| |
|
|
|
|
|
|
|||
|
Prepublished online as a Blood First Edition Paper on December 27, 2002; DOI 10.1182/blood-2002-07-2301.
NEOPLASIA
From the Division of Molecular Pathology, Aichi Cancer
Center, Chikusa-ku, Nagoya; Department of Infectious Disease and
Immunology, Faculty of Medicine, Okinawa-Asia Research Center of
Medical Science, University of the Ryukyus, Nishihara; and Department
of Cellular and Molecular Biology, The Institute of Medical Science,
University of Tokyo, Shirokanedai, Minato-ku, Japan.
Human T-cell leukemic virus type 1 (HTLV-1)-infected T cells
express the fucosyltransferase (Fuc-T) VII
gene involved in the biosynthesis of the leukocyte sialyl Lewis
X, which may be related to tissue infiltration in patients with
malignant adult T-cell leukemia. HTLV-1 induces Fuc-T VII
transcription through the viral transactivator Tax, although the
underlying molecular mechanism remains unknown. In the present study,
we analyzed the role of the cis-activating element in Tax
activation using reporter constructs bearing the 5'-regulatory region
of Fuc-T VII in Jurkat T cells. A sequence
(GGCTGTGGGGGCGTCATATTGCCCTGG) covering a half-palindromic cyclic
adenosine monophosphate (cAMP)-responsive element (CRE) was found to
be required for Tax activation of the Fuc-T VII promoter. We further demonstrated that transcription factors of the CRE-binding protein (CREB)/activating transcription factor (ATF) family bind to
this CRE-like sequence and that Tax binds in association with CREB and
the coactivator CREB-binding protein (CBP) in Jurkat T cells. This
element, containing the G+C-rich flanking sequences, is homologous to
the Tax-responsive viral CREs in the HTLV-1 long terminal repeat
(LTR)-promoter. Furthermore, CREM We have previously shown that leukemia cells in
patients with adult T-cell leukemia (ATL), and cell lines derived
therefrom, more strongly express sialyl Lewis X, a major ligand for
selectins in leukocytes, than other types of human lymphocytic leukemia cells.1,2 ATL is a malignancy of peripheral
CD4+ cells initiated by infection with human T-cell
leukemic virus type 1 (HTLV-1).3,4 Infiltration by
leukemic cells into various tissues is a frequent manifestation of
ATL5 and often causes serious clinical problems. The
degree of expression of sialyl Lewis X on leukemic cells in ATL
significantly correlates with their degree of extravascular
infiltration.2 The evidence suggests that deregulated
expression of sialyl Lewis X determinant on leukemic cells is involved
in the infiltration of ATL cells because the binding of sialyl Lewis X
on leukocytes with selectins on endothelial cells is known to trigger
extravasation.6-8
Human fucosyltransferase VII (Fuc-T VII) has proved to be crucial for
the synthesis of sialyl Lewis X,9,10 the expression of
which is regulated during hematopoietic differentiation, inflammation, and malignant transformation.11-14 Recent studies revealed
that the synthesis of sialyl Lewis X in leukocytes and leukemic cells is controlled principally at the level of transcription of Fuc-T VII.9,10,12,15-21
Therefore, it is important to determine how the transcription of
Fuc-T VII is enhanced in ATL cells. We previously found that the expression of sialyl Lewis X and Fuc-T VII is
transactivated by HTLV-1 Tax,22 which is involved in the
proliferation and transformation of T cells in ATL through the control
of viral gene expression.23-25 Tax also exerts its
transactivating effects on promoters of various cellular
genes.26,27 In the present study, undertaken to
investigate the mechanism underlying transactivational effects of Tax
on the Fuc-T VII promoter, we identified a Tax-responsive element in the Fuc-T VII promoter that contains a
half-palindromic cAMP-responsive element (CRE) binding to CRE-binding
protein/activating transcription factor (CREB/ATF) factors. The family
of CREB/ATF transcription factors, a member of the basic leucine zipper
(bZIP) transcription factor group, has been shown to bind the
Tax-responsive element in the 21-base pair (bp) repeats of the HTLV-1
long-terminal repeat (LTR) promoter and to modulate viral promoter
activity.28 Further examination revealed that this
CRE-like element highly resembles the Tax-responsive element in the
21-bp repeats, called the viral CRE, similarly flanked by G+C-rich
