Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Prepublished online as a Blood First Edition Paper on December 27, 2002; DOI 10.1182/blood-2002-07-2301.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2002-07-2301v1
101/9/3615    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hiraiwa, N.
Right arrow Articles by Kannagi, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hiraiwa, N.
Right arrow Articles by Kannagi, R.
Related Collections
Right arrow Neoplasia
Right arrow Cell Adhesion and Motility
Right arrow Gene Expression
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 1 May 2003, Vol. 101, No. 9, pp. 3615-3621

NEOPLASIA

Transactivation of the fucosyltransferase VII gene by human T-cell leukemia virus type 1 Tax through a variant cAMP-responsive element

Nozomu Hiraiwa, Tomonori Yabuta, Keijiro Yoritomi, Miki Hiraiwa, Yuetsu Tanaka, Takeshi Suzuki, Mitsuaki Yoshida, and Reiji Kannagi

From the Division of Molecular Pathology, Aichi Cancer Center, Chikusa-ku, Nagoya; Department of Infectious Disease and Immunology, Faculty of Medicine, Okinawa-Asia Research Center of Medical Science, University of the Ryukyus, Nishihara; and Department of Cellular and Molecular Biology, The Institute of Medical Science, University of Tokyo, Shirokanedai, Minato-ku, Japan.


    Abstract
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Human T-cell leukemic virus type 1 (HTLV-1)-infected T cells express the fucosyltransferase (Fuc-T) VII gene involved in the biosynthesis of the leukocyte sialyl Lewis X, which may be related to tissue infiltration in patients with malignant adult T-cell leukemia. HTLV-1 induces Fuc-T VII transcription through the viral transactivator Tax, although the underlying molecular mechanism remains unknown. In the present study, we analyzed the role of the cis-activating element in Tax activation using reporter constructs bearing the 5'-regulatory region of Fuc-T VII in Jurkat T cells. A sequence (GGCTGTGGGGGCGTCATATTGCCCTGG) covering a half-palindromic cyclic adenosine monophosphate (cAMP)-responsive element (CRE) was found to be required for Tax activation of the Fuc-T VII promoter. We further demonstrated that transcription factors of the CRE-binding protein (CREB)/activating transcription factor (ATF) family bind to this CRE-like sequence and that Tax binds in association with CREB and the coactivator CREB-binding protein (CBP) in Jurkat T cells. This element, containing the G+C-rich flanking sequences, is homologous to the Tax-responsive viral CREs in the HTLV-1 long terminal repeat (LTR)-promoter. Furthermore, CREMalpha , an isoform of CREB deficient in the glutamine-rich domains, was found to activate the Fuc-T VII promoter in a phosphorylation-independent manner, similar to the viral CRE in HTLV-1 LTR but in contrast to the phosphorylation-dependent activation of the cellular CREs by Tax. These findings indicate that the Fuc-T VII promoter is transactivated by Tax in concert with CBP through a CRE-like sequence in a manner similar to that of viral CRE in HTLV-1 LTR. (Blood. 2003;101:3615-3621)

© 2003 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

We have previously shown that leukemia cells in patients with adult T-cell leukemia (ATL), and cell lines derived therefrom, more strongly express sialyl Lewis X, a major ligand for selectins in leukocytes, than other types of human lymphocytic leukemia cells.1,2 ATL is a malignancy of peripheral CD4+ cells initiated by infection with human T-cell leukemic virus type 1 (HTLV-1).3,4 Infiltration by leukemic cells into various tissues is a frequent manifestation of ATL5 and often causes serious clinical problems. The degree of expression of sialyl Lewis X on leukemic cells in ATL significantly correlates with their degree of extravascular infiltration.2 The evidence suggests that deregulated expression of sialyl Lewis X determinant on leukemic cells is involved in the infiltration of ATL cells because the binding of sialyl Lewis X on leukocytes with selectins on endothelial cells is known to trigger extravasation.6-8

Human fucosyltransferase VII (Fuc-T VII) has proved to be crucial for the synthesis of sialyl Lewis X,9,10 the expression of which is regulated during hematopoietic differentiation, inflammation, and malignant transformation.11-14 Recent studies revealed that the synthesis of sialyl Lewis X in leukocytes and leukemic cells is controlled principally at the level of transcription of Fuc-T VII.9,10,12,15-21

Therefore, it is important to determine how the transcription of Fuc-T VII is enhanced in ATL cells. We previously found that the expression of sialyl Lewis X and Fuc-T VII is transactivated by HTLV-1 Tax,22 which is involved in the proliferation and transformation of T cells in ATL through the control of viral gene expression.23-25 Tax also exerts its transactivating effects on promoters of various cellular genes.26,27 In the present study, undertaken to investigate the mechanism underlying transactivational effects of Tax on the Fuc-T VII promoter, we identified a Tax-responsive element in the Fuc-T VII promoter that contains a half-palindromic cAMP-responsive element (CRE) binding to CRE-binding protein/activating transcription factor (CREB/ATF) factors. The family of CREB/ATF transcription factors, a member of the basic leucine zipper (bZIP) transcription factor group, has been shown to bind the Tax-responsive element in the 21-base pair (bp) repeats of the HTLV-1 long-terminal repeat (LTR) promoter and to modulate viral promoter activity.28 Further examination revealed that this CRE-like element highly resembles the Tax-responsive element in the 21-bp repeats, called the viral CRE, similarly flanked by G+C-rich sequences.29

In addition to the structural resemblance, we confirmed that this CRE-like element is functionally involved in transactivation of Fuc-T VII by Tax in a phosphorylation-independent manner.30,31


    Materials and methods
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Cells and plasmids

JPX-9 (kindly provided by Drs K. Ohtani and M. Nakamura, Tokyo Medical and Dental University) is a Jurkat T-cell subline generated by stable introduction of a gene that contains the Tax-coding region preceded by a murine metallothionein promoter.32 JPX-9 cells, a human T cell line (Jurkat), an HTLV-1-infected T-cell line (ED40515-N),22 and a natural killer (NK)-like cell line (YT)15 were maintained in RPMI 1640 medium with 10% fetal calf serum. F9 cells were maintained in Dulbecco modified Eagle medium with the same supplement. Construction of the expression plasmid of Tax, pCGTax, and of Tax mutants (d3 and d7/16) were described previously.33-35 The Tax mutant M2236 was a gift from Dr W. C. Greene. Rous sarcoma virus (RSV) enhancer-driven expression plasmids RSV-CREMalpha and RSV-protein kinase A (PKA) were kindly provided by Dr Richard Goodman.37 Chloramphenicol acetyltransferase (CAT) reporter constructs pU3R-CAT38 and somatostatin-CAT39 plasmids, which were also gifts of Dr Richard Goodman, were digested with XhoI and HindIII or with SalI and HindIII, respectively, and were ligated to pGL2 (Promega, Madison, WI) to get pU3R-Luc and somatostatin-Luc reporter plasmids.

