|
|
Prepublished online as a Blood First Edition Paper on January 9, 2003; DOI 10.1182/blood-2002-06-1847.
 Previous Article | Table of Contents | Next Article 
Blood, 1 May 2003, Vol. 101, No. 9, pp. 3477-3484
HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY
Role of the intracellular domains of GPIb in controlling the
adhesive properties of the platelet GPIb/V/IX complex
Christelle Perrault,
Pierre Mangin,
Martine Santer,
Marie-Jeanne Baas,
Sylvie Moog,
Susan L. Cranmer,
Inna Pikovski,
David Williamson,
Shaun P. Jackson,
Jean-Pierre Cazenave, and
François Lanza
From INSERM U311, Etablissement Français du Sang,
Alsace, Strasbourg, France; and the Australian Centre for
Blood Diseases, Department of Medicine, Monash Medical School,
Australia.
 |
Abstract |
Glycoprotein (GP) Ib/V/IX complex-dependent platelet adhesion to
von Willebrand factor (VWF) is supported by the 45-kd N-terminal extracellular domain of the GPIb subunit. Recent results with an
adhesion blocking antibody (RAM.1) against GPIb , which is disulfide
linked to GPIb, have suggested a novel function of this subunit in
regulating VWF-mediated platelet adhesion, possibly involving its
intracellular face. A putative cooperation between the GPIb and
GPIb cytoplasmic domains was investigated by measuring the adhesion
under flow to immobilized VWF of K562 and Chinese hamster ovary
(CHO) cells transfected with GPIb/(V)/IX containing mutations in this region. Adhesion of cells carrying a glycine substitution of the GPIb Ser166 phosphorylation site was 50% lower
than normal and became insensitive to inhibition by RAM.1. In contrast,
forskolin or PGE1 treatment increased both the
phosphorylation of GPIb and adhesion of control cells, both effects
being reversed by RAM.1, but had no influence on cells expressing the
Ser166Gly mutation. A role of the GPIb intracellular domain
was also apparent as the VWF-dependent adhesion of cells containing
deletions of the entire ( 518-610) or portions (535-568,
569-610) of the GPIb cytoplasmic tail was insensitive to RAM.1
inhibition. Cells carrying progressive 11 amino acid deletions spanning
the GPIb 535-590 region were equally unresponsive to RAM.1, with the
exception of those containing GPIb 569-579, which behaved like
control cells. These findings support a role of the GPIb
intracellular domain in controlling the adhesive properties of the
GPIb/V/IX complex through phosphorylation of GPIb Ser166 and point
to the existence of cross-talk between the GPIb and GPIb
intracellular domains.
(Blood. 2003;101:3477-3484)
© 2003 by The American Society of Hematology.
| |
Introduction |
Platelets play an essential role in hemostasis by
adhering to injured blood vessels where they become activated and
aggregate.1 The glycoprotein (GP) Ib/V/IX receptor
mediates the initial adhesion of platelets by binding to von Willebrand
factor (VWF) exposed on the subendothelium of the damaged vessel
wall.2 This interaction is capable of withstanding high
shear forces, which is necessary for its function of tethering
platelets in rapidly flowing blood.3,4
The GPIb/V/IX receptor belongs to the leucine-rich repeat glycoproteins
and is composed of GPIb, disulfide linked to GPIb to form GPIb,
which is noncovalently associated with GPIX and GPV on the platelet
surface.5-7 The GPIb (610 amino acids) adhesive subunit
binds to VWF through its 45-kd globular extracellular domain,8,9 while its 96-residue cytoplasmic domain binds to filamin-1 (or ABP-280) through the 557-579 region10,11
and to adaptor protein 14.3.3 through the 605-610 region.12,13 These interactions serve to anchor the
receptor to the cytoskeleton, regulate VWF-dependent adhesion under
flow, and transduce signals necessary for IIb3 integrin
activation.14-18 The roles of the other subunits are less
well established apart from the requirement for GPIb and GPIX for
correct processing and surface expression of the
complex.19,20 These 2 subunits have similar extracellular sequences but differ in their intracellular domains of 34 and 6 residues, respectively. The GPIb intracellular serine at position 166 can be phosphorylated by a cyclic adenosine monophosphate (cAMP)-dependent kinase (PKA), a process thought to facilitate interaction with 14.3.3.13,21,22 More recently,
calmodulin has been proposed as a third intracellular partner of
GPIb/V/IX with binding sites identified in GPIb and
GPV.23
In a previous report, we described a monoclonal antibody (MoAb) RAM.1
against the GPIb extracellular domain that inhibited VWF-mediated
adhesion of platelets and GPIb/V/IX-transfected K562 cells under
flow.24 The mechanism controlling this effect of RAM.1 was
unknown but suggested a role of GPIb in regulating GPIb/V/IX-dependent adhesion to VWF. In the present study, we tested
the possibility that the inhibition of the GPIb-VWF interaction by
RAM.1 was conveyed by the GPIb intracellular domain. Studies of
adhesion to immobilized VWF in a flow system were performed using K562
and Chinese hamster ovary (CHO) cells transfected with GPIb/(V)/IX containing mutations and deletions in the intracellular domains of GPIb and GPIb. The participation of cAMP-dependent phosphorylation of GPIb was also evaluated. Evidence was found that
efficient cell tethering and sensitivity to inhibition by RAM.1 require
an intact serine at position 166 of GPIb and are regulated by the
level of phosphorylation. Moreover, deletions of the GPIb
intracellular region caused loss of the effect of RAM.1, suggesting a
functional communication between the GPIb and GPIb subunits.
