Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Prepublished online as a Blood First Edition Paper on January 2, 2003; DOI 10.1182/blood-2002-10-3116.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2002-10-3116v1
101/9/3492    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Neerman-Arbez, M.
Right arrow Articles by Morris, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Neerman-Arbez, M.
Right arrow Articles by Morris, M. A.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Brief Reports
Right arrow Clinical Trials and Observations
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 1 May 2003, Vol. 101, No. 9, pp. 3492-3494

HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY
Brief report

Prenatal diagnosis for congenital afibrinogenemia caused by a novel nonsense mutation in the FGB gene in a Palestinian family

Marguerite Neerman-Arbez, Dung Vu, Bassam Abu-Libdeh, Isabelle Bouchardy, and Michael A. Morris

From the Division of Medical Genetics, University Medical School and University Hospital, Geneva; Division of Angiology and Hemostasis, University Hospital, Geneva, Switzerland; and the Department of Pediatrics and Genetics, Makassed Hospital, Jerusalem, Israel.


    Abstract
Top
Abstract
Introduction
Study design
Results and discussion
References

Congenital afibrinogenemia is a rare autosomal recessive disorder characterized by the complete absence of detectable fibrinogen. We previously identified the first causative mutations for this disease, homozygous deletions of approximately 11 kb of the fibrinogen alpha chain gene (FGA). Subsequent analyses revealed that most afibrinogenemia alleles are truncating mutations of FGA, although mutations in all 3 fibrinogen genes, FGG, FGA and FGB have been identified. In this study, we performed the first prenatal diagnosis for afibrinogenemia. The causative mutation in a Palestinian family was a novel nonsense mutation in the FGB gene, Trp467Stop (W467X). Expression of the Trp467Stop mutant FGB cDNA in combination with wild-type FGA and FGG cDNAs showed that fibrinogen molecules containing the mutant beta chain are not secreted into the media. The fetus was found to be heterozygous for the Trp467Stop mutation by direct sequencing and by linkage analysis, a result that was confirmed in the newborn by intermediate fibrinogen levels. (Blood. 2003;101:3492-3494)

© 2003 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Study design
Results and discussion
References

Congenital afibrinogenemia (Mendelian Inheritance in Man, no. 202400; http://www.ncbi.nlm.nih.gov/omim), characterized by a complete absence of detectable fibrinogen, was originally described in 1920.1 To date some 150 families with this disorder have been reported,2 with approximately 50% of cases present in consanguineous families.3 Although functional assays of clot formation are infinitely prolonged in affected individuals, the coagulation defect is surprisingly no more severe than in severe hemophilias A and B.4,5 Umbilical cord hemorrhage is often the first sign of the disorder; gum bleeding, epistaxis, menorrhagia, gastrointestinal bleeding, and hemarthrosis occur with varying intensity, and spontaneous intracerebral bleeding and splenic rupture can occur throughout life.

Fibrinogen is synthesized in the hepatocyte from 3 homologous polypeptide chains, Aalpha , Bbeta , and gamma , which assemble to form the hexameric structure (Aalpha Bbeta gamma )2. The 3 genes coding for fibrinogen gamma (FGG), alpha (FGA), and beta (FGB) are clustered in a region of approximately 50 kb on chromosome 4q28-q31.6 We previously identified the first causative mutations for this disorder.7 The genetic defect in a nonconsanguineous Swiss family was an apparently recurrent deletion of approximately 11 kb of DNA, which eliminates most of the FGA gene and so leads to a complete absence of functional fibrinogen. Since our identification of the disease locus, numerous causative mutations have been characterized in FGA (most of the cases)8,9 but also in FGG and FGB, allowing a precise molecular diagnosis for the patients, as well as prenatal diagnosis for the families concerned. In this study, the first prenatal diagnosis for afibrinogenemia was performed for a Palestinian family with 2 affected daughters.