sequences.29
In addition to the structural resemblance, we confirmed that this
CRE-like element is functionally involved in transactivation of
Fuc-T VII by Tax in a phosphorylation-independent
manner.30,31
Cells and plasmids
Construction of 5'-deletion and site-directed mutants
Promoter activity determinations Cultures at 50% to 60% confluence grown in 6-well culture plates were rinsed in serum-free medium and exposed to SV40-CAT (0.5 µg) and reporter constructs (4 µg), with or without pCGTax (4 µg) with 0.5% DMRIE-C (Life Technologies, Grand Island, NY) for 5 hours. Cells were refed medium supplemented with 10% fetal calf serum and cultured for 48 to 72 hours to reach confluence, rinsed twice with phosphate-buffered saline, and extracted with 200 µL cell lysis buffer (Promega). Nuclei were cleared by centrifugation at 12 000g for 5 minutes. Luciferase assays were performed according to the manufacturer's protocol for the reporter assay system (Promega) with a single-photon channel of a scintillation counter (Beckman, Somerset, NJ) and CAT activity in supernatants. For F9 embryonic teratocarcinoma, a 1:15 dilution was made at 50% confluence, and after 6 hours the cells were transfected with Lipofectamine (Life Technologies) with a constant amount of DNA. Cultures were grown for 25 to 30 hours before harvesting and were assayed for luciferase activity as described above, normalized to vector-dependent CAT activity.Purification of histidine fusion proteins Escherichia coli BL21 (DE3) cells transformed with Tax expression plasmid 6HisT-pET11 derivatives were grown and induced with isopropyl- -D-thiogalactoside. Histidine fusion proteins were purified from cell lysates on nitrilotriacetic acid-agarose column (Qiagen, Düsseldorf, Germany) by stepwise elution with buffer containing 20 to 100 mM imidazole. Fractions containing histidine fusion proteins were dialyzed against 20 mM HEPES
(N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid)-KOH buffer, pH
7.9, 80 mM KCl, 0.2 mM EDTA (ethylenediaminetetraacetic acid), 0.5 mM
dithiothreitol (DTT), 10% glycerol, and 0.1 mM phenylmethylsulfonyl fluoride (PMSF) and were stored frozen at 80°C.
DNAP assay DNA affinity precipitation (DNAP) assays were performed as described previously.28,34 Briefly, biotinylated DNA probe carrying a tetramer of the CRE-like element was prepared, and aliquots (1 µg) was mixed with a cell lysate containing poly(dI-dC) (15 µg). Streptavidin-Dynabeads (Dynal, Great Neck, NY) were added, collected with a magnet, and washed twice with buffer. The trapped proteins were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by Western blotting. Bands were enhanced with a chemiluminescence detection system (Amersham, Piscataway, NJ). The monoclonal antibody Lt-4 used against Tax was previously reported.41 Anti-CREB-1 (specific for the bZIP domain), anti-CREB-2, anti-ATF4, and anti-CBP antibody were purchased from Santa Cruz Biotechnology (Santa Cruz, CA), along with a bZIP domain peptide derived from CREB-1.Electrophoretic mobility shift assays Nuclear extracts of unstimulated or stimulated Jurkat T cells were prepared by the method described by Dignam et al.42 The final extract was dialyzed overnight at 4°C in a mixture of 20 mM HEPES (pH 7.8), 20% glycerol, 0.1 M KCl, 0.2 mM EDTA, 0.5 mM DTT, and PMSF, centrifuged at 10 000g to remove any precipitation, and stored at 80°C in aliquots. The protein concentration ranged between 2 and 4 mg/mL. Electrophoretic mobility shift assays (EMSAs) were carried out as described previously43 with
electrophoresis in 5% nondenaturing polyacrylamide gels. The probe
used from the Fuc-T VII promoter corresponded to the
sequence from 166 bp to 144 bp GTGGGGGCGTCATATTGCCCTGG.
Oligonucleotide competition analysis was conducted with a 20- to
50-fold molar excess of unlabeled wild-type or mutant probe
oligonucleotides (mut-probe, GTGGGGGCcaCATATTGCCCTGG) and the 21-bp
enhancer sequence in HTLV-1 LTR.28 The CRE-consensus sequence was purchased from Promega. Gels were dried and subjected to
autoradiography and analysis with BAS2000 (Fuji Film, Tokyo, Japan).
For supershift analysis, 1-µg aliquots of specific antibodies (obtained from Santa Cruz Biotechnology) were used as specified in the
figure legends.