| |
Materials and methods |
Materials
Cell culture reagents were from Life Technologies GIBCO BRL
(Cergy-Pontoise, France) except for FuGene transfection reagent (Roche
Diagnostic, Meylan, France), methotrexate (France Biochem, Meudon,
France), and Zeocin (Invitrogen, San Diego, CA). Forskolin, prostaglandins E1 (PGE1) and I2 (PGI2), normal
goat serum (NGS), fatty acid-free human serum albumin (HSA), bovine
serum albumin (BSA), and protein G-sepharose were from Sigma Aldrich
(St Louis, MO). Apyrase was purified from potatoes as previously
described.25 Human VWF and bovine VWF were prepared
according to published procedures.15,26 The
cAMP(125I) assay kit and phosphorus-32
([32P]PO4) were from Amersham Pharmacia
Biotech (Uppsala, Sweden). Fluorescein isothiocyanate
(FITC)-conjugated goat anti-mouse immunoglobulin G (IgG) and
FITC-conjugated goat F(ab')2 fragments anti-rat IgG were
from Jackson ImmunoResearch (West Grove, PA). Purified rat IgG1 was
from Pharmingen (Le Pont de Claix, France) and the murine MoAb SZ2
against human GPIb was from Immunotech (Marseille, France). Different MoAbs were produced in our laboratory as IgG1,  isotype. Mouse MoAbs ALMA.12 and ALMA.19 are directed against human GPIb, ALMA.16 against human GPIX, and V.1 against human GPV. RAM.1 is a rat
MoAb directed against mouse and human GPIb.24 Complete protease inhibitor cocktail and calpain inhibitor 1 were from Roche
Molecular Biochemicals (Mannheim, Germany).
Platelets and cell lines
Human platelets were isolated from acid-citrate-dextrose
anticoagulated blood obtained from aspirin-free healthy volunteers and
washed by sequential centrifugation in Tyrode buffer containing 5 mM
HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid), pH 7.35, 0.35% HSA, and 0.5 µM PGI2.25 The platelets
were finally resuspended at 3 × 105
platelets/µL in the same buffer lacking PGI2 and
containing 0.04 U/mL apyrase.
CHO cell lines expressing the GPIb/IX complex with deletions of the
GPIb intracellular domain have been reported
previously.27,28 K562 cell lines expressing the GPIb/V/IX
complex with deletions of the GPIb intracellular domain (518-610,
535-568, 569-610) were obtained by cotransfection of plasmids
coding for wild-type GPIb, GPIX, and GPV essentially as described
earlier.15,27 To obtain a cell line containing a Ser166Gly
mutation of GPIb, K562 cells were transfected with a pSVZeo plasmid
containing GPV cDNA and pDX expression plasmids individually containing
cDNAs for GPIb, GPIX, and mutated GPIb with glycine at position
166 using the U-DNA Mutagenesis kit (Boehringer Mannheim,
Germany).29 GPIb primers
1241CAGCGGGTCGGTCAGACCCAGCCGGGCTGC1212
and
1212GCAGCCCGGCTGGGTCTGACCGACCCGCTG1241
containing the mutation (underlined) were each annealed with full-length GPIb inserted into the EcoRI sites of M13.
M13 single- and second-strand DNA synthesis was performed using T4
ligase and polymerase. After sequencing, the mutated GPIb was
reinserted into pDX. CHO-GPIb/IX cells were cultured in minimum
essential medium (MEM) supplemented with 10% fetal calf serum
(FCS), PSG mix (100 U/mL penicillin, 100 µg/mL streptomycin, 2 mM
glutamine), and 400 µg/mL G418. K562-GPIb/V/IX cells were cultured in
RPMI 1640 medium containing 10% FCS, PSG mix, and 200 µg/mL Zeocin.
Measurement of intracellular cAMP
Transfected cells (1.5 × 105 in 0.5 mL)
or platelets (9 × 107 in 0.5 mL) were incubated at
37°C with forskolin (10 µM or 50 µM) for 1 hour or with
adrenaline (10 µM) or PGE1 (10 µM) for 5 minutes.
Treatment was stopped by adding 50 µL of ice-cold 6 N perchloric acid
and cAMP was isolated from the supernatant by extraction with a mixture
of trioctylamine and freon (28/22 vol/vol). Following centrifugation at
12 000 rpm for 4 minutes at 4°C, the upper aqueous phase was
recovered and lyophilized. The dry residue was dissolved and cAMP was
quantified with a commercial cAMP(125I) assay kit.