    Study design
Top
Abstract
Introduction
Study design
Results and discussion
References

Description of family

Informed consent was obtained from the adults participating in the study. The parents were a healthy consanguineous Palestinian couple with no history of bleeding tendency. Their first conception was a miscarriage during the first trimester. The second and third conceptions produced 2 daughters who were born at term with birth weights of 2.9 and 3 kg, respectively. The bleeding tendency in the 2 daughters was noted during midinfancy (between 4 and 5 months of age) in the form of serious intracranial bleeding after nonsignificant trauma. Fibrinogen levels were undetectably low (< 50 mg/dL), establishing the diagnosis of congenital afibrinogenemia. Following diagnosis, treatment consisted of infusions of fresh frozen plasma (FFP) following any significant bleeding, approximately once every 5-6 months. No infusion was required for the last 2 years because of increased parental awareness of accident and trauma prevention. Fibrinogen levels were determined for the parents and were found to be 170 and 150 mg/dL for the mother and the father, respectively.

Mutation screening in family members

Mutation screening of the FGA, FGG, and FGB gene was performed by polymerase chain reaction (PCR) amplification of all exons and intron-exon junctions, followed by sequencing as previously described.8,10

Microsatellite analysis

The FGA intron 3 tetranucleotide repeat (FGAi3) was analyzed by PCR amplification with oligonucleotides FGA PCR2.1 (5'CCATAGGTTTTGAACTCACAG3') and FGA PCR2.2 (5'CTTCTCAGATCCTCTGACAC3') followed by denaturing polyacrylamide-urea gel electrophoresis according to standard procedures.

Amniocentesis

Amniocentesis was performed by the usual procedure at 16 weeks of gestation. Amniotic fluid cells were cultured and, after achieving adequate growth, DNA was prepared and analyzed for the mutation present in the affected daughters.

Expression and analysis of the FGB Trp467Stop mutation in COS-7 cells

The 3 human fibrinogen cDNAs, FGA, FGB, and FGG were obtained by reverse transcription-polymerase chain reaction (RT-PCR) on HepG2 cells and cloned into the pcDNA3.1/V5-His TOPO mammalian expression vector (Invitrogen, Groningen, The Netherlands). The Trp467Stop mutation was inserted in the FGB construct using the QuickChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA). Transient transfections of COS-7 cells were performed using LipofectAMINE Plus reagent (Invitrogen) according to the manufacturer's instructions. Transfections were performed in 100-mm dishes with 12 µg pcDNA3.1/V5-His TOPO vector (negative control) or with equal amounts (4 µg) of all expression vectors. In the case of the heterozygous mutant analysis, 2 µg of each Bbeta construct (wild type and mutant) was used. Cells were washed with phosphate-buffered saline (PBS) 3 hours after transfection and incubated for 18 hours in media without serum but with protease inhibitors (Complete Mini, Roche, Basel, Switzerland). Conditioned medium was centrifuged to remove cell debris, harvested, and concentrated using Ultrafree-4 5K column (Millipore, Bedford, MA) before adding reducing or nonreducing Laemmli buffer. Cells were lysed in 2 × concentrated Laemmli buffer. After boiling at 95°C for 5 minutes, samples were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (7.5% or 10%). Western blot analysis was performed using rabbit anti-human fibrinogen antibodies (Dako, Zug, Switzerland) at a 1:2500 dilution. Immunoreactive bands were revealed with an enhanced chemiluminescence kit (ECL; Amersham Pharmacia Biotech, Dübendorf, Switzerland) according to manufacturer's instructions.