Tax transactivation of the Fuc-T VII promoter is dependent on the CRE-like element We reported that Tax induces the expression of Fuc-T VII in vitro and in vivo.22 Previously we cloned a 991-bp fragment of the 5' flanking region of human Fuc-T VII and identified transcriptional start sites (N.H. et al, manuscript submitted). The sequence of the fragment is shown in Figure 1 (the nucleotide sequence reported in this paper has been deposited in the DNA Data Bank of Japan (DDBJ) databases, with accession number AB012668). As judged by the sequence, there is no conventional TATA box upstream of the principal transcription start site, but an initiator element is juxtaposed with an Sp1 consensus site for the accurate initiation of RNA transcription. We subcloned this fragment into the luciferase reporter plasmid and prepared several deletion and mutated constructs. Transfection of Tax with the promoter construct p( 791) resulted in remarkable transactivation (Figure
2). Site-specific Sp1 consensus site
mutants exhibited abrogated Fuc-T VII promoter activity, showing that the Sp1 site juxtaposed to an initiator element is critical for the efficiency of initiation and for positioning of
transcription start sites in TATA-less promoters.44,45 The reporter constructs p( 791) through p( 193) are activated by Tax, but
transactivation was suppressed with the p( 134) reporter construct. Because suppression was seen in the experiments with the smaller reporter constructs, the minimal Tax-responsive element should reside
between nucleotides 193 and 134. In this region, we found the
sequence GGGGCGTCATATTGCCC, which contains the CRE motif CGTCA (a
half-palindromic CRE motif in comparison with the 8-bp full CRE
palindrome, TGACGTCA), but did not detect the TRE-2 sequence (a holding
protein binding sequence, GGAACCACCCA), which is involved in responding
to Tax trans activation in the HTLV-1 LTR
promoter.43 However, the TRE-2 sequence contains Sp1 and
an Ets-like site, GGAA, side by side. In addition, as shown in Figure
2, we found in the Fuc-T VII promoter/enhancer that
they play a critical role in induction and may be related to the TRE-2
structure and its binding factors.46 Because CRE elements
are known to be important targets for Tax transactivation of the LTR
(viral CRE) and for certain cellular genes (cellular CRE), for
confirmation a mutated reporter construct was generated with the
half-palindromic CRE motif. Tax-induced transactivation in the
Fuc-T VII promoter was significantly suppressed. To
confirm the role of the CREB/ATF transcription pathway in Tax-mediated
transactivation of the Fuc-T VII promoter, reporter assays
were performed with cotransfection of wild-type or selected Tax
mutants. The wild-type and M22, which preferentially activates the
CRE-dependent pathway but not the NF- B/Rel-dependent pathway, fully
activated the reporter construct (Figure
3). We next tested mutants d3 and d7/16.
The d3 mutant is almost completely inactive regarding the LTR in HTLV-1
and ATF/CRE sites but is almost fully active with the NF- B
site.34 The d7/16 mutant has none of abilities to activate
all above.34 These mutants failed to transactivate the
Fuc-T VII promoter. These results imply that the CRE-like
element has the ability to enhance the Tax-induced expression of Fuc-T
VII in Jurkat T cells.
Transcription factors of the ATF/CREB family bind to the CRE-like sequence in the Fuc-T VII promoter Electrophoretic mobility shift assays showed that transcription factors of the CREB/ATF family interact with the CRE-like sequence (Figure 4), as evidenced by competition analysis and antibody recognition. Incubation of a 27-bp oligonucleotide, including a half-palindromic CRE-like site with Jurkat T-cell nuclear extracts, resulted in the formation of 4 major sequence-specific DNA-binding complexes (Figure 4A). The complex with the slowest mobility was identified as ATF1 and ATF2 complexes based on interaction with specific antibodies but was not totally supershifted, suggesting that it might contain other proteins (Figure 4B). Two of the faster migrating complexes were identified as ATF4 (CREB-2) and CREB-1, respectively (Figure 4B). These 3 major bands competed with the probe with the 21-bp enhancer, and with the CRE consensus sequence. We could not identify components of the fastest sequence-specific DNA-binding complex, which was also competed with the probe and the 21-bp enhancer but not with the CRE-consensus sequence (Figure 4A).