32P phosphorylation studies
K562-GPIb/V/IX, K562-GPIb(Ser166Gly)/V/IX cells
(106 cells/mL), and washed human platelets
(109/mL) in Tyrode buffer lacking PO4 and
PGI2 were labeled for either 15 minutes with 100 µCi/mL (3.7 MBq) [32P]PO4 (K562 cells) or
one hour with 0.2 mCi/mL (7.4 MBq) [32P]PO4
in the presence of 0.04 U/mL apyrase (platelets) at 37°C. After 2 washes, cells were first incubated with 10 µg/mL of RAM.1 or its
isotypic control rat IgG1 for 30 minutes and then treated with 10 µM
PGE1 or 10 µM forskolin for 10 minutes at 37°C.
Following centrifugation, platelets were lysed by addition of 3 N
perchloric acid and K562 cells by incubation with a ice-cold Triton
X-100 lysis buffer containing protease inhibitors, 50 mM NaF, and 2.5 mM Na3VO4 for 20 minutes. After centrifugation
at 15 000 rpm, proteins were immunoprecipitated by RAM.1 coupled to
protein G-sepharose for 2 hours. Proteins were separated on a 7.5% to
15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) gel. The dried gel was exposed for autoradiography or
analyzed in a phosphoimager system (BioRad, Hercules, CA).
Flow cytometry
K562 or CHO cells (2 × 105 in 100 µL)
were incubated for 30 minutes at 4°C with purified IgG (10 µg/mL)
in FMF buffer (RPMI medium, 5% NGS, 0.2% sodium azide). After
centrifugation at 1200 rpm, the cells were resuspended in buffer
containing a 100-fold dilution of FITC-conjugated goat
F(ab')2 anti-rat IgG or FITC-conjugated goat IgG
anti-mouse IgG for 30 minutes at 4°C. Analyses were performed on
10 000 cells in a FACSCalibur flow cytometer (BD Biosciences, Rungis, France).
Adhesion assays in a flow system
Adhesion of cells under flow conditions was investigated
according to Cranmer et al,15 using glass microcapillary
tubes (Vitro Dynamics, Mountain Lakes, NJ) coated overnight at 4°C in a humid chamber with either 1% HSA or 25 µg/mL bovine or human VWF
in phosphate buffered saline (PBS) and postcoated for one hour at room
temperature with 1% HSA. Cells (1 × 106/mL) or
platelets (3 × 108/mL) in Tyrode buffer containing 2 mM
EDTA (ethylenediaminetetraacetic acid) were perfused through the
capillaries at a shear rate of 150 s-1 for 10 minutes. The
effects of MoAbs (10 µg/mL) were tested by preincubation with the
cells for 10 minutes at room temperature. Cell adhesion was visualized
at 10-fold magnification by video microscopy (Leica DMIRB; Leica
Microsystems SA, Wetzlar, Germany). The images were recorded for
subsequent analysis on an AV disc recorder WDR 200 (Matsushita Electric
Industrial, Osaka, Japan). Under these conditions, cells tethered and
rolled over the surface. The number of adherent rolling cells counted
in fields of 1 mm2 progressively accumulated from zero to a
maximum that the matrix concentration can support. EDTA was included as
a standard condition for comparison between cell types, as it is
problematic to specifically inhibit endogenous integrins in CHO cells
due to lack of appropriate antibodies or antagonists. Adhesion of
K562-GPIb/V/IX cells was identical in the presence or absence of EDTA,
in keeping with the lack of endogenous integrins able to bind VWF. In
some studies the microcapillary tube was perfused with cell-free buffer
at the end of a 5-minute perfusion at 75 s-1 and the shear
rate was increased incrementally to 150 s-1, 300 s-1, 750 s-1, 1500 s-1, 3000 s-1, and 6000 s-1. At each shear rate the field
was taped for 2 minutes and the number of adherent cells was
quantitated off-line.
Statistical analyses
The statistical significance of differences between means was
evaluated using the Student t test for paired samples and
P values of less than .05 were considered to be significant.
Variations of means were calculated as the standard deviation.
| |
Results |
RAM.1 inhibits adhesion of platelets and GPIb/(V)/IX-transfected
cells to bovine or human VWF
RAM.1 inhibited adhesion of K562-GPIb/V/IX cells to bovine VWF
under flow (Figure 1A) and also decreased
adhesion of platelets and CHO-GPIb/IX cells by 50% (Figure 1B-C). When
experiments were performed with human VWF, fewer platelets and
transfected cells were captured than on bovine VWF,15 and
pretreatment with RAM.1 strongly inhibited or abolished adhesion. These
results obtained with different cells and VWF matrixes supported our
original proposal that RAM.1-occupied GPIb down-regulates
GPIb-VWF interactions.