    Results and discussion
Top
Abstract
Introduction
Study design
Results and discussion
References

A consanguineous Palestinian couple (first cousins) with 2 daughters with congenital afibrinogenemia requested a prenatal diagnosis for their ongoing pregnancy (Figure 1A). In the first step, DNA was extracted from fresh EDTA (ethylenediaminetetraacetic acid) blood samples from parents and affected children for identification of the causative mutation transmitted in this family. Screening of all the coding regions and exon-intron junctions for FGA (alpha  isoform, exons 1-5) and FGG by PCR and sequencing showed no mutation. Analysis of the FGB gene revealed a previously unreported nonsense mutation in the last exon, exon 8, Trp467Stop (TGG>TAG) (numbered from the first ATG codon according to guidelines for human mutation nomenclature11,12), which was found in heterozygosity in each of the parents and in homozygosity in each of the 2 affected daughters (Figure 1B).


View larger version (79K):
[in this window]
[in a new window]
 
Figure 1. Prenatal diagnosis for congenital afibrinogenemia. (A) Family tree. SA: spontaneous abortion. The arrow indicates the fetus undergoing prenatal diagnosis (proband). (B) Partial sequence of FGB exon 8 demonstrating the FGB Trp467Stop (W467X; TGG>TAG) mutation. Top panel, heterozygote; bottom panel, homozygote Trp467Stop. (C) Amino acid sequence of the fibrinogen beta chain. The Palestinian Trp467Stop mutation identified in this study is shown (bold) as well as the Trp470Stop (W470X) "fibrinogen Mount Eden" mutation19 and 3 missense mutations18,20: Leu383Arg, Gly430Asp, and Tyr467Gly. Amino acids encoded by odd-numbered exons 1, 3, 5, and 7 are in normal font; those encoded by even-numbered exons 2, 4, 6, and 8 are highlighted in gray. Amino acids encoded by codons separated in 2 consecutive exons are underlined. Amino acids are numbered from the initiator methionine; those included in the signal peptide are in bold.

Microsatellite analysis of the FGA intron 3 tetranucleotide repeat (FGAi3) was also performed. Both parents were found to be heterozygous for the FGAi3 microsatellite marker, whereas the 2 affected daughters were homozygous (data not shown).

Mutation analysis was performed on DNA isolated from cultured amniocytes, and the fetus was found to be heterozygous for the familial Trp467Stop mutation both by sequencing and FGAi3 microsatellite analysis. This result was confirmed in the newborn when the mother gave birth to a healthy baby boy weighing 2.9 kg at birth, and fibrinogen determination revealed a level of 120 mg/dL, consistent with heterozygosity for an afibrinogenemia mutation.

The Trp467Stop mutation was predicted to lead to the production of a truncated fibrinogen beta chain, with 25 amino acids missing from the C-terminus (Figure 1C). Alternatively, the truncated beta polypeptide might be unstable or the mutation might cause a defect in the FGB mRNA by aberrant splicing (nonsense-associated alternative splicing) or by affecting the stability of the mRNA through nonsense-mediated mRNA decay.13-15 However, because the Trp467Stop mutation lies within the last exon of FGB, these mechanisms are not thought to be activated.

Previous studies in COS-1 cells expressing normal fibrinogen alpha and gamma chains in combination with beta-chain deletion mutants had led to the conclusion that the C-terminal portion of the beta chain, notably residues 238-491 (numbering from the initiator methionine), was not essential for fibrinogen assembly and secretion.16 In order to prove the causative nature of the mutation, Trp467Stop mutant and wild-type FGB cDNAs were transiently cotransfected with wild-type FGA and FGG cDNAs in COS-7 cells. Cells were lysed 18 hours after transfection and the conditioned media harvested. Individual fibrinogen chains and assembled hexamers were detected by Western blot analysis with a polyclonal antifibrinogen antibody (Figure 2).