Construction of 5'-deletion and site-directed mutants

A genomic clone containing the exons of human Fuc-T VII and identifying transcriptional start points was generated (N.H. et al, manuscript submitted). An 895-bp element of the Fuc-T VII promoter region (from -791 to +104, just 5' of the ATG codon; numbers correspond to the principal transcription start point) was polymerase chain reaction (PCR)-amplified from the genomic clone using a sense primer containing 5' KpnI site (primer -791 to -769) and an antisense primer with 3' HindIII site (primer +78 to +104) to facilitate subcloning. The PCR products were purified from agarose gels, digested, and subcloned into the KpnI/HindIII site immediately 5' of the luciferase cDNA segment of the promoterless luciferase reporter gene plasmid, pGL2, to create p(-791). The same approach was used to produce the deletion reporter constructs. To generate the constructs of mutated p(-791), featuring changes in the CRE-like element or the Sp1 consensus site, PCR was used by overlap extension.40 To construct the multisite mutants, the first site mutant cloned in pGL2-Basic was used as a template. The second-step PCR product was cloned, and sequential overlap extensions were performed as described above.40 The absence of secondary mutations introduced by PCR was confirmed for all constructs by DNA sequencing and comparison with the sequence of the original genomic clone.

Promoter activity determinations

Cultures at 50% to 60% confluence grown in 6-well culture plates were rinsed in serum-free medium and exposed to SV40-CAT (0.5 µg) and reporter constructs (4 µg), with or without pCGTax (4 µg) with 0.5% DMRIE-C (Life Technologies, Grand Island, NY) for 5 hours. Cells were refed medium supplemented with 10% fetal calf serum and cultured for 48 to 72 hours to reach confluence, rinsed twice with phosphate-buffered saline, and extracted with 200 µL cell lysis buffer (Promega). Nuclei were cleared by centrifugation at 12 000g for 5 minutes. Luciferase assays were performed according to the manufacturer's protocol for the reporter assay system (Promega) with a single-photon channel of a scintillation counter (Beckman, Somerset, NJ) and CAT activity in supernatants. For F9 embryonic teratocarcinoma, a 1:15 dilution was made at 50% confluence, and after 6 hours the cells were transfected with Lipofectamine (Life Technologies) with a constant amount of DNA. Cultures were grown for 25 to 30 hours before harvesting and were assayed for luciferase activity as described above, normalized to vector-dependent CAT activity.

Purification of histidine fusion proteins

Escherichia coli BL21 (DE3) cells transformed with Tax expression plasmid 6HisT-pET11 derivatives were grown and induced with isopropyl-beta -D-thiogalactoside. Histidine fusion proteins were purified from cell lysates on nitrilotriacetic acid-agarose column (Qiagen, Düsseldorf, Germany) by stepwise elution with buffer containing 20 to 100 mM imidazole. Fractions containing histidine fusion proteins were dialyzed against 20 mM HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid)-KOH buffer, pH 7.9, 80 mM KCl, 0.2 mM EDTA (ethylenediaminetetraacetic acid), 0.5 mM dithiothreitol (DTT), 10% glycerol, and 0.1 mM phenylmethylsulfonyl fluoride (PMSF) and were stored frozen at -80°C.

DNAP assay

DNA affinity precipitation (DNAP) assays were performed as described previously.28,34 Briefly, biotinylated DNA probe carrying a tetramer of the CRE-like element was prepared, and aliquots (1 µg) was mixed with a cell lysate containing poly(dI-dC) (15 µg). Streptavidin-Dynabeads (Dynal, Great Neck, NY) were added, collected with a magnet, and washed twice with buffer. The trapped proteins were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by Western blotting. Bands were enhanced with a chemiluminescence detection system (Amersham, Piscataway, NJ). The monoclonal antibody Lt-4 used against Tax was previously reported.41 Anti-CREB-1 (specific for the bZIP domain), anti-CREB-2, anti-ATF4, and anti-CBP antibody were purchased from Santa Cruz Biotechnology (Santa Cruz, CA), along with a bZIP domain peptide derived from CREB-1.

Electrophoretic mobility shift assays

Nuclear extracts of unstimulated or stimulated Jurkat T cells were prepared by the method described by Dignam et al.42 The final extract was dialyzed overnight at 4°C in a mixture of 20 mM HEPES (pH 7.8), 20% glycerol, 0.1 M KCl, 0.2 mM EDTA, 0.5 mM DTT, and PMSF, centrifuged at 10 000g to remove any precipitation, and stored at -80°C in aliquots. The protein concentration ranged between 2 and 4 mg/mL. Electrophoretic mobility shift assays (EMSAs) were carried out as described previously43 with electrophoresis in 5% nondenaturing polyacrylamide gels. The probe used from the Fuc-T VII promoter corresponded to the sequence from -166 bp to -144 bp---GTGGGGGCGTCATATTGCCCTGG. Oligonucleotide competition analysis was conducted with a 20- to 50-fold molar excess of unlabeled wild-type or mutant probe oligonucleotides (mut-probe, GTGGGGGCcaCATATTGCCCTGG) and the 21-bp enhancer sequence in HTLV-1 LTR.28 The CRE-consensus sequence was purchased from Promega. Gels were dried and subjected to autoradiography and analysis with BAS2000 (Fuji Film, Tokyo, Japan). For supershift analysis, 1-µg aliquots of specific antibodies (obtained from Santa Cruz Biotechnology) were used as specified in the figure legends.


    Results
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Tax transactivation of the Fuc-T VII promoter is dependent on the CRE-like element

We reported that Tax induces the expression of Fuc-T VII in vitro and in vivo.22 Previously we cloned a 991-bp fragment of the 5' flanking region of human Fuc-T VII and identified transcriptional start sites (N.H. et al, manuscript submitted). The sequence of the fragment is shown in Figure 1 (the nucleotide sequence reported in this paper has been deposited in the DNA Data Bank of Japan (DDBJ) databases, with accession number AB012668). As judged by the sequence, there is no conventional TATA box upstream of the principal transcription start site, but an initiator element is juxtaposed with an Sp1 consensus site for the accurate initiation of RNA transcription. We subcloned this fragment into the luciferase reporter plasmid and prepared several deletion and mutated constructs. Transfection of Tax with the promoter construct p(-791) resulted in remarkable transactivation (Figure 2). Site-specific Sp1 consensus site mutants exhibited abrogated Fuc-T VII promoter activity, showing that the Sp1 site juxtaposed to an initiator element is critical for the efficiency of initiation and for positioning of transcription start sites in TATA-less promoters.44,45 The reporter constructs p(-791) through p(-193) are activated by Tax, but transactivation was suppressed with the p(-134) reporter construct. Because suppression was seen in the experiments with the smaller reporter constructs, the minimal Tax-responsive element should reside between nucleotides -193 and -134. In this region, we found the sequence GGGGCGTCATATTGCCC, which contains the CRE motif CGTCA (a half-palindromic CRE motif in comparison with the 8-bp full CRE palindrome, TGACGTCA), but did not detect the TRE-2 sequence (a holding protein binding sequence, GGAACCACCCA), which is involved in responding to Tax trans activation in the HTLV-1 LTR promoter.43 However, the TRE-2 sequence contains Sp1 and an Ets-like site, GGAA, side by side. In addition, as shown in Figure 2, we found in the Fuc-T VII promoter/enhancer that they play a critical role in induction and may be related to the TRE-2 structure and its binding factors.46 Because CRE elements are known to be important targets for Tax transactivation of the LTR (viral CRE) and for certain cellular genes (cellular CRE), for confirmation a mutated reporter construct was generated with the half-palindromic CRE motif. Tax-induced transactivation in the Fuc-T VII promoter was significantly suppressed. To confirm the role of the CREB/ATF transcription pathway in Tax-mediated transactivation of the Fuc-T VII promoter, reporter assays were performed with cotransfection of wild-type or selected Tax mutants. The wild-type and M22, which preferentially activates the CRE-dependent pathway but not the NF-kappa B/Rel-dependent pathway, fully activated the reporter construct (Figure 3). We next tested mutants d3 and d7/16. The d3 mutant is almost completely inactive regarding the LTR in HTLV-1 and ATF/CRE sites but is almost fully active with the NF-kappa B site.34 The d7/16 mutant has none of abilities to activate all above.34 These mutants failed to transactivate the Fuc-T VII promoter. These results imply that the CRE-like element has the ability to enhance the Tax-induced expression of Fuc-T VII in Jurkat T cells.