View larger version (22K):
[in this window]
[in a new window]
| Figure 1.
Effects of RAM.1 on GPIb-dependent adhesion to
bovine and human VWF under flow conditions.
K562-GPIb/V/IX cells (A), CHO-GPIb/IX cells (B), or human
platelets (C) were perfused through microcapillaries coated with 25 µg/mL bovine VWF (BVWF, upper panels) or human VWF (HVWF, lower
panels). Cells (1 × 106/mL) or platelets
(4 × 108/mL) resuspended in Tyrode buffer were
preincubated for 10 minutes with 10 µg/mL RAM.1 ( ) or control rat
IgG1 ( ) and perfused at a shear rate of 150 s-1 for 10 minutes. The number of adherent cells per field was counted off-line at
the indicated times. ( ) indicates adhesion to albumin-coated control
microcapillaries. The rate and extent of adhesion of transfected cells
or platelets was decreased by RAM.1 treatment and this effect was more
pronounced on human VWF (approximately 90%-100% inhibition) than on
bovine VWF (50% inhibition). Results are expressed as the means ± SEM of 4 separate experiments performed in
duplicate.
|
|
GPIb Ser166 is required for efficient GPIb-dependent adhesion
and the inhibitory effect of RAM.1
The role of the GPIb intracellular domain in mediating
the effect of RAM.1 was assessed in experiments using cells expressing GPIb/V/IX with a GPIb(Ser166Gly) mutation
(K562-GPIb(Ser166Gly)/V/IX cells). Ser166 was selected because of
its reported phosphorylation by a cAMP-dependent kinase,21
a process favoring 14.3.3 binding.22 Adhesion of
K562-GPIb(Ser166Gly) cells to bovine or human VWF was approximately
50% less than that of cells containing the wild-type complex
(P < .05) (Figure 2).
Interestingly, adhesion of K562-GPIb(Ser166Gly)/V/IX cells was not
modified by RAM.1 treatment. A similar decrease in
adhesion was observed when the GPIb(Ser166Gly) mutation was introduced into CHO-GPIb/IX cells (data not shown).
View larger version (13K):
[in this window]
[in a new window]
| Figure 2.
Decreased adhesion to VWF and insensitivity to RAM.1 of
GPIb/V/IX cells containing a GPIb(Ser166Gly) mutation.
K562 cells expressing the wild-type complex (GPIb/V/IX) or
containing a Ser166Gly mutation of GPIb (GPIb(Ser166Gly)/V/IX)
were perfused over a bovine (BVWF) or human VWF (HVWF) matrix at a
shear rate of 150 s-1 as described in Figure 1. The cells
were preincubated with 10 µg/mL RAM.1 () or control rat IgG1 ()
for 10 minutes before perfusion through the VWF-coated capillaries. The
number of adherent cells was counted off-line at 10 minutes. Adhesion
to HSA was less than 5 cells/field. Cells containing the
GPIb(Ser166Gly) mutation had approximately half the adhesive
capacity of control cells on bovine or human VWF and this residual
adhesion was unaffected by RAM.1 treatment. Results are expressed as
the mean ± SEM of 3 separate experiments.
*P < .05.
|
|
To evaluate the effect of the mutation on adhesion at high shear,
K562-GPIb/V/IX cells were preadhered at low shear (75 s-1)
and then exposed to incremental increases in shear rates (Figure 3). Cells with the GPIb(Ser166Gly)
mutation were more easily detached than wild-type cells, such that
approximately 55% of mutant cells were detached at 6000 s-1 compared with only 20% of wild-type cells. Defective
adhesion under static or flow conditions was not due to lower levels of GPIb as the 2 cell lines displayed comparable surface expression of
the 4 subunits (Figure 4A, upper
panels).
View larger version (11K):
[in this window]
[in a new window]
| Figure 3.
Decreased resistance to detachment of GPIb/V/IX cells
containing a GPIb(Ser166Gly) mutation.
K562-GPIb/V/IX (WT; ) or
K562-GPIb(Ser166Gly)/V/IX () cells were perfused for 5 minutes at
75 s-1 over a bovine (BVWF) matrix followed by perfusion of
buffer with incremental increases in shear rates up to 6000 s-1. At each shear rate the number of adherent cells was
counted and expressed as percent of adherent cells relative to the
number of adherent cells found at 75 s-1. Results are
expressed as the mean ± SEM of 3 separate experiments.
|
|
View larger version (38K):
[in this window]
[in a new window]
| Figure 4.
Treatment with forskolin or PGE1 increases
cAMP in K562-GPIb/V/IX cells without changing receptor surface
expression.