Association of Tax with CRE-like DNA-protein complexes containing CREB and CBP/P300 Tax itself is not able to bind DNA,29 but it reportedly interacts with CBP to stabilize the assembly of a multiprotein complex containing CBP/P300, Tax, and CREB/ATF on viral CRE.47 To demonstrate an indirect association of Tax with the CRE-like element, we used a DNAP assay. Biotinylated DNA probes consisting of repeats of the Fuc-T VII CRE-like element were incubated with nuclear extracts from Jurkat T cells, from ED40515-N cells expressing Tax and Fuc-T VII, from YT cells expressing Fuc-T VII but not Tax, and from JPX-9 cells, a Jurkat T-cell subline expressing Tax on incubation with CdCl2. The DNA-protein complexes formed were isolated and examined by immunoblotting for CREB-1, for Tax, and for CBP/P300 (Figure 5). The CRE-like element specifically formed a complex with CREB-1 (molecular mass, 43 kDa) and other undefined CREB family proteins (Figure 5A, lanes 1 and 2). Examination of whether an exogenous bZIP domain, which is conserved among the CREB/ATF family, can associate with the CRE-like element of the Fuc-T VII promoter demonstrated efficient binding to the wild-type, but not to the mutant, element, indicating that the bZIP domain is sufficient for specific DNA binding (Figure 5A, lanes 3 and 4). When the wild-type CRE-like element was used, Tax and CBP/P300 were detected in the CRE-like DNA-protein complex in the nuclear extracts of Tax-expressing cells (Figure 5B-C, lanes 2 and 5) but not with use of the mutated oligonucleotide (Figure 5B-C, lanes 3 and 4), indicating that association of these proteins on the CRE-like element includes the endogenous Tax protein. As with endogenous Tax protein, histidine-Tax was detected in the CRE-like element-protein complex (Figure 5B, lane 7), and CBP/P300 was associated with exogenous Tax (Figure 5C, lane 8). However, the mutant Tax, d3, did not associate with the CRE-like element in the Fuc-T VII promoter (Figure 5C, lane 7), strongly indicating that complex formation of Tax-nuclear protein with the CRE-like element is dependent on binding to the CREB.28
CRE-like element in the Fuc-T VII promoter resembles HTLV-1 LTR viral CRE Surveying the reported sequences that can be transactivated by Tax, we found a similarity with the CRE-like element. Alignment of all three 21-bp repeats in the HTLV-1 LTR, containing viral CREs, revealed the consensus sequence, GGCNNTGACGNNNNCCCC, with a half-palindromic CRE motif (CGTCA) flanked by G+C-rich sequences. In the CRE-like element, .........GGGGGCGTCATATT........... GCCC, in the Fuc-T VII promoter, the nonpalindromic/half-palindromic CRE motif (underlined) is flanked by the G+C-rich sequences (dotted-underlined), the same as the 21-bp repeats in the HTLV-1 LTR. This G+C-rich flanking sequence in the HTLV-1 LTR reportedly contributes to protein kinase A (PKA)-independent activation of HTLV-1 LTR by Tax.30 To examine whether the G+C-rich sequences of the CRE-like element in the Fuc-T VII promoter contribute to phosphorylation-independent Tax transactivation, we measured expression of the Fuc-T VII reporter gene in F9 teratocarcinoma cells in the presence or absence of PKA and Tax, of the somatostatin-Luc reporter gene for cellular CRE, and of the HTLV-1 LTR reporter gene for viral CRE.31 F9 cells were chosen for these studies because they lack functional levels of CREB and PKA.48 They were cotransfected with Tax and CREB-1 in the absence of PKA. The results documented in Figure 6A indicate that in the presence of Tax, CREB-1 activated the Fuc-T VII promoter to more than 20-fold the basal level, as well as the HTLV-1 LTR promoter through the viral CRE. Control transfections indicated no activation in the presence of exogenous CREB-1 alone, suggesting that phosphorylation of CREB-1 is not essential for Tax activation of the Fuc-T VII promoter. To confirm this differential requirement for phosphorylation in Tax-mediated activation of Fuc-T VII, viral CRE, and other Tax-activated cellular CREs, we used CRE modulator (CREM ),
which lacks the glutamine-rich domains present in CREB and generally
represses CRE-mediated transactivation.49 F9 cells were
cotransfected with Tax and CREM in the absence of PKA. The results
in Figure 6B indicate that in the presence of Tax, CREM activated
the Fuc-T VII promoter 15-fold as well as the HTLV-1 LTR
promoter through the viral CRE. However, cellular CRE required
the presence of PKA for Tax-transactivation with CREM . These results
revealed that the glutamine-rich regions (lacking in CREM ) are not
essential for Tax activation of the Fuc-T VII promoter.
Laurance et al30 have provided a model that CBP/P300
should be recruited to the viral CRE through a direct interaction
between Tax and the conserved bZIP domain of this isoform through
different domains of the CREB/ATF factors, depending on the particular
promoter context.
G+C-rich flanking sequences in the CRE-like element are required for Tax-mediated activation of the Fuc-T VII promoter The functional resemblance of the CRE-like element in the Fuc-T VII promoter to viral CRE in the HTLV-1 LTR suggests that these G+C-rich flanking sequences have functional importance in transactivation by Tax. Mutations were, therefore, introduced into the relevant regions of the CRE-like element, including the half-palindromic motif, and the effects on transactivation were analyzed. As shown in Figure 7, substitutions in the 5' G+C-rich sequence (TGGGG TGAAG) remarkably
reduced reporter activity, but not to the same extent as when the
mutant had a substitution in the half-palindromic CRE motif. The latter
nearly abolished transactivation. A requirement of the flanking
G+C-rich sequences, especially the 5' G+C-rich sequence, in
transactivation by Tax has also been found for HTLV-1
LTR.29
We previously reported that Tax transactivates the Fuc-T
VII promoter, which results in the appearance of sialyl Lewis X, the selectin-ligand on leukocytes.22 Although Tax contains
a transcriptional activation domain, it is unable to bind DNA
directly.29,50 Thus, it has been proposed that the
transactivation function of Tax requires its interaction with cellular
DNA-binding proteins. In the present study, we documented the results
of EMSA experiments and reporter assays indicating that the CRE-like
element enhances transactivation by Tax in association with CREB/ATF
transcription factors. In particular, DNAP experiments showed the
formation of a complex with CREB-1, Tax, and CBP mediated by the
CRE-like element in the Fuc-T VII promoter. Results of the
reporter assays with mutants of Tax also indicated the involvement of
CRE in Tax transactivation of the Fuc-T VII promoter.
