| |
|
|
|
|
|
|
|||
|
Prepublished online as a Blood First Edition Paper on January 2, 2003; DOI 10.1182/blood-2002-08-2424.
IMMUNOBIOLOGY
From the Zentrum für Innere Medizin, Medizinische
Klinik I, Universitätsklinikum Hamburg-Eppendorf,
Germany; Klinik für Allgemeine Innere Medizin,
Inselspital, Universitätsspital Bern, Switzerland;
Institut für Hämatopathologie and Lymph Node Registry Kiel,
Christian-Albrecht-Universität Kiel, Germany;
Biology Department, Boehringer Ingelheim Pharmaceuticals, Ridgefield,
CT; and Biochemistry and Cell Biology Department, Institute for Cell
and Developmental Biology, State University of New York, Stony
Brook.
Activation-induced cytidine deaminase (AID) induces somatic
hypermutation (SHM), class switch recombination (CSR), and
immunoglobulin gene conversion in B-lymphocytes. Here we report for the
first time the expression of AID in healthy human B-lymphocytes and in
B-cell non-Hodgkin lymphomas (B-NHL). AID mRNA expression in humans is
restricted to the CD19+CD38+IgD Specific chromosomal translocations are a genetic
hallmark of lymphoid malignancies in non-Hodgkin lymphoma (NHL).
Immunoglobulin gene loci are involved in most of these translocations
in B-cell NHL, suggesting that mistaken maturation of the
immunoglobulin genes may contribute to lymphoma
formation.1,2 During B-cell development the immunoglobulin
genes are altered by 3 distinct mechanisms: In B lymphoblasts, V(D)J
joining rearranges the immunoglobulin-gene variable (V), diversity (D),
and joining (J) segments to produce the primary antibody repertoire;
this well defined process is mediated by the recombination activating
genes 1 and 2.3,4 After antigen encounter, an effective
secondary antibody response is achieved by somatic hypermutation (SHM)
of the variable region exons and by class switch recombination (CSR)
that replaces the µ constant region with one of the
downstream-located constant regions.5,6 Activation-induced
cytidine deaminase (AID) is indispensable for SHM, CSR, and
immunoglobulin gene conversion in B cells.7-10 AID is a
close homologue of APOBEC-1, the catalytic subunit of the apo-B mRNA
editing-complex; AID and APOBEC-1 are located in tandem on chromosome
12 and apparently have arisen by gene duplication.11-14
APOBEC-1 is an RNA-dependent cytidine deaminase that specifically
deaminates C6666 in the apo-B mRNA together with the
APOBEC-1-stimulating protein.12,15-18 In AID-deficient mice, SHM and CSR are completely abolished, leading to a severe defect
of the humoral immune response.8 In human patients with the autosomal recessive form of the hyper-immunoglobulin M syndrome (HIGM2), various mutations in the human AID gene have been
found that cripple AID function.7 In these patients not
only is CSR absent but SHM is strongly reduced.7 In
fibroblasts, the expression of AID is sufficient to mediate CSR of an
artificial switch substrate and SHM in an actively transcribed
artificial gene substrate.19,20 Expression of AID in
Escherichia coli leads to a hypermutator phenotype with
nucleotide transitions at dC/dG in a context-dependent manner.21 Moreover, expression of a bacteriophage-derived
inhibitor protein of uracil-DNA glycosylase in chicken DT40 cells that
lack the repair gene XRCC2 shifts the pattern of SHM from
predominantly transversions to transitions.22 These recent
results indicate that AID may simply act by deamination of cytidines in
the DNA.21,22
Because APOBEC-1 transgenic animals develop hepatocellular
carcinomas,23 we reasoned that AID might be a potential
oncogene. Here we demonstrate that AID is constitutively expressed in
follicular lymphoma (FL) and diffuse large B-cell lymphoma (DLBCL),
whereas in healthy B-cell development the expression of AID is
highly regulated and restricted to germinal center B cells. This
constitutive expression of AID may contribute to NHL formation.