(A) K562-GPIb/V/IX and K562-GPIb(Ser166Gly)/V/IX cells
(1 × 106/mL) were treated (+Fsk) or not (-Fsk)
with 50 µM forskolin. GPIb/V/IX cell surface expression was then
analyzed by flow cytometry after incubation with 10 µg/mL of ALMA.12
against GPIb (thick black line), RAM.1 against GPIb (gray line),
ALMA.16 against GPIX (thin black line), V.1 against GPV (stippled
line), or control MOPC21 (filled gray histogram). Histograms are
representative of 2 separate experiments. (B) K562-GPIb/V/IX and
K562-GPIb(Ser166Gly)/V/IX cells were treated with 10 µM ( ) or
50 µM () forskolin (Fsk) for one hour at 37°C, or with 10 µM
PGE1 (PGE1) or 10 µM adrenaline (Adr) for 3 to 5 minutes at 37°C. Levels of cAMP were determined with a cAMP
(125I) assay system and results are expressed as the
mean ± SEM of 3 separate experiments. Surface expression of
GPIb/V/IX was not affected by forskolin treatment, although forskolin
and PGE1 increased cAMP levels in both cell
lines.
|
|
GPIb-dependent adhesion to VWF is increased by raising cAMP
levels
Since results for the GPIb(Ser166Gly) mutant cells indicated
that lack of GPIb phosphorylation decreased adhesion efficiency, the
consequences of increased phosphorylation were investigated by treating
K562 cells expressing the wild-type or mutated complex with forskolin
or PGE1. A 6-fold increase in cAMP levels using 50 µM forskolin and a 2-fold increase using 10 µM forskolin or PGE1 was observed in both cell lines (Figure 4B), whereas
treatment with either reagent had no effect on surface expression of
GPIb/V/IX as confirmed by fluorescence activated cell sorting
(Figure 4A).
The level of GPIb phosphorylation was evaluated by 32P
incorporation in platelets and K562-GPIb/V/IX cells. At a resting
state, only a very low level of phosphorylation was observed in both platelets and cell lines (Figure 5).
Treatment with forskolin or PGE1 increased phosphorylation
of GPIb in platelets and cells expressing the wild-type complex and
this effect was reversed by treatment with RAM.1. GPIb was not
phosphorylated in cells expressing the Ser166Gly mutation.
View larger version (44K):
[in this window]
[in a new window]
| Figure 5.
Treatment with forskolin or PGE1 increases
phosphorylation of GPIb in GPIb/V/IX-transfected cells and
platelets, an effect reversed by RAM.1.
K562-GPIb/V/IX, K562-GPIb(Ser166Gly)/V/IX cells, or human platelets
were labeled with [32P]PO4, then
preincubated with 10 µg/mL RAM.1 (+) or rat control IgG (-) and
treated with dimethyl sulfoxide (resting), 10 µM
PGE1 (+PGE1), or 10 µM forskolin (+Fsk) for
10 minutes at 37°C. Following cell lysis, the GPIb/V/IX complex was
immunoprecipitated by RAM.1 and proteins were separated on a 7.5%-15%
SDS-PAGE gel. Gels were analyzed by autoradiography or using the
phosphoimager system. Results are representative of 2 separate
experiments. Forskolin or PGE1 treatment increased the
GPIb phosphorylation on both platelets and K562-GPIb/V/IX cells
whereas RAM.1 switched it off. In contrast, forskolin and
PGE1 had no effect on phosphorylation of the
GPIb(Ser166Gly) subunit.
|
|
Adhesion on VWF of platelets (Figure 6),
and of cells transfected with the wild-type complex (Figures
7 and 8), was increased following
treatment with forskolin or
PGE1 compared with untreated cells. Adhesion of platelets
was increased to a similar extent with either forskolin or
PGE1. Cells incubated with the higher concentration of
forskolin adhered more efficiently (70%-100% increase,
P < .01) than those incubated with the lower
concentration of forskolin or with PGE1
(P < .05). In contrast, forskolin or PGE1
treatment did not influence adhesion of cells expressing the
GPIb(Ser166Gly) mutation, despite identical rises in cAMP (Figures
4B, 7, and 8). The effect of forskolin was completely abolished when
K562-GPIb/V/IX cells were first treated with RAM.1 (P < .01) and adhesion levels were identical to those of
cells treated with RAM.1 in the absence of forskolin (Figure
7B).
View larger version (15K):
[in this window]
[in a new window]
| Figure 6.
Effect of treatment with forskolin or PGE1
on platelet adhesion to VWF.
Washed human platelets (3 × 108/mL) were perfused for 5 minutes at a shear rate of 150 s-1 through microcapillaries
coated with 1% HSA ( ) or 25 µg/mL bovine VWF (, , ). The
cells were pretreated with 10 µM PGE1 (), 10 µM
forskolin (), or buffer (). Adherent platelets were counted
off-line at the indicated times and results are expressed as the
mean ± SEM of 2 separate experiments.
|
|
View larger version (24K):
[in this window]
[in a new window]
| Figure 7.
Effect of forskolin on adhesion of K562-GPIb/V/IX cells
to VWF under flow, sensitivity to RAM.1 treatment.