View larger version (92K):
[in this window]
[in a new window]
 
Figure 2. Western blot analysis of cell extracts and conditioned media of COS-7 cells transfected with fibrinogen cDNAs. Samples of cell lysates and culture medium were subjected to (A) 10% SDS-PAGE under reducing conditions or (B) 7.5% SDS-PAGE under nonreducing conditions. The blots were incubated with a polyclonal anti-human fibrinogen antibody and cross-reacting bands revealed by chemiluminescence, as described in "Study design." Fbg indicates purified fibrinogen control; -, COS cells transfected with an empty vector. The positions of the hexameric complex and the normal Aalpha , Bbeta , and gamma  chains are indicated; open arrowheads indicate probable alpha /gamma intermediates (see "Results and discussion" and Hartwig and Danishefsky17). An asterisk marks the Trp467Stop mutant fibrinogen chain, which lacks 25 amino acid residues from the C-terminus. Transfections, lane 1: normal Aalpha , Bbeta , and gamma ; lane 2: normal Aalpha , normal Bbeta  + mutant Trp467Stop Bbeta , and normal gamma ; lane 3: normal Aalpha , mutant Trp467Stop Bbeta (only), and normal gamma .

When COS-7 cells are transfected with the 3 normal fibrinogen cDNAs, all 3 chains are correctly expressed and assembled inside the cell, and the fibrinogen hexamers are secreted into the media. When cells are transfected with normal FGA and FGG cDNAs and the Trp467Stop FGB mutant cDNA, again all 3 chains are correctly and stably expressed inside the cells. The mutant beta chain is incorporated into the fibrinogen hexamer inside the cell (Figure 2B, "Cells," lane 3) but is not secreted: only incomplete forms containing alpha  and/or gamma  chains and no fibrinogen hexamer are detectable in the supernatant (Figure 2A and B, "Media," lane 3). These results closely resemble those previously described in COS cells transfected with different combinations of the 3 normal fibrinogen cDNAs.17

When cells are transfected with equal amounts of wild-type and mutant FGB cDNAs (and normal FGA and FGG cDNAs), imitating heterozygosity for the Trp467Stop mutation, both beta chains are clearly distinguished in the Western blot of cell lysates, with the normal chain being more abundant (Figure 2A, "Cells," lane 2). By contrast, in the cell medium only the wild-type beta chain is found (Figure 2A, "Media," lane 2).

The data demonstrate that truncation of the last 25 amino acid residues from the fibrinogen beta chain C-terminus does not inhibit hexamer assembly but eliminates its secretion, as previously reported for 2 missense mutations in FGB exons 7 and 8 identified in afibrinogenemia patients.18 These results are apparently in contradiction with the experimental observation that fibrinogen beta chains truncated at amino acid position 238 were able to assemble with alpha and gamma fibrinogen chains and were secreted into the media.16 However, the assembly and secretion of such a severely truncated polypeptide may not be physiologically relevant.

Interestingly, Homer et al19 reported a very similar mutation (Trp440Stop, amino acids numbered without the signal peptide, or Trp470Stop according to our nomenclature), which occurs only 3 codons downstream of the Trp467Stop mutation. The Trp470Stop mutation "fibrinogen Mount Eden" was identified in heterozygosity in a patient following laboratory investigations prior to a liver biopsy for hepatitis C. The patient had reduced fibrinogen levels (0.7 mg/mL) and a prolonged activated partial thromboplastin time. Other than mild epistaxis and gum bleeding, the patient was asymptomatic. The authors showed that the truncated fibrinogen beta chain was not found in the patient's plasma and suggested that removal of the C-terminal 22 residues does not allow incorporation of the mutant chain into mature fibrinogen hexamers. No fibrinogen inclusion bodies were detected in the liver biopsy, indicating that molecules containing the mutant chains do not accumulate in the patient's hepatocytes. We suggest that the molecular mechanism may be at the level of secretion, as with the Trp467Stop mutation we describe. The authors state that the mutation causes hypofibrinogenemia in heterozygosity; however, one can consider it an afibrinogenemia mutation because a homozygous individual for this mutation will most certainly have no circulating fibrinogen.

In conclusion, the Trp467Stop mutation identified in this study, along with the Trp470Stop mutation19 and 3 missense mutations18,20 identified in the same region in afibrinogenemia patients, confirms the necessity of intact C-terminal portions of the fibrinogen beta chain for the secretion of functional fibrinogen hexamers.