Isolation of B-cell populations from human tonsils
Isolation of naive human B cells by negative selection and in
vitro stimulation with CD40L
Lymphoma tissue specimens For all lymphomas investigated, fresh and paraffin-embedded samples were available. Fresh tissue specimens were obtained during surgery, immediately shock frozen in liquid nitrogen, and kept at 80°C until use. Diagnoses of the lymphoma subtypes were established by the reference pathologists of the Lymph Node Registry Kiel on the
basis of standard histopathology with additional immunhistochemical stainings with mouse monoclonal antibodies using the alkaline phosphatase-anti-alkaline phosphatase (APAAP) technique. Informed consent was obtained from all patients analyzed in this study. All
immunoreagents were purchased from DAKO (Hamburg, Germany), except for
CD20, Ki-B3, and Ki-S5, which had been generated in the Lymphoma
Registry, Kiel, Germany.
B-precursor lymphoblastic leukemia/lymphoma (cALL) was diagnosed when blasts expressed terminal deoxyribonucleotidyl transferase (TdT), CD79a, CD19 or CD20, and CD10. Diffuse large B-cell lymphoma (DLBCL) was diagnosed when centroblasts or immunoblasts expressed B-cell marker-like CD20 and showed a high proliferation index determined by Ki-S5 staining. Follicular lymphoma (FL) was diagnosed on the basis of a follicular growth pattern with the expression of CD20, CD10, and bcl-2 in the absence of CD5. B-chronic lymphocytic leukemia (B-CLL) and mantle cell lymphoma (MCL) showed a predominance of small or medium-sized lymphocytes with coexpression of CD20, CD23, and CD5 in B-CLL or coexpression of CD20, CD5, and cyclin D1 in the absence of CD23 in MCL. Extranodal marginal zone B-cell lymphoma of MALT (mucosa-associated lymphatic tissue) (MALT-lymphoma) was diagnosed on the basis of the diagnostic lymphoepithelial lesions with expression of CD20 in the absence of Ki-B3 or DBA44. The diagnosis of plasma cell multiple myeloma (MM) was established by the presence of plasma cell infiltrates expressing monotypic light chains. Immunocytoma (lymphoplasmacytic lymphoma) (IC) was diagnosed when lymphoplasmacytoid cells expressed CD20 and IgM with intracytoplasmic monotypic light chains, and the lymphoma lacked features of other entities such as follicular growth or marginal zone features. Based on the Kiel classification, lymphoplasmacytic lymphoma included clonal plasma cells determined by clonal expression of one immunoglobulin light chain. Lymphocytoid immunocytoma contained polyclonal plasma cells. This group of lymphomas is classified as B-CLL in the World Health Organization (WHO) classification. All samples were completely composed of lymphoma tissue and contained no portions of adjacent tissue. RNA was prepared from 5 to 7 slices of 7 µm using Trizol (Invitrogen). cDNA pools of the individual lymphoma specimens were synthesized using 1 µg total RNA and a commercially available kit with random primers (SMART RACE cDNA Amplification Kit; Clontech, Palo Alto, CA). Oligonucleotides The following oligonucleotides were used: AID 1 (sense, nucleotide [nt] 48-78, GAGGCAAGAAGA CAC TCT GGA CAC CAC TAT); AID 2 (antisense, nt 408-381, GCGGTGAAGATCCTCAGGCTGAGG TTG); AID 3 (sense, nt 328-358, AGCCCCTGCTACGACTGTGCC CGACATGTG); AID 4 (antisense, nt 681-654, AGTTGCTAT CAA AGT CCCAAA GTA CGA); AID 5 (sense, nt 11-40, TAATTGAAG TGAGAT TTTTCT GGCCTGAGA); AID 6 (antisense, nt 720-690, CTTCAGCAGAGATAT TTC ATC GTGTGTGAC); AID 7 (antisense, nt 520-490, CCAGCAGTAAAA ATA ATC TTTGAA GGTCAT); AID 13 (antisense, 232-203, CTTATT GCGAAGATA ACC AAA GTCCAGTGA); AID 14 (sense, intron 8201-8230, GGA GCC GAA ATT AAA GAT TAG AAG CAG AGA); AID s-1 (sense, nt 200-232, TTTTCACTGGAC TTTGGTTAT CTTCGC); AID as-1 (antisense, nt 520-485, CCAGCAGTAAAA ATA ATC TTTGAAGGT); AID as-2 (antisense, nt 484-461, TATTTGCAC CCC GGCGCGGTGCAG); -actin s-2 (sense, nt 391-420, CCCCCTGAACCC CAAGGCCAACCGCGA GAA); -actin (as-2) (antisense, nt