View larger version (55K):
[in this window]
[in a new window]
 
Figure 1. Genomic sequence of the 5'-untranslated region of the Fuc-T VII gene. The number in the left column pertains to the nucleotide location of the first letter in each lane with respect to the +1 site, which corresponds to the principal transcription start site, and the initiator sequence regarding this transcription start site is underlined with a wavy line. Uppercase letters indicate exon sequences, and lowercase letters indicate untranscribed sequences. The ATG codon is in boldface. The CRE-like element is also underlined (half-palindromic CRE motif is in boldface). Another putative cis-acting motif, Sp1, just 5' to Ets-like site (GGAA), is represented by a closed box.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 2. Identification of the Tax-responsive region in the Fuc-T VII promoter. Reporter constructs, full-length, and 5' deletions of the Fuc-T VII sequence cloned upstream of luciferase reporter gene (pGL2) through +104 nucleotide, were transfected into Jurkat T cells and either not cotransfected () or cotransfected with pCGTax (black-square). The transcription start site and its location are indicated with an arrow in each construct. Reporter constructs shown are described in "Materials and methods." The CRE-like element is represented by closed boxes, and the Sp1 consensus element is represented by open boxes. Promoter activity was expressed as the fold induction of the observed reporter activity of the construct cotransfected with pCGTax over that of the negative control, the full-length construct without pCGTax. CRE-mut has a mutation of bases -159 to -155 (from CGTCA to TTTAA) in the half-palindromic CRE motif of the CRE-like element, and Sp1-mut has a mutation of bases -39 to -32 (from GGGGCGGG to GTTTCAGG) in the Sp1 consensus element. Crossed-out boxes depict the site of these mutations. Results are expressed as relative light units normalized for CAT activity. Mean values for 3 independent assays are presented, and the corresponding standard deviation is indicated on the top of each bar.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 3. Differential activation of the Fuc-T VII reporter with Tax mutants. Jurkat T cells were cotransfected with 4 µg reporter construct of the Fuc-T VII promoter and 4 µg pCGTax/Tax mutants. Resultant activities are plotted as fold induction over that in the absence of Tax. Results are the mean values of fold induction for 3 independent assays normalized for CAT activity, and the corresponding standard deviation is indicated on the top of each bar.

Transcription factors of the ATF/CREB family bind to the CRE-like sequence in the Fuc-T VII promoter

Electrophoretic mobility shift assays showed that transcription factors of the CREB/ATF family interact with the CRE-like sequence (Figure 4), as evidenced by competition analysis and antibody recognition. Incubation of a 27-bp oligonucleotide, including a half-palindromic CRE-like site with Jurkat T-cell nuclear extracts, resulted in the formation of 4 major sequence-specific DNA-binding complexes (Figure 4A). The complex with the slowest mobility was identified as ATF1 and ATF2 complexes based on interaction with specific antibodies but was not totally supershifted, suggesting that it might contain other proteins (Figure 4B). Two of the faster migrating complexes were identified as ATF4 (CREB-2) and CREB-1, respectively (Figure 4B). These 3 major bands competed with the probe with the 21-bp enhancer, and with the CRE consensus sequence. We could not identify components of the fastest sequence-specific DNA-binding complex, which was also competed with the probe and the 21-bp enhancer but not with the CRE-consensus sequence (Figure 4A).


View larger version (101K):
[in this window]
[in a new window]
 
Figure 4. Binding of transcription factors of the CREB/ATF family to the CRE-like sequence in the Fuc-T VII promoter. Electrophoretic mobility shift assays were conducted with Jurkat T cell nuclear extracts, as described in "Materials and methods." (A) A 27-bp oligonucleotide containing the CRE-like sequence was used as a probe in the absence and presence of competitor oligonucleotides. Complexes were resolved on a 4% nondenaturing gel. Sequence-specific binding species obtained were competed with a 20- to 50-fold molar excess of the cold competitor oligonucleotide. DNA-protein complexes are numbered. (B) The probe was incubated with specific antibodies against ATF1, ATF3, ATF4 (CREB-2), or CREB-1. Anti-Sp1 antibody was used as a negative control. Specific DNA-protein complexes are indicated by roman numerals. NS indicates nonspecific complex; SS, supershifted band; and CRE-con, CRE-consensus.

Association of Tax with CRE-like DNA-protein complexes containing CREB and CBP/P300

Tax itself is not able to bind DNA,29 but it reportedly interacts with CBP to stabilize the assembly of a multiprotein complex containing CBP/P300, Tax, and CREB/ATF on viral CRE.47 To demonstrate an indirect association of Tax with the CRE-like element, we used a DNAP assay. Biotinylated DNA probes consisting of repeats of the Fuc-T VII CRE-like element were incubated with nuclear extracts from Jurkat T cells, from ED40515-N cells expressing Tax and Fuc-T VII, from YT cells expressing Fuc-T VII but not Tax, and from JPX-9 cells, a Jurkat T-cell subline expressing Tax on incubation with CdCl2. The DNA-protein complexes formed were isolated and examined by immunoblotting for CREB-1, for Tax, and for CBP/P300 (Figure 5). The CRE-like element specifically formed a complex with CREB-1 (molecular mass, 43 kDa) and other undefined CREB family proteins (Figure 5A, lanes 1 and 2). Examination of whether an exogenous bZIP domain, which is conserved among the CREB/ATF family, can associate with the CRE-like element of the Fuc-T VII promoter demonstrated efficient binding to the wild-type, but not to the mutant, element, indicating that the bZIP domain is sufficient for specific DNA binding (Figure 5A, lanes 3 and 4). When the wild-type CRE-like element was used, Tax and CBP/P300 were detected in the CRE-like DNA-protein complex in the nuclear extracts of Tax-expressing cells (Figure 5B-C, lanes 2 and 5) but not with use of the mutated oligonucleotide (Figure 5B-C, lanes 3 and 4), indicating that association of these proteins on the CRE-like element includes the endogenous Tax protein. As with endogenous Tax protein, histidine-Tax was detected in the CRE-like element-protein complex (Figure 5B, lane 7), and CBP/P300 was associated with exogenous Tax (Figure 5C, lane 8). However, the mutant Tax, d3, did not associate with the CRE-like element in the Fuc-T VII promoter (Figure 5C, lane 7), strongly indicating that complex formation of Tax-nuclear protein with the CRE-like element is dependent on binding to the CREB.28