    Acknowledgments

We are grateful to Dr Colette Rossier and Corinne Gumy for DNA sequencing and to Elena Barro for expert technical assistance.


    Footnotes

Submitted October 21, 2002; accepted December 13, 2002.

Prepublished online as Blood First Edition Paper, January 2, 2003; DOI 10.1182/blood- 2002-10-3116.

Supported by Swiss National Science Foundation (SNF) grant no. 31-64987.01 and by the Dr Henri Dubois Ferrière-Dinu Lipatti Foundation. M.N.-A. is the recipient of an SNF professorship.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Marguerite Neerman-Arbez, Centre Médical Universitaire, 1 rue Michel Servet, CH-1211 Geneva, Switzerland; e-mail: marguerite.arbez{at}medecine.unige.ch.


    References
Top
Abstract
Introduction
Study design
Results and discussion
References

1. Rabe F, Salomon E. Ueber-faserstoffmangel im Blute bei einem Falle von Hämophilie. Arch Int Med. 1920;95:2-14.

2. Martinez J. Congenital dysfibrinogenemia. Curr Opin Hemat. 1997;4:357-365[Medline] [Order article via Infotrieve].

3. Crabtree GR. The molecular biology of fibrinogen. In: Stamatoyannopoulos G,Nienhuis AW, eds. er P, Majerus PW, eds. The Molecular Basis of Blood Diseases. Philadelphia, PA: Saunders; 1987:631-661.

4. Lak M, Keihani M, Elahi F, Peyvandi F, Mannucci PM. Bleeding and thrombosis in 55 patients with inherited afibrinogenaemia. Br J Haematol. 1999;107:204-206[Medline] [Order article via Infotrieve].

5. Peyvandi F, Mannucci PM. Rare coagulation disorders. Thromb Haemost. 1999;82:1207-1214[Medline] [Order article via Infotrieve].

6. Kant JA, Fornace AJ Jr, Saxe D, Simon MI, McBride OW, Crabtree GR. Evolution and organization of the fibrinogen locus on chromosome 4: gene duplication accompanied by transposition and inversion. Proc Natl Acad Sci U S A. 1985;82:2344-2348[Medline] [Order article via Infotrieve].

7. Neerman-Arbez M, Honsberger A, Antonarakis SE, Morris MA. Deletion of the fibrinogen alpha-chain gene (FGA) causes congenital afibrinogenemia. J Clin Invest. 1999;103:215-218[Abstract/Free Full Text].

8. Neerman-Arbez M, de Moerloose P, Bridel C, et al. Mutations in the fibrinogen alpha gene account for the majority of cases of congenital afibrinogenemia. Blood. 2000;96:149-152[Abstract/Free Full Text].

9. Neerman-Arbez M. The molecular basis of inherited afibrinogenemia. Thromb Haemost. 2001;86:154-163[Medline] [Order article via Infotrieve].

10. Neerman-Arbez M, de Moerloose P, Honsberger A, et al. Molecular analysis of the fibrinogen gene cluster in 16 patients with congenital afibrinogenemia: novel truncating mutations in the FGA and FGG genes. Hum Genet. 2001;108:237-240[Medline] [Order article via Infotrieve].

11. Antonarakis SE. Recommendations for a nomenclature system for human gene mutations. Nomenclature Working Group. Hum Mutat. 1998;11:1-3[CrossRef][Medline] [Order article via Infotrieve].

12. den Dunnen JT, Antonarakis SE. Mutation nomenclature extensions and suggestions to describe complex mutations: a discussion. Hum Mutat. 2000;15:7-12[CrossRef][Medline] [Order article via Infotrieve].

13. Frischmeyer PA, Dietz HC. Nonsense-mediated mRNA decay in health and disease. Hum Mol Genet. 1999;8:1893-1900[Abstract/Free Full Text].