660-631, TAGCCGCGCTCGGTGAGGATCTTCATGAGG); -actin as-4 (nt 630-601, TAGTCAGTCAGGTCC CGGCCAGCCAGGTCC); Blimp-1 s-1 (sense, nt 421-444),
GAGTAAAGAATA CAT ACC AAA GGG); Blimp-1 as-1 (antisense, nt 824-801, CATTTTTCTCAG TGCTCGGTTGCT); Blimp 1 as-2 (antisense, nt 730-701, TGCAAAGTCCCGACA ATA CCA CACAAG); c-myc s-1(sense, nt 594-617, TCTCAACGACAGCAG CTCGCCCAA); c-myc as-1 (antisense, 893-870, TTGAGGACCAGTGGGCTGTGAGGA); c-myc s-2 (sense, nt 618-642, GTCCTGCGCCTCGCAAGACTCCAG); Bcl-6 s-1 (sense, nt 248-271, CAA GAA GTT
TCT AGG AAA GGC CGG); Bcl-6 as-1 (antisense, nt 547-524, GATTGATCA CACTAA GGTTGCATT); Bcl-6 as (antisense, nt 520-497, ACTGGT CTGTAA AGATGC TATAGA).
RT-PCR analysis One microliter cDNA synthesis mix was used for polymerase chain reaction (PCR) amplification. PCR reactions were performed as described24,25 using the following conditions AID s-1 and AID as-2: 30 cycles at 94°C for 30 seconds, 58°C for 30 seconds, and 72°C for 30 seconds; AID 3 and AID 7: 30 cycles at 94°C
for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds; AID 5 and AID 6: 30 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds; nested PCR with AID 14 and AID 6 and 30 cycles using the same PCR conditions; -actin s-1 and
-actin as-1: 25 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds; Bcl-6 s-1 and Bcl-6 as-1: 30 cycles
at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds; blimp-1 s-a and blimp-1 as-1: 30 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds; c-myc s-1
and c-myc as-1: 30 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds. PCR products were hybridized with
32P-labeled internal oligonucleotides.25
Quantitative PCR was performed with a Light Cycler (Roche, Basel,
Switzerland) using standard software for quantification as recommended
by the manufacturer. Expression levels were normalized to the
expression level of Ribonuclease protection assay Radiolabeled antisense AID RNA was synthesized as described spanning 222 bases of the AID mRNA sequence (nt 232-10).25 Total RNA from human lymphoma tissues (10 µg) was coprecipitated with 2 × 104 cpm -32P-labeled AID antisense
RNA probe. Hybridization and RNA digestion with the Ribonuclease
Protection Assay II Kit (Ambion, Austin, TX) and analysis of the
protected RNAs on denaturing polyacrylamide sequencing gels was
performed as described.25,26
Analysis of somatic hypermutation of the variable region of the immunoglobulin heavy-chain gene Recombined V(D)J segments of the IgH transcripts of the lymphoma specimens were amplified from the respective cDNA pools by PCR using a set of degenerate oligonucleotides exactly as described.27Determination of immunoglobulin heavy- and light-chain expression Immunglobulin heavy-chain and light-chain expression was determined by standard immunohistochemistry using antibodies against , , IgM, IgG, IgD, IgE, and IgA as
described.28
Expression of AID mRNA in human germinal center B cells AID mRNA was amplified by reverse transcription (RT)-PCR from naive B cells (CD19+CD38 IgD+), naive germinal
center cells (CD19+CD38+IgD+),
germinal center cells
(CD19+CD38+IgD ), and memory cells
(CD19+CD38 IgD ) (Figure
1). In germinal center B cells, a strong
AID PCR product was generated, and a faint band was detectable in the
memory cell fraction (Figure 1). No RT-PCR products for AID mRNA were
detectable in naive B cells or in naive germinal center B cells (Figure
1). CD19+CD38+ germinal center cells were
further fractionated with anti-CD44 monoclonal antibodies into
centroblasts (CD19+CD38+CD44 ) and
centrocytes (CD19+CD38+CD44+). AID
mRNA was strongly detected in the CD44 centroblasts but
was hardly detectable in CD44+ centrocytes (Figure
1).