Previously we described that Tax mutant d3 did not form a complex with
either CREB or CREM but rather with the NF- We proposed here that Tax activates the CRE-like element of the
Fuc-T VII promoter through a mechanism similar to that for viral CRE in HTLV-1 LTR. Laurance et al30 earlier reported
that Tax activates cellular CREs and viral CREs in HTLV-1 LTR through mechanisms that are differentially dependent on phosphorylation. With
the use of CREM
Recently, Fimia et al46 reported the existence of a novel nuclear factor that can associate with CRE elements, bypassing the classic requirement of activation by CREB and CREM. That is, it does not require their phosphorylation by PKA. They suggested the possibility of other phosphorylation-independent CREB activators, which might contribute to the mechanism of transactivation through CRE-like element in the Fuc-T VII promoter. The observed mode of transactivation might suggest the presence of a new class of cofactors whose function does not require the phosphorylation of CREB/ATF transcription factors.
We thank Dr R. H. Goodman and Dr J. F. Habener for providing plasmid DNAs and Dr K. Ohtani and Professor M. Nakamura for the gift of JPX-9 cells.
Submitted July 31, 2002; accepted December 2, 2002.
Prepublished online as Blood First Edition Paper, December 27, 2002; DOI 10.1182/blood-2002-07-2301.
Supported in part by the Ministry of Education, Culture, Sports, Science and Technology, Japan (grants-in-aid 13680732,13670582, and on priority areas 14030092) and grants-in-aid for the Second Term Comprehensive 10-Year Strategy for Cancer Control from the Ministry of Health, Labor and Welfare, Japan.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Reiji Kannagi, Division of Molecular Pathology, Aichi Cancer Center, Chikusa-ku, Nagoya, 464-8681, Japan; e-mail: rkannagi{at}aichi-cc.jp.
1.
Ohmori K, Takada A, Ohwaki I, et al.
A distinct type of sialyl Lewis X antigen defined by a novel monoclonal antibody is selectively expressed on helper memory T cells.
Blood.
1993;82:2797-2805
2.
Furukawa Y, Tara M, Ohmori K, Kannagi R.
Variant type of sialyl Lewis X antigen expressed on adult T cell leukemia cells is associated with skin involvement.
Cancer Res.
1994;54:6533-6538 3. Takatsuki K. Kenneth MacGredie Memorial Lectureship: adult T-cell leukemia/lymphoma. Leukemia. 1997;11(suppl 3):54-56[CrossRef][Medline] [Order article via Infotrieve].
4.
Yoshida M, Miyoshi I, Hinuma Y.
Isolation and characterization of retrovirus from cell lines of human adult T-cell leukemia and its implication in the disease.
Proc Natl Acad Sci U S A.
1982;79:2031-2035 5. Shimoyama M. Diagnostic criteria and classification of clinical subtypes of adult T- cell leukaemia-lymphoma; a report from the Lymphoma Study Group (1984-87). Br J Haematol. 1991;79:428-437[Medline] [Order article via Infotrieve]. 6. Springer TA. Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell. 1994;76:301-314[CrossRef][Medline] [Order article via Infotrieve].
7.
Kansas GS.
Selectins and their ligands: current concepts and controversies.
Blood.
1996;88:3259-3287 8. Weston BW, Hiller KM, Mayben JP, et al. A cloned CD15-negative variant of HL60 cells is deficient in expression of FUT7 and does not adhere to cytokine-stimulated endothelial cells. Eur J Haematol. 1999;63:42-49[Medline] [Order article via Infotrieve].
9.
Knibbs RN, Craig RA, Natsuka S, et al.
The fucosyltransferase FucT-VII regulates E-selectin ligand synthesis in human T cells.
J Cell Biol.
1996;133:911-920 10. Wagers AJ, Stoolman LM, Kannagi R, Craig R, Kansas GS. Expression of leukocyte fucosyltransferases regulates binding to E-selectin: relationship to previously implicated carbohydrate epitopes. J Immunol. 1997;159:1917-1929[Abstract].
11.
Wagers AJ, Kansas GS.