View larger version (16K):
[in this window]
[in a new window]
 
Figure 5. Demonstration of complex formation of Tax protein and CBP/P300 coactivator in nuclear extract with the Fuc-T VII CRE-like element. Nuclear extracts were analyzed in DNAP assay. (A) Detection of CREB-1 protein and the bZIP domain peptide in the Fuc-T VII CRE-like element protein complex. Nuclear extracts from Jurkat T cells (lanes 1-2) or the bZIP domain peptide (lanes 3-4) were incubated with the biotinylated wild-type oligonucleotide (lanes 1 and 3) or the mutated one (lanes 2 and 4), blotted with the anti-CREB-1 antibody reacting to the bZIP domain specifically. (B) Detection of Tax protein in the Fuc-T VII CRE-like element-protein complex. JPX-9 cells were treated with CdCl2 (15 ng/mL) for 24 hours to induce Tax protein in vivo (lanes 2 and 4) and without CdCl2 (lanes 1 and 3). Nuclear extracts were incubated with the biotinylated wild-type oligonucleotide (lanes 1-2 and 5-7) or the mutated oligonucleotide (lanes 3 and 4) of the CRE-like element, blotted with the anti-Tax antibody. Nuclear factor-dependent association of exogenous Tax was detected in the presence of histidine-Tax (lane 7). (C) Association of CBP/P300 coactivator in the nuclear protein-complex formation with Tax. Nuclear extracts of Jurkat T cells were incubated with the CRE-like element in the presence of inactive Tax mutant histidine-d3 (lane 7) or histidine-Tax (lane 8). DNA-protein complexes were analyzed by immunoblotting with anti-CBP. Mr indicates kilodaltons of molecular size markers; and ED, ED40515-N.

CRE-like element in the Fuc-T VII promoter resembles HTLV-1 LTR viral CRE

Surveying the reported sequences that can be transactivated by Tax, we found a similarity with the CRE-like element. Alignment of all three 21-bp repeats in the HTLV-1 LTR, containing viral CREs, revealed the consensus sequence, GGCNNTGACGNNNNCCCC, with a half-palindromic CRE motif (CGTCA) flanked by G+C-rich sequences. In the CRE-like element, .........GGGGGCGTCATATT........... GCCC, in the Fuc-T VII promoter, the nonpalindromic/half-palindromic CRE motif (underlined) is flanked by the G+C-rich sequences (dotted-underlined), the same as the 21-bp repeats in the HTLV-1 LTR. This G+C-rich flanking sequence in the HTLV-1 LTR reportedly contributes to protein kinase A (PKA)-independent activation of HTLV-1 LTR by Tax.30 To examine whether the G+C-rich sequences of the CRE-like element in the Fuc-T VII promoter contribute to phosphorylation-independent Tax transactivation, we measured expression of the Fuc-T VII reporter gene in F9 teratocarcinoma cells in the presence or absence of PKA and Tax, of the somatostatin-Luc reporter gene for cellular CRE, and of the HTLV-1 LTR reporter gene for viral CRE.31 F9 cells were chosen for these studies because they lack functional levels of CREB and PKA.48 They were cotransfected with Tax and CREB-1 in the absence of PKA. The results documented in Figure 6A indicate that in the presence of Tax, CREB-1 activated the Fuc-T VII promoter to more than 20-fold the basal level, as well as the HTLV-1 LTR promoter through the viral CRE. Control transfections indicated no activation in the presence of exogenous CREB-1 alone, suggesting that phosphorylation of CREB-1 is not essential for Tax activation of the Fuc-T VII promoter. To confirm this differential requirement for phosphorylation in Tax-mediated activation of Fuc-T VII, viral CRE, and other Tax-activated cellular CREs, we used CRE modulator alpha  (CREMalpha ), which lacks the glutamine-rich domains present in CREB and generally represses CRE-mediated transactivation.49 F9 cells were cotransfected with Tax and CREMalpha in the absence of PKA. The results in Figure 6B indicate that in the presence of Tax, CREMalpha activated the Fuc-T VII promoter 15-fold as well as the HTLV-1 LTR promoter through the viral CRE. However, cellular CRE required the presence of PKA for Tax-transactivation with CREMalpha . These results revealed that the glutamine-rich regions (lacking in CREMalpha ) are not essential for Tax activation of the Fuc-T VII promoter. Laurance et al30 have provided a model that CBP/P300 should be recruited to the viral CRE through a direct interaction between Tax and the conserved bZIP domain of this isoform through different domains of the CREB/ATF factors, depending on the particular promoter context.


View larger version (22K):
[in this window]
[in a new window]
 
Figure 6. Activation of the HTLV-1 and the Fuc-T VII promoters by CREB-1 or CREMalpha . F9 teratocarcinoma cells were transfected with 4 µg reporter constructs, somatostatin-Luc (), pU3R-Luc (), or Fuc-T VII promoter (p(-791) (black-square), and 0 to 4 µg pCGTax, together with 0 to 4 µg RSV-CREB (A) or 0 to 4 µg RSV-CREMalpha (B) and 4 µg RSV-PKA, as indicated. Resultant activities are plotted as fold induction normalized for CAT activity over that in the absence of Tax. Error bars depict the standard deviations from 3 independent experiments.

G+C-rich flanking sequences in the CRE-like element are required for Tax-mediated activation of the Fuc-T VII promoter

The functional resemblance of the CRE-like element in the Fuc-T VII promoter to viral CRE in the HTLV-1 LTR suggests that these G+C-rich flanking sequences have functional importance in transactivation by Tax. Mutations were, therefore, introduced into the relevant regions of the CRE-like element, including the half-palindromic motif, and the effects on transactivation were analyzed. As shown in Figure 7, substitutions in the 5' G+C-rich sequence (TGGGGright-arrowTGAAG) remarkably reduced reporter activity, but not to the same extent as when the mutant had a substitution in the half-palindromic CRE motif. The latter nearly abolished transactivation. A requirement of the flanking G+C-rich sequences, especially the 5' G+C-rich sequence, in transactivation by Tax has also been found for HTLV-1 LTR.29


View larger version (22K):
[in this window]
[in a new window]
 
Figure 7. Tax activation of the Fuc-T VII promoter is dependent on the CRE-like element and on its flanking G+C-rich sequences. (A) The CRE-like element and the luciferase reporter construct are represented by closed and open boxes, respectively. The Fuc-T VII promoter from nucleotide -791 to +104 with the CRE-like element underlined. Specific mutations in each reporter construct are shown below. (B) Cells were transfected with 4 µg mutant reporter construct alone or in combination with 4 µg pCGTax. Results are expressed as relative light units normalized for CAT activity. Error bars depict the standard deviations from 3 independent experiments.