Naive human IgM+ B cells isolated from human tonsils were
cultivated for up to 8 days in the presence of IL-4 and plasma
membranes of Sf21 cells that had been infected with a CD40-L expressing baculovirus. AID mRNA was strongly induced between days 2 and 3 (Figure
2A). At day 4, the levels of AID mRNA
strongly decreased (Figure 2A). The mRNA of bcl-6 decreased at
approximately day 4 and was hardly detectable from day 5 to day 8 (Figure 2A). In contrast, the mRNA of blimp-1 was strongly induced at
approximately day 5 (Figure 2A). The mRNA expression of AID, bcl-6, and
blimp-1 in these cells was quantitated by real-time PCR (Figure 2B).
The increase of AID mRNA at day 3 was approximately 40-fold in
comparison with the AID mRNA levels of naive B-lymphocytes at day 1 (Figure 2B). At day 0, AID mRNA could not be detected by real-time
RT-PCR. From day 3 to day 4, the AID mRNA level decreased by more than 80% (Figure 2B). The mRNA of bcl-6 steeply decreased from day 4 to day
5, and the mRNA of blimp-1 increased approximately 50-fold between day
4 and day 6 (Figure 2B). When the naive human IgM+ B cells
were cultivated in the presence of CD40-L without IL-4, the mRNA of
AID was induced much later, at day 4 instead of day 2, and this induction was far less pronounced (data not
shown).
Expression of AID mRNA in human B-cell non-Hodgkin lymphomas The mRNA expression of AID and of c-myc, blimp-1, bcl-6, and -actin was studied in B-precursor lymphoblastic leukemia/lymphoma (cALL), diffuse large B-cell lymphoma (DLBCL), follicular lymphoma (FL), mantle cell lymphoma (MCL), immunocytoma (IC), extranodal marginal zone B-cell lymphoma of MALT (MALT lymphoma), B-cell chronic
lymphatic leukemia (B-CLL), and multiple myeloma (MM). Individual mRNA
expression profiles for each entity are depicted in Figure
3. Within this series, AID mRNA was not
detected in any of the patients with cALL (n = 3), MCL (n = 4), or
MM (n = 3). Strong RT-PCR products of AID mRNA were generated in all
patients with FL (n = 5) and in all patients with DLBCL (n = 13).
In patients with MALT lymphoma (n = 8), IC (n = 8), and B-CLL
(n = 5), a heterogeneous expression pattern was found for AID mRNA,
with strong expression in some and absence of expression in other
patients. Although blimp-1 was most abundantly expressed in IC, MM,
and, to a lesser extent, in B-CLL (Figure 3), c-myc mRNA was strongly
amplified in DLBCL, and Bcl-6 was strongly expressed in IC (Figure 3).
In healthy human lymph nodes (n = 4), AID mRNA could only be detected by nested RT-PCR but not by the conventional RT-PCR, indicating that
AID is expressed in healthy lymphatic tissues at lower levels than in
germinal center B-NHL (data not shown).
In all AID-expressing lymphomas, full-length AID mRNA is the most
abundant splice form (Figure 4).