Potent induction of alpha(1,3)-fucosyltransferase VII in activated CD4+ T cells by TGF-beta 1 through a p38 mitogen-activated protein kinase-dependent pathway.
J Immunol.
2000;165:5011-5016
12.
Wagers AJ, Stoolman LM, Craig R, Knibbs RN, Kansas GS.
An sLex-deficient variant of HL60 cells exhibits high levels of adhesion to vascular selectins: further evidence that HECA-452 and CSLEX1 monoclonal antibody epitopes are not essential for high avidity binding to vascular selectins.
J Immunol.
1998;160:5122-5129
13.
Lim YC, Henault L, Wagers AJ, Kansas GS, Luscinskas FW, Lichtman AH.
Expression of functional selectin ligands on Th cells is differentially regulated by IL-12 and IL-4.
J Immunol.
1999;162:3193-3201
14.
Erdmann I, Scheidegger EP, Koch FK, et al.
Fucosyltransferase VII-deficient mice with defective E-, P-, and L-selectin ligands show impaired CD4+ and CD8+ T cell migration into the skin, but normal extravasation into visceral organs.
J Immunol.
2002;168:2139-2146
15.
Natsuka S, Gersten KM, Zenita K, Kannagi R, Lowe JB.
Molecular cloning of a cDNA encoding a novel human leukocyte alpha-1,3-fucosyltransferase capable of synthesizing the sialyl Lewis x determinant.
J Biol Chem.
1994;269:16789-16794
16.
Sasaki K, Kurata K, Funayama K, et al.
Expression cloning of a novel alpha 1,3-fucosyltransferase that is involved in biosynthesis of the sialyl Lewis x carbohydrate determinants in leukocytes.
J Biol Chem.
1994;269:14730-14737
17.
Smithson G, Rogers CE, Smith PL, et al.
Fuc-TVII is required for T helper 1 and T cytotoxic 1 lymphocyte selectin ligand expression and recruitment in inflammation, and together with Fuc-TIV regulates naive T cell trafficking to lymph nodes.
J Exp Med.
2001;194:601-614
18.
Delmotte P, Degroote S, Lafitte JJ, Lamblin G, Perini JM, Roussel P.
Tumor necrosis factor alpha increases the expression of glycosyltransferases and sulfotransferases responsible for the biosynthesis of sialylated and/or sulfated Lewis x epitopes in the human bronchial mucosa.
J Biol Chem.
2002;277:424-431
19.
Knibbs RN, Craig RA, Maly P, et al.
Alpha(1,3)-fucosyltransferase VII-dependent synthesis of P- and E-selectin ligands on cultured T lymphoblasts.
J Immunol.
1998;161:6305-6315
20.
Wagers AJ, Lowe JB, Kansas GS.
An important role for the alpha 1,3 fucosyltransferase, FucT-VII, in leukocyte adhesion to E-selectin.
Blood.
1996;88:2125-2132
21.
Hiraiwa N, Dohi T, Kawakami-Kimura N, et al.
Suppression of sialyl Lewis X expression and E-selectin-mediated cell adhesion in cultured human lymphoid cells by transfection of antisense cDNA of an alpha1
22.
Hiraiwa N, Hiraiwa M, Kannagi R.
Human T-cell leukemia virus-1 encoded Tax protein transactivates alpha 1
23.
Felber BK, Paskalis H, Kleinman-Ewing C, Wong-Staal F, Pavlakis GN.
The pX protein of HTLV-I is a transcriptional activator of its long terminal repeats.
Science.
1985;229:675-679 24. Yoshida M, Inoue J, Fujisawa J, Seiki M. Molecular mechanisms of regulation of HTLV-1 gene expression and its association with leukemogenesis. Genome. 1989;31:662-667[Medline] [Order article via Infotrieve] 25. Yoshida M, Fujisawa J, Inoue J, Seiki M. Mechanism of the gene expression of HTLV-I and its association with ATL. AIDS Res. 1986;2(suppl 1):S71-S78[Medline] [Order article via Infotrieve]. 26. Inoue J, Seiki M, Taniguchi T, Tsuru S, Yoshida M. Induction of interleukin 2 receptor gene expression by p40x encoded by human T-cell leukemia virus type 1. EMBO J. 1986;5:2883-2888[Medline] [Order article via Infotrieve].
27.
Fujii M, Sassone-Corsi P, Verma IM.
c-fos promoter trans-activation by the tax1 protein of human T-cell leukemia virus type I.
Proc Natl Acad Sci U S A.
1988;85:8526-8530
28.
Suzuki T, Fujisawa JI, Toita M, Yoshida M.
The trans-activator tax of human T-cell leukemia virus type 1 (HTLV-1) interacts with cAMP-responsive element (CRE) binding and CRE modulator proteins that bind to the 21-base-pair enhancer of HTLV-1.