Adhesion of K562-GPIb/V/IX and K562-GPIb(Ser166Gly)/V/IX cells to
microcapillaries coated with bovine VWF was followed for 10 minutes at
a shear rate of 150 s-1. Adherent cells were counted
off-line at the indicated times. (A) Cells were left untreated ( ) or
incubated for one hour at 37°C with 10 µM
( ) or 50 µM ( ) forskolin (Fsk). (B) Cells incubated or not with 50 µM forskolin were further incubated for 10 minutes with 10 µg/mL
RAM.1 or control rat IgG1 and perfused through bovine VWF-coated
capillaries. Results are expressed as the mean ± SEM of 3 separate experiments; * P < .05, **
P < .01. Treatment with forskolin significantly increased
adhesion of cells transfected with the wild-type complex
(P < .05), but had no effect on the adhesion of
GPIb(Ser166Gly) mutant cells. In K562-GPIb/V/IX cells, RAM.1
treatment abolished the effect of forskolin.
|
|
View larger version (15K):
[in this window]
[in a new window]
| Figure 8.
Effect of PGE1 on adhesion of K562-GPIb/V/IX
cells to VWF.
K562-GPIb/V/IX and K562-GPIb(Ser166Gly)/V/IX cells
(1 × 106/mL) were perfused for 10 minutes at a
shear rate of 150 s-1 through microcapillaries coated with
1% HSA () or 25 µg/mL bovine VWF (,, ). The cells were
pretreated with 10 µM PGE1 (), 10 µM adrenaline
(), or buffer (). Adherent cells were counted off-line at the
indicated times and results are expressed as the mean ± SEM of 4 separate experiments. PGE1 treatment increased adhesion of
K562 cells transfected with the wild-type complex but had no effect on
the adhesion of cells expressing the GPIb Ser166Gly
mutant.
|
|
The GPIb intracellular domain is required to mediate the
effect of RAM.1
The finding of a regulatory role of the GPIb intracellular
domain and its close proximity to the GPIb subunit suggested the
possible involvement of the GPIb intracellular domain in RAM.1
inhibition. Hence, flow studies were carried out using cells containing
deletions of the entire (518-610), central (535-568), or
C-terminal (569-610) portion of the GPIb intracellular domain. All 3 cell lines adhered with comparable efficiency and displayed kinetics similar to those of cells expressing the normal complex (Figure 9), in agreement with results for
transfected CHO cells.15 Contrary to K562 cells expressing
the wild-type GPIb/V/IX complex, the 3 cell lines containing GPIb
deletions did not exhibit any decrease in adhesion in the presence of
RAM.1. This lack of sensitivity to RAM.1 was also observed in
CHO-GPIb/IX cells expressing the same deletions (Figure
10).
View larger version (26K):
[in this window]
[in a new window]
| Figure 9.
Effect of RAM.1 on adhesion of K562-GPIb/V/IX cells
containing deletions in the intracellular domain of GPIb.
Adhesion of K562 cells expressing GPIb/V/IX containing wild-type
GPIb (WT) or GPIb with deletions of the entire intracellular
domain (518-610) or of residues 535-568 (535-568) or 569-610 (569-610) was followed in microcapillaries coated with 1% HSA ()
or 25 µg/mL bovine VWF (,). The cells (1 × 106/mL) were perfused through the capillaries for
10 minutes at a shear rate of 150 s-1 after preincubation
for 10 minutes with 10 µg/mL RAM.1 () or control rat IgG1 ().
Adherent cells were counted off-line at the indicated times and results
are expressed as the mean ± SEM of 4 separate experiments. None
of the deletions of the GPIb intracellular region affected the
kinetics and levels of adhesion as compared with cells containing the
wild-type complex. However, all 3 mutants were resistant to treatment
with RAM.1, unlike cells expressing the wild-type GPIb
sequence.
|
|
View larger version (18K):
[in this window]
[in a new window]
| Figure 10.
Effect of RAM.1 on adhesion of CHO-GPIb/IX cells
containing progressive 11 amino acid deletions in the 535-590 intracellular domain of GPIb.
CHO cells stably expressing GPIb/IX were transfected with GPIb
containing the deletions 535-568, 569-610, 535-545,
546-556, 557-568, 569-579, and 580-590. The cells were
preincubated for 10 minutes with 10 µg/mL RAM.1 () or control rat
IgG1 () and perfused through microcapillaries coated with bovine VWF
at a shear rate of 150 s-1 for 10 minutes. Adherent cells
were counted off-line at 10 minutes and results are expressed
as the mean ± SEM of 4 separate experiments; *
P < .05. Cells carrying mutant GPIb displayed
comparable levels of adhesion in the presence or absence of RAM.1,
except those containing 569-579, which behaved like control cells
and exhibited approximately 50% lower adhesion in the presence of
RAM.1.