    Discussion
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

We previously reported that Tax transactivates the Fuc-T VII promoter, which results in the appearance of sialyl Lewis X, the selectin-ligand on leukocytes.22 Although Tax contains a transcriptional activation domain, it is unable to bind DNA directly.29,50 Thus, it has been proposed that the transactivation function of Tax requires its interaction with cellular DNA-binding proteins. In the present study, we documented the results of EMSA experiments and reporter assays indicating that the CRE-like element enhances transactivation by Tax in association with CREB/ATF transcription factors. In particular, DNAP experiments showed the formation of a complex with CREB-1, Tax, and CBP mediated by the CRE-like element in the Fuc-T VII promoter. Results of the reporter assays with mutants of Tax also indicated the involvement of CRE in Tax transactivation of the Fuc-T VII promoter. Previously we described that Tax mutant d3 did not form a complex with either CREB or CREM but rather with the NF-kappa B factors.51 The inability to form the complex and to transactivate the Fuc-T VII promoter also indicates that association with transcription factors of the CREB/ATF family occurs in a Tax sequence-specific manner.

We proposed here that Tax activates the CRE-like element of the Fuc-T VII promoter through a mechanism similar to that for viral CRE in HTLV-1 LTR. Laurance et al30 earlier reported that Tax activates cellular CREs and viral CREs in HTLV-1 LTR through mechanisms that are differentially dependent on phosphorylation. With the use of CREMalpha , which is unable to transactivate cellular CREs even in the presence of Tax, we confirmed the results of Laurance et al30 and also found that in the presence of Tax, these normally repressive nuclear factors of the CREB/ATF family activate the Fuc-T VII promoter and the viral CRE-like element in HTLV-1 LTR in a phosphorylation-independent manner, in contrast to the other cellular CREs. This is in line with the report that the activation of the HTLV-1 promoter through Tax and CREB/ATF nuclear factors is PKA independent.52 We conclude that activation of the viral promoter occurs through the recruitment of CBP/P300 and requires, in addition to Tax, only the bZIP domain that is conserved among CREB and CREMalpha . In contrast, activation of the cellular CREs by Tax appears to require the presence of PKA and an isoform of CREB or CREM that contains the kinase-inducible domain (KID). Thus, our results indicate that activation of the Fuc-T VII CRE-like element by Tax is attributed to the ability of Tax, interacting with the minimal bZIP domain, to recruit the coactivator CBP/P300 to the promoter even without phosphorylation. Regarding the transactivation of HTLV-1 LTR by Tax, it has been demonstrated that the G+C-rich sequences flanking the viral CREs are essential for Tax-enhanced binding of CREB/ATF transcription factors to the half-palindromic CRE-like element.53-55 We also reported previously that another G+C-rich sequence, TRE2S, adjacent to the 21-bp enhancer in LTR, can influence the 21-bp enhancer activity through the novel binding factor Tax-helping protein-1 (THP-1) and Gli2 protein.43,56,57 We could detect a similar effect of THP-1 and Gli2 protein on the Fuc-T VII promoter (T.Y. et al, unpublished results, September 2002) as that on the 21-bp enhancer of HTLV-1. With viral CRE, G+C-rich flanking sequences are critical for Tax-CREB/ATF-DNA ternary complex assembly and transactivation.58-60 Furthermore, it is known that Tax enhances binding of the factors to the CRE-like element but not the palindromic CREs, such as somatostatin promoter cellular CRE,61 providing support for the idea that the occupancy of CREB over a particular CRE site is influenced by flanking sequences. As here shown in Figure 8, Tax may provide a bridge between the coactivator CBP/P300 and CREB/ATF nuclear factor(s) assembled on the Fuc-T VII CRE-like element in a phosphorylation-independent manner. In view of the homology to TRE2S and the findings with undefined proteins in the EMSA shown in Figure 4, other transcriptional factors, such as THP-1 and Gli2, may be involved in cooperation with the CRE-like element in responding to Tax transactivation.43,62


View larger version (21K):
[in this window]
[in a new window]
 
Figure 8. Model depicting a suggested mechanism by which Tax could increase the cooperative effect of CBP on the Fuc-T VII CRE-like element. CREB/ATF refers to CREB/ATF transcription factor(s). Tax, in association with CREB/ATF and the CRE-like element, creates a binding site that anchors CBP/P300 to the promoter. The initiator consensus sequence (Inr) is described in "Results" and in Figure 1.

Recently, Fimia et al46 reported the existence of a novel nuclear factor that can associate with CRE elements, bypassing the classic requirement of activation by CREB and CREM. That is, it does not require their phosphorylation by PKA. They suggested the possibility of other phosphorylation-independent CREB activators, which might contribute to the mechanism of transactivation through CRE-like element in the Fuc-T VII promoter. The observed mode of transactivation might suggest the presence of a new class of cofactors whose function does not require the phosphorylation of CREB/ATF transcription factors.


    Acknowledgments

We thank Dr R. H. Goodman and Dr J. F. Habener for providing plasmid DNAs and Dr K. Ohtani and Professor M. Nakamura for the gift of JPX-9 cells.


    Footnotes

Submitted July 31, 2002; accepted December 2, 2002.

Prepublished online as Blood First Edition Paper, December 27, 2002; DOI 10.1182/blood-2002-07-2301.

Supported in part by the Ministry of Education, Culture, Sports, Science and Technology, Japan (grants-in-aid 13680732,13670582, and on priority areas 14030092) and grants-in-aid for the Second Term Comprehensive 10-Year Strategy for Cancer Control from the Ministry of Health, Labor and Welfare, Japan.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Reiji Kannagi, Division of Molecular Pathology, Aichi Cancer Center, Chikusa-ku, Nagoya, 464-8681, Japan; e-mail: rkannagi{at}aichi-cc.jp.


    References
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

1. Ohmori K, Takada A, Ohwaki I, et al. A distinct type of sialyl Lewis X antigen defined by a novel monoclonal antibody is selectively expressed on helper memory T cells. Blood. 1993;82:2797-2805[Abstract/Free Full Text].

2. Furukawa Y, Tara M, Ohmori K, Kannagi R. Variant type of sialyl Lewis X antigen expressed on adult T cell leukemia cells is associated with skin involvement. Cancer Res. 1994;54:6533-6538[Abstract/Free Full Text].