Proc Natl Acad Sci U S A.
1993;90:610-614
29.
Fujisawa J, Toita M, Yoshida M.
A unique enhancer element for the trans activator (p40tax) of human T-cell leukemia virus type I that is distinct from cyclic AMP- and 12-O- tetradecanoylphorbol-13-acetate-responsive elements.
J Virol.
1989;63:3234-3239
30.
Laurance ME, Kwok RP, Huang MS, Richards JP, Lundblad JR, Goodman RH.
Differential activation of viral and cellular promoters by human T-cell lymphotropic virus-1 tax and cAMP-responsive element modulator isoforms.
J Biol Chem.
1997;272:2646-2651
31.
Brauweiler A, Garl P, Franklin AA, Giebler HA, Nyborg JK.
A molecular mechanism for human T-cell leukemia virus latency and Tax transactivation.
J Biol Chem.
1995;270:12814-12822
32.
Nagata K, Ohtani K, Nakamura M, Sugamura K.
Activation of endogenous c-fos proto-oncogene expression by human T-cell leukemia virus type I-encoded p40 tax protein in the human T-cell line, Jurkat.
J Virol.
1989;63:3220-3226
33.
Fujisawa J, Toita M, Yoshimura T, Yoshida M.
The indirect association of human T-cell leukemia virus tax protein with DNA results in transcriptional activation.
J Virol.
1991;65:4525-4528 34. Hirai H, Fujisawa J, Suzuki T, et al. Transcriptional activator Tax of HTLV-1 binds to the NF-kappa B precursor p105. Oncogene. 1992;7:1737-1742[Medline] [Order article via Infotrieve]. 35. Suzuki T, Hirai H, Fujisawa J, Fujita T, Yoshida M. A trans-activator Tax of human T-cell leukemia virus type 1 binds to NF-kappa B p50 and serum response factor (SRF) and associates with enhancer DNAs of the NF-kappa B site and CArG box. Oncogene. 1993;8:2391-2397[Medline] [Order article via Infotrieve]. 36. Smith MR, Greene WC. Type I human T cell leukemia virus tax protein transforms rat fibroblasts through the cyclic adenosine monophosphate response element binding protein/activating transcription factor pathway. J Clin Invest. 1991;88:1038-1042[Medline] [Order article via Infotrieve].
37.
Walton KM, Rehfuss RP, Chrivia JC, Lochner JE, Goodman RH.
A dominant repressor of cyclic adenosine 3',5'-monophosphate (cAMP)-regulated enhancer-binding protein activity inhibits the cAMP-mediated induction of the somatostatin promoter in vivo.
Mol Endocrinol.
1992;6:647-655
38.
Gitlin SD, Dittmer J, Shin RC, Brady JN.
Transcriptional activation of the human T-lymphotropic virus type I long terminal repeat by functional interaction of Tax1 and Ets1.
J Virol.
1993;67:7307-7316
39.
Montminy MR, Sevarino KA, Wagner JA, Mandel G, Goodman RH.
Identification of a cyclic-AMP-responsive element within the rat somatostatin gene.
Proc Natl Acad Sci U S A.
1986;83:6682-6686 40. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene. 1989;77:51-59[CrossRef][Medline] [Order article via Infotrieve]. 41. Tanaka Y, Yoshida A, Tozawa H, Shida H, Nyunoya H, Shimotohno K. Production of a recombinant human T-cell leukemia virus type-I transactivator (tax1) antigen and its utilization for generation of monoclonal antibodies against various epitopes on the tax1 antigen. Int J Cancer. 1991;48:623-630[Medline] [Order article via Infotrieve].
42.
Dignam JD, Lebovitz RM, Roeder RG.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
1983;11:1475-1489
43.
Tanimura A, Teshima H, Fujisawa J, Yoshida M.
A new regulatory element that augments the Tax-dependent enhancer of human T-cell leukemia virus type 1 and cloning of cDNAs encoding its binding proteins.
J Virol.
1993;67:5375-5382 44. Smale ST, Baltimore D. The "initiator" as a transcription control element. Cell. 1989;57:103-113[CrossRef][Medline] [Order article via Infotrieve].
45.
Smale ST, Schmidt MC, Berk AJ, Baltimore D.
Transcriptional activation by Sp1 as directed through TATA or initiator: specific requirement for mammalian transcription factor IID.
Proc Natl Acad Sci U S A.
1990;87:4509-4513 46. Fimia GM, De Cesare D, Sassone-Corsi P. CBP-independent activation of CREM and CREB by the LIM-only protein ACT. Nature. 1999;398:165-169[CrossRef][Medline] [Order article via Infotrieve].
47.
Harrod R, Tang Y, Nicot C, et al.