Alternative splicing generates 3 additional AID mRNA variants. In
splice variant 1 (sv 1), the intron between exon 3 and exon 4 is not
spliced, extending the open-reading frame for an additional 45 amino
acid residues up to the first stop codon in intron 3 (Figure 4). In
splice variant 2 (sv 2), exon 4 is spliced, leading to an internal
deletion of 39 amino acid residues. In splice variant 3 (sv 3), a short
neo-exon located in intron 3 is used, but exon 3 and exon 4 are
excluded (Figure 4). This spliced variant encodes a truncated peptide
consisting of the amino terminus and the carboxy terminus of AID linked
by 20 amino acid residues encoded by the neo-exon 3 (Figure 4). In FL,
sv 2 was the second minor splice variant, whereas in MALT lymphoma, sv
1 was the second minor variant (Figure 4A). In MALT lymphoma, both sv 1 and sv 3 are expressed, whereas in FL and in DLBCL, only sv 3 could be
found (Figure 4). Sequencing did not detect point mutations in AID
full-length cDNA from patients with FL (n = 3), DLBCL (n = 3), and
MALT lymphoma (n = 3).
The expression of AID mRNA in human B-cell non-Hodgkin lymphoma was
directly quantitated by ribonuclease protection analysis (RPA). For
these experiments an AID antisense RNA probe complementary to exons 1 and 2 was used. Therefore, full-length AID and the mRNA variants sv 1 and sv 2 protect an identical fragment of 222 nucleotides. The expected
protected fragment of 222 nucleotides was observed with the highest
intensity in MALT, followed by FC and DLBCL (Figure
5). Quantification of AID mRNA based on
the expression of
AID mRNA expression, somatic hypermutation, and class switch recombination in human B-cell non-Hodgkin lymphomas Next we studied somatic hypermutation (SHM) of the recombined V(D)J segment and determined the subtype of the constant region of the immunoglobulin heavy-chain (IgH) gene in MCL (n = 3), FL (n = 3), DLBCL (n = 3), and B-CLL (n = 3) in correlation to the expression of AID mRNA (Figure 6). In MCL, no AID mRNA is expressed, no somatic hypermutation of the variable region is detectable, and the µ constant region of the IgH gene is expressed (Figure 6). In contrast, in FL and DLBCL, both of which express AID mRNA, the variable region of the IgH gene is hypermutated (Figure 6). In most patients with FL, the IgH gene locus has not undergone isotype class switch recombination (CSR), and mainly IgM is expressed (Figure 6). In contrast, in most patients with DLBCL, CSR of the IgH gene has occurred and IgG is expressed (Figure 6). In the B-CLLs investigated, CSR had not occurred and somatic hypermutation was either absent or low (Figure 6).
Because not all DLBCLs are thought to be derived from germinal center
cells, we analyzed 13 patients with DLBCL and stratified them according
to their expression of CD10 as detected by immunohistochemistry, which
can be used to discriminate the germinal center B-cell-like type of
DLBCL from the activated B-cell-like type.29 Five of these DLBCLs were positive for CD10, and 8 were negative (Table 1). AID mRNA was detected in all 5 CD10+ and all 8 CD10
The expression of AID and blimp-1 was also studied in 7 MALT lymphomas
and in 7 immunocytomas (Figure 7). In the
MALT lymphomas, a great variation of AID mRNA expression was observed
with relatively high AID expression in 3 patients and low or no
expression of AID mRNA in 5 patients (Figure 7). The expression of
blimp-1 is inversely correlated to the expression of AID in MALT
lymphomas, and to lesser extent, in immunocytomas (Figure 7). Thus, the
lymphomas with high-level expression of blimp-1 demonstrated less AID
mRNA, and high-level expression of AID mRNA was linked to low amounts of blimp-1 (Figure 7). In the MALT lymphomas, SHM was present in all
patients except for 2 in whom no IgH transcripts could be detected.