3. Takatsuki K. Kenneth MacGredie Memorial Lectureship: adult T-cell leukemia/lymphoma. Leukemia. 1997;11(suppl 3):54-56[CrossRef][Medline] [Order article via Infotrieve].

4. Yoshida M, Miyoshi I, Hinuma Y. Isolation and characterization of retrovirus from cell lines of human adult T-cell leukemia and its implication in the disease. Proc Natl Acad Sci U S A. 1982;79:2031-2035[Abstract/Free Full Text].

5. Shimoyama M. Diagnostic criteria and classification of clinical subtypes of adult T- cell leukaemia-lymphoma; a report from the Lymphoma Study Group (1984-87). Br J Haematol. 1991;79:428-437[Medline] [Order article via Infotrieve].

6. Springer TA. Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell. 1994;76:301-314[CrossRef][Medline] [Order article via Infotrieve].

7. Kansas GS. Selectins and their ligands: current concepts and controversies. Blood. 1996;88:3259-3287[Free Full Text].

8. Weston BW, Hiller KM, Mayben JP, et al. A cloned CD15-negative variant of HL60 cells is deficient in expression of FUT7 and does not adhere to cytokine-stimulated endothelial cells. Eur J Haematol. 1999;63:42-49[Medline] [Order article via Infotrieve].

9. Knibbs RN, Craig RA, Natsuka S, et al. The fucosyltransferase FucT-VII regulates E-selectin ligand synthesis in human T cells. J Cell Biol. 1996;133:911-920[Abstract/Free Full Text].

10. Wagers AJ, Stoolman LM, Kannagi R, Craig R, Kansas GS. Expression of leukocyte fucosyltransferases regulates binding to E-selectin: relationship to previously implicated carbohydrate epitopes. J Immunol. 1997;159:1917-1929[Abstract].

11. Wagers AJ, Kansas GS. Potent induction of alpha(1,3)-fucosyltransferase VII in activated CD4+ T cells by TGF-beta 1 through a p38 mitogen-activated protein kinase-dependent pathway. J Immunol. 2000;165:5011-5016[Abstract/Free Full Text].

12. Wagers AJ, Stoolman LM, Craig R, Knibbs RN, Kansas GS. An sLex-deficient variant of HL60 cells exhibits high levels of adhesion to vascular selectins: further evidence that HECA-452 and CSLEX1 monoclonal antibody epitopes are not essential for high avidity binding to vascular selectins. J Immunol. 1998;160:5122-5129[Abstract/Free Full Text].

13. Lim YC, Henault L, Wagers AJ, Kansas GS, Luscinskas FW, Lichtman AH. Expression of functional selectin ligands on Th cells is differentially regulated by IL-12 and IL-4. J Immunol. 1999;162:3193-3201[Abstract/Free Full Text].

14. Erdmann I, Scheidegger EP, Koch FK, et al. Fucosyltransferase VII-deficient mice with defective E-, P-, and L-selectin ligands show impaired CD4+ and CD8+ T cell migration into the skin, but normal extravasation into visceral organs. J Immunol. 2002;168:2139-2146[Abstract/Free Full Text].

15. Natsuka S, Gersten KM, Zenita K, Kannagi R, Lowe JB. Molecular cloning of a cDNA encoding a novel human leukocyte alpha-1,3-fucosyltransferase capable of synthesizing the sialyl Lewis x determinant. J Biol Chem. 1994;269:16789-16794[Abstract/Free Full Text].

16. Sasaki K, Kurata K, Funayama K, et al. Expression cloning of a novel alpha 1,3-fucosyltransferase that is involved in biosynthesis of the sialyl Lewis x carbohydrate determinants in leukocytes. J Biol Chem. 1994;269:14730-14737[Abstract/Free Full Text].

17. Smithson G, Rogers CE, Smith PL, et al. Fuc-TVII is required for T helper 1 and T cytotoxic 1 lymphocyte selectin ligand expression and recruitment in inflammation, and together with Fuc-TIV regulates naive T cell trafficking to lymph nodes. J Exp Med. 2001;194:601-614[Abstract/Free Full Text].

18. Delmotte P, Degroote S, Lafitte JJ, Lamblin G, Perini JM, Roussel P. Tumor necrosis factor alpha increases the expression of glycosyltransferases and sulfotransferases responsible for the biosynthesis of sialylated and/or sulfated Lewis x epitopes in the human bronchial mucosa. J Biol Chem. 2002;277:424-431[Abstract/Free Full Text].

19. Knibbs RN, Craig RA, Maly P, et al. Alpha(1,3)-fucosyltransferase VII-dependent synthesis of P- and E-selectin ligands on cultured T lymphoblasts. J Immunol. 1998;161:6305-6315[Abstract/Free Full Text].

20. Wagers AJ, Lowe JB, Kansas GS. An important role for the alpha 1,3 fucosyltransferase, FucT-VII, in leukocyte adhesion to E-selectin. Blood. 1996;88:2125-2132[Abstract/Free Full Text].

21. Hiraiwa N, Dohi T, Kawakami-Kimura N, et al. Suppression of sialyl Lewis X expression and E-selectin-mediated cell adhesion in cultured human lymphoid cells by transfection of antisense cDNA of an alpha1right-arrow3 fucosyltransferase (Fuc-T VII). J Biol Chem. 1996;271:31556-31561[Abstract/Free Full Text].

22. Hiraiwa N, Hiraiwa M, Kannagi R. Human T-cell leukemia virus-1 encoded Tax protein transactivates alpha 1right-arrow3 fucosyltransferase Fuc-T VII, which synthesizes sialyl Lewis X, a selectin ligand expressed on adult T-cell leukemia cells. Biochem Biophys Res Commun. 1997;231:183-186[CrossRef][Medline] [Order article via Infotrieve].

23. Felber BK, Paskalis H, Kleinman-Ewing C, Wong-Staal F, Pavlakis GN. The pX protein of HTLV-I is a transcriptional activator of its long terminal repeats. Science. 1985;229:675-679[Abstract/Free Full Text].

24. Yoshida M, Inoue J, Fujisawa J, Seiki M. Molecular mechanisms of regulation of HTLV-1 gene expression and its association with leukemogenesis. Genome. 1989;31:662-667[Medline] [Order article via Infotrieve]

25. Yoshida M, Fujisawa J, Inoue J, Seiki M. Mechanism of the gene expression of HTLV-I and its association with ATL. AIDS Res. 1986;2(suppl 1):S71-S78[Medline] [Order article via Infotrieve].

26. Inoue J, Seiki M, Taniguchi T, Tsuru S, Yoshida M. Induction of interleukin 2 receptor gene expression by p40x encoded by human T-cell leukemia virus type 1. EMBO J. 1986;5:2883-2888[Medline] [Order article via Infotrieve].

27. Fujii M, Sassone-Corsi P, Verma IM. c-fos promoter trans-activation by the tax1 protein of human T-cell leukemia virus type I. Proc Natl Acad Sci U S A. 1988;85:8526-8530[Abstract/Free Full Text].