|
|
In an attempt to identify discrete residues required for transmission
of the inhibitory effect of RAM.1, experiments were performed using
cells containing progressive 11-12 amino acid deletions in the 535 to
590 region of GPIb. As previously reported,11 comparable levels of adhesion were observed for control cells and all
cell lines expressing deletions (Figure 10). Pretreatment of these
cells with RAM.1 did not significantly influence their kinetics and
levels of adhesion, with the exception of the 569-579 clone, which
displayed 50% lower adhesion and behaved similarly to cells containing
the wild-type complex. These results indicate that a major portion of
the intracellular domain of GPIb is required to convey the
inhibitory signal triggered by RAM.1.
| |
Discussion |
This study supports a functional role of GPIb and the
involvement of its intracellular domain in regulating GPIb-dependent adhesion to VWF. Experiments with the MoAb RAM.1 directed against the
extracellular domain of GPIb and with cell lines expressing the
GPIb/V/IX complex containing mutations in the intracellular domain of
GPIb or GPIb provided evidence for (1) a regulatory role of
GPIb, which is dependent on the degree of phosphorylation of Ser166
in the intracellular domain and (2) cross-talk between GPIb and
GPIb, requiring an intact GPIb intracellular domain.
Our original observation that RAM.1 inhibited platelet VWF binding,
VWF-induced aggregation, and adhesion to a VWF matrix was unexpected
because GPIb was viewed as the only subunit capable of mediating
platelet interactions with VWF. This study confirms and extends our
previous results by demonstrating an effect of RAM.1 independent of the
cell type, leading to inhibition of the adhesion of not only platelets
but also K562-GPIb/V/IX- and CHO-GPIb/IX-transfected cells. A further
observation is that RAM.1 was a more efficient inhibitor when
experiments were carried out using a human VWF matrix (70%-80%
inhibition) rather than bovine VWF (50% inhibition), in keeping with
the lower capturing efficiency of the human matrix.15 These results did not yet clarify the roles played by each subunit of
the GPIb/V/IX complex and which domains were involved in conveying the
negative signal of RAM.1.
Since GPIb has no direct VWF binding properties, we hypothesized
that RAM.1 could act indirectly by modifying GPIb-dependent adhesion. Intracellular regulation of GPIb-dependent binding has
been recently suggested in relation to its association with the
cytoskeleton or adaptor proteins.15,28,31 A possible
mechanism that was tested in this study was that GPIb could
cooperate with GPIb intracellularly. Reports of binding sites for
the dimeric 14.3.3 adaptor protein on the GPIb (amino acid [aa]
605-610) and GPIb (aa 160-175) intracellular domains suggested a
putative link between the 2 subunits.12,13 The 14.3.3
binding site on GPIb includes a serine at position 166, a residue
phosphorylated by a cAMP-dependent mechanism.21
Interestingly, we found that blocking GPIb Ser166 phosphorylation
with a glycine substitution decreased cell adhesion to VWF and the
remaining adhesion was unaffected by treatment with RAM.1. This
indicated that optimal adhesion and sensitivity to RAM.1 both required
phosphorylation at position 166 of GPIb. It also suggested that a
basal level of adhesion provided by GPIb could be independent of its
association with GPIb. Confirmation of the latter in a cellular
system would require testing cells lacking the whole GPIb subunit.
In the absence of GPIb, levels of GPIb surface expression are,
however, too low in our experience to allow sufficient cell attachment and a meaningful comparison.
One possible explanation for the decreased adhesion of the
GPIb(Ser166Gly) mutant could relate to defective 14.3.3 binding. However, we observed normal GPIb/IX-14.3.3 coprecipitation in the
GPIb(Ser166Gly) cell line (P.M., unpublished
results, March 2002) and similar replacement of Ser166 by
alanine only reduced interaction with 14.3.3 in a 2-hybrid system by
20% to 40%.30 Furthermore, several deletions of GPIb
that completely prevented 14.3.3 binding did not modify adhesion as
compared with cells expressing the wild-type complex.31 On
the other hand, increasing GPIb Ser166 phosphorylation has been
reported to enhance binding of GPIb to 14.3.3. In this study,
treatment of platelets, CHO cells, or K562 cells expressing GPIb/(V)/IX
with forskolin or PGE1 significantly increased
phosphorylation of GPIb and adhesion to VWF, demonstrating the
regulatory importance of this phosphorylated residue. RAM.1 treatment
reversed these effects, suggesting that sensitivity to RAM.1 correlates
with the degree of GPIb Ser166 phosphorylation. In these conditions,
phosphorylation of GPIb seems to provide optimal initial interaction
between GPIb/V/IX and VWF.