Interestingly, the MALT lymphoma with the high-level expression of AID
mRNA (Figure 7, lane 2, and Figure 5) demonstrated only low levels of
SHM (3.2% base changes in the variable region) and expressed IgM
(Figure 7). Although AID mRNA was absent in 2 and was expressed in 5 ICs, SHM and CSR could not be detected in the ICs with the exception of
one sample (lane 9) (Figure 7). Notably, this IC with low-level SHM did
not express AID, whereas the IC with AID expression did not demonstrate
SHM (Figure 7). Therefore, in MALT lymphoma and in IC, no correlation
of AID expression with the presence of SHM in the IgH variable regions
is observed. In addition, AID expression was studied in the blood
lymphocytes of 10 additional patients with B-CLL. In 7 of these
patients, AID mRNA was detected in blood lymphocytes, and in the other
3 patients AID mRNA was undetectable (data not shown). As in IC, no
correlation of AID expression and SHM was found in the blood lymphocytes of these 10 patients with B-CLL.
This investigation demonstrates for the first time that AID is
highly regulated in healthy human germinal center B cells, namely the
CD44 Recent studies have demonstrated the pivotal role of AID for the induction of SHM and CSR that mark the transition of the primary humoral immune response to the secondary phase of mature, highly specific antibody production.10,30,31 The identification of AID enables studies of these events at a molecular level. We started to investigate AID expression in healthy human germinal center B cells and B-cell NHL because AID might be a pacemaker for lymphoma development and malignant progression. This assumption is supported by the finding of AID-induced mutations in E coli, demonstrating that AID alone is sufficient to confer a mutator phenotype.21 Moreover, aberrant hepatic overexpression of the AID homologue APOBEC-1 induces hepatocellular carcinomas, indicating the oncogenic potential of these genes.23 Previous studies in healthy human B cells and in B-NHL have shown that SHM occurs not only occur in the variable region of the IgH gene locus but also in other genes specifically expressed in B cells such as bcl-6.32-35 In DLBCL, a loss of specificity for SHM and DNA recombination events is observed with respect to the healthy B cell that could well be caused by the observed constitutive expression of AID.35 During healthy B-cell maturation, AID expression is highly restricted to only a short period of time. The constitutive expression of AID in B-NHL must be attributed to an autocrine or a paracrine secretion of the required growth factors by the neoplastic B cells or by lymphoma-infiltrating T cells or, alternatively, by a constitutive activation of the AID promoter. Current experiments in our laboratories try to address this important issue. If indeed AID is a pacemaker of B-NHL formation, measures to reverse the expression of AID would be an obvious option for the treatment or prevention of germinal center B NHL. Alternative splicing generates 3 AID variants in addition to the full-length protein. Whether these splice variants have a biologic role remains to be investigated. The regularly spliced mRNA of AID is the most prevalent AID transcript in healthy and neoplastic B cells, and AID mRNA remains unmutated in human B-NHL. Thus, in B-NHL the expression of the AID gene is altered, but the function of the encoded AID protein is unchanged. With respect to the recent results on AID function in E coli, it is possible that the AID protein acts as a mutator in neoplastic human B cells.21,35 The expression of AID in DLBCL and FL was coincident with the occurrence of SHM in the variable region exons of the IgH locus. On the contrary, the absence of AID expression in MCL was associated with a lack of CSR and SHM. In DLBCL, the expression of AID is predictable for SHM and CSR and may become a molecular marker for these processes. AID expression was found in all patients with DLBCL studied regardless of whether CD10 protein was expressed or whether the DLBCL developed from a previous FL. We are currently generating a monoclonal antibody directed against AID that will allow a much easier determination of AID protein expression in human B-NHL. In MALT lymphoma, IC, and B-CLL a great variation of AID expression was observed, and no correlation of AID expression with SHM and CSR could be demonstrated. A striking negative correlation of AID mRNA to blimp-1 mRNA was observed in MALT lymphomas. With respect to these markers, 2 entities of MALT lymphomas can be defined that are characterized by the expression of AID and the absence of blimp-1 or the reverse. This assumption is in accordance with recent results on blimp-1 action in human B-cell lines and mouse splenic B cells.36 Blimp-1 extinguishes the gene expression for germinal center B-cell function by repressing several transcription factors such as Spi-B and Id3, and it induces plasma cell genes such as XBP-1.36 The results of our investigation indicate that certain subsets within MALT lymphoma, IC, and B-CLL can be defined solely based on the expression of AID. Further studies with more patients are required to analyze whether the expression of AID in these lymphomas correlates to a different clinical outcome in patients. Taken together, the results of our study suggest that AID indeed may be a potent oncogene for B-cell NHL development. In addition to conducting more extended clinical studies, this hypothesis should now be tested experimentally using transgenic animals.