28. Suzuki T, Fujisawa JI, Toita M, Yoshida M. The trans-activator tax of human T-cell leukemia virus type 1 (HTLV-1) interacts with cAMP-responsive element (CRE) binding and CRE modulator proteins that bind to the 21-base-pair enhancer of HTLV-1. Proc Natl Acad Sci U S A. 1993;90:610-614[Abstract/Free Full Text].

29. Fujisawa J, Toita M, Yoshida M. A unique enhancer element for the trans activator (p40tax) of human T-cell leukemia virus type I that is distinct from cyclic AMP- and 12-O- tetradecanoylphorbol-13-acetate-responsive elements. J Virol. 1989;63:3234-3239[Abstract/Free Full Text].

30. Laurance ME, Kwok RP, Huang MS, Richards JP, Lundblad JR, Goodman RH. Differential activation of viral and cellular promoters by human T-cell lymphotropic virus-1 tax and cAMP-responsive element modulator isoforms. J Biol Chem. 1997;272:2646-2651[Abstract/Free Full Text].

31. Brauweiler A, Garl P, Franklin AA, Giebler HA, Nyborg JK. A molecular mechanism for human T-cell leukemia virus latency and Tax transactivation. J Biol Chem. 1995;270:12814-12822[Abstract/Free Full Text].

32. Nagata K, Ohtani K, Nakamura M, Sugamura K. Activation of endogenous c-fos proto-oncogene expression by human T-cell leukemia virus type I-encoded p40 tax protein in the human T-cell line, Jurkat. J Virol. 1989;63:3220-3226[Abstract/Free Full Text].

33. Fujisawa J, Toita M, Yoshimura T, Yoshida M. The indirect association of human T-cell leukemia virus tax protein with DNA results in transcriptional activation. J Virol. 1991;65:4525-4528[Abstract/Free Full Text].

34. Hirai H, Fujisawa J, Suzuki T, et al. Transcriptional activator Tax of HTLV-1 binds to the NF-kappa B precursor p105. Oncogene. 1992;7:1737-1742[Medline] [Order article via Infotrieve].

35. Suzuki T, Hirai H, Fujisawa J, Fujita T, Yoshida M. A trans-activator Tax of human T-cell leukemia virus type 1 binds to NF-kappa B p50 and serum response factor (SRF) and associates with enhancer DNAs of the NF-kappa B site and CArG box. Oncogene. 1993;8:2391-2397[Medline] [Order article via Infotrieve].

36. Smith MR, Greene WC. Type I human T cell leukemia virus tax protein transforms rat fibroblasts through the cyclic adenosine monophosphate response element binding protein/activating transcription factor pathway. J Clin Invest. 1991;88:1038-1042[Medline] [Order article via Infotrieve].

37. Walton KM, Rehfuss RP, Chrivia JC, Lochner JE, Goodman RH. A dominant repressor of cyclic adenosine 3',5'-monophosphate (cAMP)-regulated enhancer-binding protein activity inhibits the cAMP-mediated induction of the somatostatin promoter in vivo. Mol Endocrinol. 1992;6:647-655[Abstract/Free Full Text].

38. Gitlin SD, Dittmer J, Shin RC, Brady JN. Transcriptional activation of the human T-lymphotropic virus type I long terminal repeat by functional interaction of Tax1 and Ets1. J Virol. 1993;67:7307-7316[Abstract/Free Full Text].

39. Montminy MR, Sevarino KA, Wagner JA, Mandel G, Goodman RH. Identification of a cyclic-AMP-responsive element within the rat somatostatin gene. Proc Natl Acad Sci U S A. 1986;83:6682-6686[Abstract/Free Full Text].

40. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene. 1989;77:51-59[CrossRef][Medline] [Order article via Infotrieve].

41. Tanaka Y, Yoshida A, Tozawa H, Shida H, Nyunoya H, Shimotohno K. Production of a recombinant human T-cell leukemia virus type-I transactivator (tax1) antigen and its utilization for generation of monoclonal antibodies against various epitopes on the tax1 antigen. Int J Cancer. 1991;48:623-630[Medline] [Order article via Infotrieve].

42. Dignam JD, Lebovitz RM, Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 1983;11:1475-1489[Abstract/Free Full Text].

43. Tanimura A, Teshima H, Fujisawa J, Yoshida M. A new regulatory element that augments the Tax-dependent enhancer of human T-cell leukemia virus type 1 and cloning of cDNAs encoding its binding proteins. J Virol. 1993;67:5375-5382[Abstract/Free Full Text].

44. Smale ST, Baltimore D. The "initiator" as a transcription control element. Cell. 1989;57:103-113[CrossRef][Medline] [Order article via Infotrieve].

45. Smale ST, Schmidt MC, Berk AJ, Baltimore D. Transcriptional activation by Sp1 as directed through TATA or initiator: specific requirement for mammalian transcription factor IID. Proc Natl Acad Sci U S A. 1990;87:4509-4513[Abstract/Free Full Text].

46. Fimia GM, De Cesare D, Sassone-Corsi P. CBP-independent activation of CREM and CREB by the LIM-only protein ACT. Nature. 1999;398:165-169[CrossRef][Medline] [Order article via Infotrieve].

47. Harrod R, Tang Y, Nicot C, et al. An exposed KID-like domain in human T-cell lymphotropic virus type 1 Tax is responsible for the recruitment of coactivators CBP/p300. Mol Cell Biol. 1998;18:5052-5061[Abstract/Free Full Text].

48. Masson N, Ellis M, Goodbourn S, Lee KA. Cyclic AMP response element-binding protein and the catalytic subunit of protein kinase A are present in F9 embryonal carcinoma cells but are unable to activate the somatostatin promoter. Mol Cell Biol. 1992;12:1096-1106[Abstract/Free Full Text].

49. Foulkes NS, Borrelli E, Sassone-Corsi P. CREM gene: use of alternative DNA-binding domains generates multiple antagonists of cAMP-induced transcription. Cell. 1991;64:739-749[CrossRef][Medline] [Order article via Infotrieve].

50. Walker WH, Sanborn BM, Habener JF. An isoform of transcription factor CREM expressed during spermatogenesis lacks the phosphorylation domain and represses cAMP-induced transcription. Proc Natl Acad Sci U S A. 1994;91:12423-12427[Abstract/Free Full Text].

51. Fujii M, Tsuchiya H, Chuhjo T, Minamino T, Miyamoto K, Seiki M. Serum response factor has functional roles both in indirect binding to the CArG box and in the transcriptional activation function of human T-cell leukemia virus type I Tax. J Virol. 1994;68:7275-7283[Abstract/Free Full Text].

52. Kwok RP, Lundblad JR, Chrivia JC, et al. Nuclear protein CBP is a coactivator for the transcription factor CREB. Nature. 1994;370:223-226[CrossRef][Medline] [Order article via Infotrieve].

53. Wagner S, Green MR. HTLV-I Tax protein stimulation of DNA binding of bZIP proteins by enhancing dimerization. Science. 1993;262:395-399[Abstract/Free Full Text].