14. Hentze MW, Kulozik AE. A perfect message: RNA surveillance and nonsense-mediated decay. Cell. 1999;96:307-310[Medline] [Order article via Infotrieve].

15. Cartegni L, Chew SL, Krainer AR. Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nat Rev Genet. 2002;3:285-298[CrossRef][Medline] [Order article via Infotrieve].

16. Zhang JZ, Redman CM. Identification of B beta chain domains involved in human fibrinogen assembly. J Biol Chem. 1992;267:21727-21732[Abstract/Free Full Text].

17. Hartwig R, Danishefsky KJ. Studies on the assembly and secretion of fibrinogen. J Biol Chem. 1991;266:6578-6585[Abstract/Free Full Text].

18. Duga S, Asselta R, Santagostino E, et al. Missense mutations in the human beta fibrinogen gene cause congenital afibrinogenemia by impairing fibrinogen secretion. Blood. 2000;95:1336-1341[Abstract/Free Full Text].

19. Homer VM, Brennan SO, Ockelford P, George PM. Novel fibrinogen truncation with deletion of Bbeta -chain residues 440-461 causes hypofibrinogenemia. Thromb Haemost. 2002;88:427-431[Medline] [Order article via Infotrieve].

20. Duga S, Asselta R, Santagostino E, et al. Involvement of fibrinogen Bbeta -chain gene in the pathogenesis of congenital afibrinogenemia [abstract]. Thromb Haemost. 2001;86(suppl):P1108.

© 2003 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
haematolHome page
D. Vu, C. Di Sanza, and M. Neerman-Arbez
Manipulating the quality control pathway in transfected cells: low temperature allows rescue of secretion-defective fibrinogen mutants
Haematologica, February 1, 2008; 93(2): 224 - 231.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
D. Vu, C. Di Sanza, D. Caille, P. de Moerloose, H. Scheib, P. Meda, and M. Neerman-Arbez
Quality control of fibrinogen secretion in the molecular pathogenesis of congenital afibrinogenemia
Hum. Mol. Genet., November 1, 2005; 14(21): 3271 - 3280.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
D Vu, P de Moerloose, A Batorova, J Lazur, L Palumbo, and M Neerman-Arbez
Hypofibrinogenaemia caused by a novel FGG missense mutation (W253C) in the {gamma} chain globular domain impairing fibrinogen secretion
J. Med. Genet., September 1, 2005; 42(9): e57 - e57.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Neerman-Arbez, M. Germanos-Haddad, K. Tzanidakis, D. Vu, S. Deutsch, A. David, M. A. Morris, and P. de Moerloose
Expression and analysis of a split premature termination codon in FGG responsible for congenital afibrinogenemia: escape from RNA surveillance mechanisms in transfected cells
Blood, December 1, 2004; 104(12): 3618 - 3623.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. M. Mannucci, S. Duga, and F. Peyvandi
Recessively inherited coagulation disorders
Blood, September 1, 2004; 104(5): 1243 - 1252.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. W. Mosesson
Afibrinogenemia in a compound heterozygote: making sense out of missense
Blood, December 15, 2003; 102(13): 4247 - 4248.
[Full Text] [PDF]


Home page
BloodHome page
D. Vu, P. H. B. Bolton-Maggs, J. R. Parr, M. A. Morris, P. de Moerloose, and M. Neerman-Arbez
Congenital afibrinogenemia: identification and expression of a missense mutation in FGB impairing fibrinogen secretion
Blood, December 15, 2003; 102(13): 4413 - 4415.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2002-10-3116v1
101/9/3492    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Neerman-Arbez, M.
Right arrow Articles by Morris, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Neerman-Arbez, M.
Right arrow Articles by Morris, M. A.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Brief Reports
Right arrow Clinical Trials and Observations
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2003 by American Society of Hematology         Online ISSN: 1528-0020