We thank Anna Sotnikova for her help in purifying B-lymphocytes from human tonsils.
Submitted August 9, 2002; accepted December 23, 2002.
Prepublished online as Blood First Edition Paper, January 2, 2003; DOI 10.1182/blood-2002-08-2424.
Supported by Deutsche Forschungsgemeinschaft grant SFB 545, Teilprojekt A6 (J.G.) and Bundesministerium für Bildung und Forschung, Förderkennzeichen 01KV95090 (J.G.), and supported in part by National Institutes of Health grant GM26939 (K.B.M.).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Jobst Greeve, Klinik für Allgemeine Innere Medizin, Inselspital-Universitätsspital Bern, CH-3010 Bern Switzerland; e-mail: jobst.greeve{at}insel.ch.
1. Gaidano G, Dalla-Favera R. Pathobiology of non-Hodgkin's lymphoma. In: Hoffman R,Benz EJ Jr,Shattil SJ, et al., eds. Hematology: Basic Principles and Practice. New York, NY: Churchill Livingstone; 2000:1213-1229.
2.
Harris NL, Jaffe ES, Diebold J, et al.
World Health Organization classification of neoplastic diseases of the hematopoietic and lymphoid tissues: report of the Clinical Advisory Committee meeting 3. Ramsden DA, van Gent DC, Gellert M. Specificity in V(D)J recombination: new lessons from biochemistry and genetics. Curr Opin Immunol. 1997;9:114-120[CrossRef][Medline] [Order article via Infotrieve]. 4. Ramsden DA, Paull TT, Gellert M. Cell-free V(D)J recombination. Nature. 1997;388:488-491[CrossRef][Medline] [Order article via Infotrieve]. 5. Jacobs H, Bross L. Towards an understanding of somatic hypermutation. Curr Opin Immunol. 2001;13:208-218[CrossRef][Medline] [Order article via Infotrieve]. 6. Honjo T, Kinoshita K, Muramatsu M. Molecular mechanism of class switch recombination: linkage with somatic hypermutation. Annu Rev Immunol. 2002;20:165-196[CrossRef][Medline] [Order article via Infotrieve]. 7. Revy P, Muto T, Levy Y, et al. Activation-induced cytidine deaminase (AID) deficiency causes the autosomal recessive form of the Hyper-IgM Syndrome (HIGM2). Cell. 2002;102:565-575. 8. Muramatsu M, Kinoshita K, Fagarasan S, Yamada S, Shinkai Y, Honjo T. Class switch recombination and hypermutation require activation-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell. 2000;102:553-563[CrossRef][Medline] [Order article via Infotrieve].
9.
Arakawa H, Hauschild J, Buerstedde J-M.
Requirement of the activation-induced deaminase (AID) gene for immunoglobuline gene conversion.
Science.
2002;295:1301-1306
10.
Fugmann SD, Schatz DG.
One AID to unite them all.
Science.
2002;295:1244-1245
11.
Muramatsu M, Sankaranand VS, Anant S, et al.
Specific expression of activation-induced cytidine deaminase (AID), a novel member of the RNA-editing deaminase family in germinal center B cells.
J Biol Chem.
1999;274:18470-18476
12.
Teng BB, Burand CF, Davidson NO.
Molecular cloning of an apolipoprotein B messenger RNA editing protein.
Science.
1993;260:1816-1819 13. Espinosa R, Funahashi T, Hadjiagapiou C, Lebeau MM, Davidson NO. Assignment of the gene encoding the human apolipoprotein B mRNA editing enzmye (APOBEC-1) to chromosome 12p13.1. Genomics. 1994;24:414-415[CrossRef][Medline] [Order article via Infotrieve]. 14. Muto T, Muramatsu M, Tanikawi M, Kinoshita K, Honjo T. Isolation, tissue distribution and chromosomal localization of the human activation-induced cytidine deaminase gene. Genomics. 2000;15:85-88.