54. Lenzmeier BA, Baird EE, Dervan PB, Nyborg JK. The tax protein-DNA interaction is essential for HTLV-1 transactivation in vitro. J Mol Biol. 1999;291:731-744[CrossRef][Medline] [Order article via Infotrieve].

55. Kimzey AL, Dynan WS. Identification of a human T-cell leukemia virus type I tax peptide in contact with DNA. J Biol Chem. 1999;274:34226-34232[Abstract/Free Full Text].

56. Tanimura A, Dan S, Yoshida M. Cloning of novel isoforms of the human Gli2 oncogene and their activities to enhance tax-dependent transcription of the human T-cell leukemia virus type 1 genome. J Virol. 1998;72:3958-3964[Abstract/Free Full Text].

57. Smith MJ, Gitlin SD, Browning CM, et al. GLI-2 modulates retroviral gene expression. J Virol. 2001;75:2301-2313[Abstract/Free Full Text].

58. Baranger AM, Palmer CR, Hamm MK, et al. Mechanism of DNA-binding enhancement by the human T-cell leukaemia virus transactivator Tax. Nature. 1995;376:606-608[CrossRef][Medline] [Order article via Infotrieve].

59. Kwok RP, Laurance ME, Lundblad JR, et al. Control of cAMP-regulated enhancers by the viral transactivator Tax through CREB and the co-activator CBP. Nature. 1996;380:642-646[CrossRef][Medline] [Order article via Infotrieve].

60. Shetty S, Takahashi T, Matsui H, Ayengar R, Raghow R. Transcriptional autorepression of Msx1 gene is mediated by interactions of Msx1 protein with a multi-protein transcriptional complex containing TATA-binding protein, Sp1 and cAMP-response element binding protein (CBP/p300). Biochem J. 1999;339:751-758[CrossRef][Medline] [Order article via Infotrieve].

61. Lundblad JR, Kwok RP, Laurance ME, et al. The human T-cell leukemia virus-1 transcriptional activator Tax enhances cAMP-responsive element-binding protein (CREB) binding activity through interactions with the DNA minor groove. J Biol Chem. 1998;273:19251-19259[Abstract/Free Full Text].

62. Dan S, Tanimura A, Yoshida M. Interaction of Gli2 with CREB protein on DNA elements in the long terminal repeat of human T-cell leukemia virus type 1 is responsible for transcriptional activation by Tax protein. J Virol. 1999;73:3258-3263[Abstract/Free Full Text].

© 2003 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
GlycobiologyHome page
K. Nystrom, R. Norden, I. Muylaert, P. Elias, G. Larson, and S. Olofsson
Induction of sialyl-Lex expression by herpes simplex virus type 1 is dependent on viral immediate early RNA-activated transcription of host fucosyltransferase genes
Glycobiology, August 1, 2009; 19(8): 847 - 859.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
R. Norden, K. Nystrom, and S. Olofsson
Activation of host antiviral RNA-sensing factors necessary for herpes simplex virus type 1-activated transcription of host cell fucosyltransferase genes FUT3, FUT5, and FUT6 and subsequent expression of sLex in virus-infected cells
Glycobiology, July 1, 2009; 19(7): 776 - 788.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G.-Y. Chen, K. Sakuma, and R. Kannagi
Significance of NF-{kappa}B/GATA Axis in Tumor Necrosis Factor-{alpha}-induced Expression of 6-Sulfated Cell Recognition Glycans in Human T-lymphocytes
J. Biol. Chem., December 12, 2008; 283(50): 34563 - 34570.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
K. Nystrom, A. Grahn, M. Lindh, M. Brytting, U. Mandel, G. Larson, and S. Olofsson
Virus-induced transcriptional activation of host FUT genes associated with neo-expression of Ley in cytomegalovirus-infected and sialyl-Lex in varicella-zoster virus-infected diploid human cells
Glycobiology, April 1, 2007; 17(4): 355 - 366.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G.-Y. Chen, H. Osada, L. F. Santamaria-Babi, and R. Kannagi
Interaction of GATA-3/T-bet transcription factors regulates expression of sialyl Lewis X homing receptors on Th1/Th2 lymphocytes
PNAS, November 7, 2006; 103(45): 16894 - 16899.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M.-X. Guo, D. Wang, H.-J. Shao, H.-L. Qiu, L. Xue, Z.-Z. Zhao, C.-G. Zhu, Y.-B. Shi, and W.-X. Li
Transcription of Human Zinc Finger ZNF268 Gene Requires an Intragenic Promoter Element
J. Biol. Chem., August 25, 2006; 281(34): 24623 - 24636.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Ohmori, F. Fukui, M. Kiso, T. Imai, O. Yoshie, H. Hasegawa, K. Matsushima, and R. Kannagi
Identification of cutaneous lymphocyte-associated antigen as sialyl 6-sulfo Lewis X, a selectin ligand expressed on a subset of skin-homing helper memory T cells
Blood, April 15, 2006; 107(8): 3197 - 3204.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
J. Kikuchi, H. Shinohara, C. Nonomura, H. Ando, S. Takaku, H. Nojiri, and M. Nakamura
Not core 2 {beta}1,6-N-acetylglucosaminyltransferase-2 or -3 but -1 regulates sialyl-Lewis x expression in human precursor B cells
Glycobiology, March 1, 2005; 15(3): 271 - 280.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. K. Patnaik, B. Potvin, and P. Stanley
LEC12 and LEC29 Gain-of-Function Chinese Hamster Ovary Mutants Reveal Mechanisms for Regulating VIM-2 Antigen Synthesis and E-selectin Binding
J. Biol. Chem., November 26, 2004; 279(48): 49716 - 49726.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
N. Markine-Goriaynoff, L. Gillet, J. L. Van Etten, H. Korres, N. Verma, and A. Vanderplasschen
Glycosyltransferases encoded by viruses
J. Gen. Virol., October 1, 2004; 85(10): 2741 - 2754.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. D. Dodon, Z. Li, S. Hamaia, and L. Gazzolo
Tax protein of human T-cell leukaemia virus type 1 induces interleukin 17 gene expression in T cells
J. Gen. Virol., July 1, 2004; 85(7): 1921 - 1932.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Koike, N. Kimura, K. Miyazaki, T. Yabuta, K. Kumamoto, S. Takenoshita, J. Chen, M. Kobayashi, M. Hosokawa, A. Taniguchi, et al.
Hypoxia induces adhesion molecules on cancer cells: A missing link between Warburg effect and induction of selectin-ligand carbohydrates
PNAS, May 25, 2004; 101(21): 8132 - 8137.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2002-07-2301v1
101/9/3615    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hiraiwa, N.
Right arrow Articles by Kannagi, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hiraiwa, N.
Right arrow Articles by Kannagi, R.
Related Collections
Right arrow Neoplasia
Right arrow Cell Adhesion and Motility
Right arrow Gene Expression
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2003 by American Society of Hematology         Online ISSN: 1528-0020