These results would appear to contradict an earlier report of decreased
shear-induced aggregation of platelets treated with PGI2,
another PKA activator,22 or a recently published report of
decreased VWF-dependent adhesion of platelets and CHO-GPIb/IX treated
with forskolin.32 Shear-induced aggregation results from
both GPIb-VWF interaction and IIb3 integrin activation, which is
down-regulated by agents raising cAMP. We examined adhesion of
GPIb/(V)/IX-transfected cells under conditions independent of integrin
mobilization. In the more recent study, adhesion of platelets (but not
that of GPIb/IX-transfected cells) was performed in the
presence of integrin blockade. An important difference relates to the
level of GPIb phosphorylation observed in platelets and
GPIb/IX-transfected cells. Bodnar et al32 using a
phosphopeptide-specific antibody concluded on a high level of GPIb
phosphorylation in platelets and full phosphorylation in CHO-GPIb/IX
cells at a resting state and proposed that this was responsible for the
low adhesion efficiency of the CHO-GPIb/IX cells. It is our observation
and that of other groups that GPIb/(V)/IX-transfected cells have
acquired the ability to efficiently bind and/or adhere to
VWF.14,15,33 In this study we observed, using direct
measurement of 32P incorporation, only a very low level of
GPIb phosphorylation in resting platelets,
K562-GPIb/V/IX-transfected cells (Figure 5), and CHO-GPIb/IX cells
(data not shown), and that all 3 cells have an intrinsic capacity to
bind VWF and adhere under flow conditions, which is further enhanced by
PGE1 or forskolin treatment.
The results obtained with RAM.1 and mutant GPIb suggested a model
whereby direct or indirect interaction of the GPIb intracellular domain with GPIb would modulate VWF-dependent adhesion. Studies of
cells expressing complete or partial deletions of the GPIb intracellular sequence showed that this domain was essential to sustain
RAM.1 inhibition and pointed to the existence of cross-talk between the
GPIb and GPIb intracellular domains. This was indicated by the
normal levels of adhesion of all cell lines containing mutant
receptors, which became completely resistant to inhibition by RAM.1
despite normal binding of the MoAb. Only one construct behaved like the
wild-type sequence, the GPIb569-579 deletion. Hence, no discrete
subdomain could be pinpointed for the effect of RAM.1, which appears to
require most of the intracellular sequence of GPIb.
The normal adhesion and absence of sensitivity to RAM.1 of cells
lacking the intracellular region of GPIb suggest that this domain
could negatively control VWF-dependent adhesion. According to this
model, an increase in cAMP would relieve the control by phosphorylating
GPIb Ser166. Another possibility is that cAMP could phosphorylate
the GPIb intracellular domain that contains 8 threonine and 10 serine residues. To date only Ser609 at the C-terminal end of
GPIb has been found to be phosphorylated in platelets under resting
conditions and was proposed to bind 14.3.3 and regulate platelet
adhesion.34 Several deletions of GPIb that prevent
RAM.1 inhibition such as GPIb557-568 and 535-568 have also
been reported to prevent interaction with filamin-1,28 suggesting that it could be involved in transmitting the effect of
RAM.1. However, other deletions that preserve normal filamin-1 binding,
such as GPIb591-610, 535-545, 546-556, and 580-590, also
fail to exhibit inhibition by RAM.1. Moreover, the fact that filamin-1
interacts with the GPIb intracellular region but not with GPIb
does not support a role of filamin as a functional switch between the
2 subunits.
As stated earlier, 14.3.3 binds to and could bridge the GPIb and
GPIb subunits. However, mutations of GPIb Ser166 and deletions in
the 535-568 region of GPIb, both preserving 14.3.3 binding,31 were refractory to the effect of RAM.1, which
does not favor involvement of the adaptor protein. Calmodulin has
recently been identified as a third intracellular binding partner of
the GPIb/V/IX complex,23 but its apparent lack of
interaction with GPIb would exclude a role in bridging to the
GPIb subunit.
The exact mechanism by which RAM.1 regulates the adhesive properties of
GPIb is still not clear but could involve decreases in
affinity or avidity for VWF. Gain-of-function mutations within the
cysteine loops in platelet-type von Willebrand disease
(GPIbGly233Val, Met239Val) suggest that GPIb could exist
in at least 2 conformational states (low and high
affinity).35 Furthermore, an intramolecular interaction
between the 1-81 and 201-268 regions of resting GPIb was recently
identified and could be destroyed by addition of ristocetin or
application of shear.36 The recently published crystal
structure of the GPIb N-terminal domain is compatible with regulated
exposure of the VWF binding site by an unmasking mechanism.37,38 This raises the possibility of an
inside-out regulation of the adhesive properties of GPIb as has been
documented for other adhesive receptors. For example, deletions within
the intracellular domain of selectins affect cell rolling and
attachment on their counterreceptors.39 Intracellular
deletions in the or subunits of integrin heterodimers can
negatively or positively influence their adhesive properties and
binding affinity.40 Opposite effects of RAM.1 treatment or
GPIb phosphorylation on VWF binding could potentially result in
similar opening or closure of a GPIb binding cavity.
| |
Acknowledgments |
The authors thank G. Kauffenstein for advice in measurement of
intracellular cAMP and J. Mulvihill for correcting the English of
the manuscript.
| |
Footnotes |
Submitted June 24, 2002; accepted December 13, 2002.
Prepublished
online as Blood First Edition Paper, January 9, 2003; DOI
10.1182/blood-2002-06-1847.
S |
Top
Abstract
Introduction