15.
Navaratnam N, Morrison JR, Battacharya S, et al.
The p27 catalytic subunit of the apolipoprotein B mRNA editing enzyme is a cytidine deaminase.
J Biol Chem.
1993;268:20709-20712 16. Lellek H, Kirsten R, Diehl I, Apostel F, Buck F, Greeve J. Purification and molecular cloning of a novel essential component of the apolipoprotein B mRNA editing enzyme-complex. J Biol Chem. 2000;27:19848-19856.
17.
Metha A, Kinter MT, Sherman NE, Driscoll DM.
Molecular cloning of APOBEC-1 complementation factor, a novel RNA-binding protein involved in the editing of apolipoprotein B mRNA.
Mol Cell Biol.
2000;20:1846-1854
18.
Lellek H, Welker S, Diehl I, Kirsten R, Greeve J.
Reconstitution of mRNA editing in yeast using a Gal4-ApoB-Gal80 fusion transcript as the selectable marker.
J Biol Chem.
2002;277:23638-23644 19. Okazaki I, Kinoshita K, Muramatsu M, Yoshikawa K, Honjo T. The AID enzyme induces class switch recombination in fibroblasts. Nature. 2002;416:340-345[CrossRef][Medline] [Order article via Infotrieve].
20.
Yoshikawa K, Okazaki I, Eto T, et al.
AID enzyme-induced hypermutation in an actively transcribed gene in fibroblasts.
Science.
2002;296:2033-2036 21. Petersen-Mahrt SK, Harris RS, Neuberger MS. AID mutates E. coli suggesting a DNA deamination mechanism for antibody diversification. Nature. 2002;418:99-103[Medline] [Order article via Infotrieve]. 22. Di Noia J, Neuberger M. Altering the pathway of immunoglobulin hypermutation by inhibiting uracil-DNA glycosylase. Nature. 2002;419:43-48[CrossRef][Medline] [Order article via Infotrieve].
23.
Yamanaka S, Balestra ME, Ferrell LD, et al.
Apolipoprotein B mRNA editing protein induces hepatocellular carcinoma and dysplasia in transgenic animals.
Proc Natl Acad Sci U S A.
1995;92:8483-8487 24. Greeve J, Altkemper I, Dieterich JD, Greten H, Windler E. Apolipoprotein B mRNA editing in 12 different mammalian species: hepatic expression is reflected in low concentrations of apo B-containing plasma lipoproteins. J Lipid Res. 1993;34:1367-1384[Abstract]. 25. Greeve J, Lellek H, Apostel F, et al. Absence of APOBEC-1 mediated mRNA editing in human carcinomas. Oncogene. 1999;18:6357-6366[CrossRef][Medline] [Order article via Infotrieve].
26.
Greeve J, Axelos D, Welker S, Schipper M, Greten H.
Distinct promotors induce APOBEC-1 expression in rat liver and intestine.
Arterioscler Thromb Vasc Biol.
1998;18:1079-1092 27. Küppers R, Zhao M, Rajewski K, Hansmann ML. Detection of clonal B cell populations in paraffin-embedded tissues by polymerase chain reaction Am J Pathol. 1993;143:230-239[Abstract]. 28. Kreipe H, Heidebrec hat HJ, Hansen S, et al. A new proliferation-associated nuclear antigen detectable in paraffin-embedded tissues by the monoclonal antibody Ki-S1. Am J Pathol. 1993;142:3-9[Abstract].
29.
Huang JZ, Sanger WG, Greiner TC, et al.
The t(14;18) defines a unique subset of diffuse large B-cell lymphoma with a germinal center B-cell gene expression profile.
Blood.
2002;99:2285-2290 30. Rajewski K. Clonal selection and learning in the antibody system. Nature. 1996;381:751-758[CrossRef][Medline] < | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||