An exposed KID-like domain in human T-cell lymphotropic virus type 1 Tax is responsible for the recruitment of coactivators CBP/p300.
Mol Cell Biol.
1998;18:5052-5061
48.
Masson N, Ellis M, Goodbourn S, Lee KA.
Cyclic AMP response element-binding protein and the catalytic subunit of protein kinase A are present in F9 embryonal carcinoma cells but are unable to activate the somatostatin promoter.
Mol Cell Biol.
1992;12:1096-1106 49. Foulkes NS, Borrelli E, Sassone-Corsi P. CREM gene: use of alternative DNA-binding domains generates multiple antagonists of cAMP-induced transcription. Cell. 1991;64:739-749[CrossRef][Medline] [Order article via Infotrieve].
50.
Walker WH, Sanborn BM, Habener JF.
An isoform of transcription factor CREM expressed during spermatogenesis lacks the phosphorylation domain and represses cAMP-induced transcription.
Proc Natl Acad Sci U S A.
1994;91:12423-12427
51.
Fujii M, Tsuchiya H, Chuhjo T, Minamino T, Miyamoto K, Seiki M.
Serum response factor has functional roles both in indirect binding to the CArG box and in the transcriptional activation function of human T-cell leukemia virus type I Tax.
J Virol.
1994;68:7275-7283 52. Kwok RP, Lundblad JR, Chrivia JC, et al. Nuclear protein CBP is a coactivator for the transcription factor CREB. Nature. 1994;370:223-226[CrossRef][Medline] [Order article via Infotrieve].
53.
Wagner S, Green MR.
HTLV-I Tax protein stimulation of DNA binding of bZIP proteins by enhancing dimerization.
Science.
1993;262:395-399 54. Lenzmeier BA, Baird EE, Dervan PB, Nyborg JK. The tax protein-DNA interaction is essential for HTLV-1 transactivation in vitro. J Mol Biol. 1999;291:731-744[CrossRef][Medline] [Order article via Infotrieve].
55.
Kimzey AL, Dynan WS.
Identification of a human T-cell leukemia virus type I tax peptide in contact with DNA.
J Biol Chem.
1999;274:34226-34232
56.
Tanimura A, Dan S, Yoshida M.
Cloning of novel isoforms of the human Gli2 oncogene and their activities to enhance tax-dependent transcription of the human T-cell leukemia virus type 1 genome.
J Virol.
1998;72:3958-3964
57.
Smith MJ, Gitlin SD, Browning CM, et al.
GLI-2 modulates retroviral gene expression.
J Virol.
2001;75:2301-2313 58. Baranger AM, Palmer CR, Hamm MK, et al. Mechanism of DNA-binding enhancement by the human T-cell leukaemia virus transactivator Tax. Nature. 1995;376:606-608[CrossRef][Medline] [Order article via Infotrieve]. 59. Kwok RP, Laurance ME, Lundblad JR, et al. Control of cAMP-regulated enhancers by the viral transactivator Tax through CREB and the co-activator CBP. Nature. 1996;380:642-646[CrossRef][Medline] [Order article via Infotrieve]. 60. Shetty S, Takahashi T, Matsui H, Ayengar R, Raghow R. Transcriptional autorepression of Msx1 gene is mediated by interactions of Msx1 protein with a multi-protein transcriptional complex containing TATA-binding protein, Sp1 and cAMP-response element binding protein (CBP/p300). Biochem J. 1999;339:751-758[Medline] [Order article via Infotrieve].
61.
Lundblad JR, Kwok RP, Laurance ME, et al.
The human T-cell leukemia virus-1 transcriptional activator Tax enhances cAMP-responsive element-binding protein (CREB) binding activity through interactions with the DNA minor groove.
J Biol Chem.
1998;273:19251-19259
62.
Dan S, Tanimura A, Yoshida M.
Interaction of Gli2 with CREB protein on DNA elements in the long terminal repeat of human T-cell leukemia virus type 1 is responsible for transcriptional activation by Tax protein.
J Virol.
1999;73:3258-3263
© 2003 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
K. Nystrom, R. Norden, I. Muylaert, P. Elias, G. Larson, and S. Olofsson Induction of sialyl-Lex expression by herpes simplex virus type 1 is dependent on viral immediate early RNA-activated transcription of host fucosyltransferase genes Glycobiology, August 1, 2009; 19(8): 847 - 859. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Norden, K. Nystrom, and S. Olofsson Activation of host antiviral RNA-sensing factors necessary for herpes simplex virus type 1-activated transcription of host cell fucosyltransferase genes FUT3, FUT5, and FUT6 and subsequent expression of sLex in virus-infected cells Glycobiology, July 1, 2009; 19(7): 776 - 788. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-Y. Chen, K. Sakuma, and R. Kannagi Significance of NF-{kappa}B/GATA Axis in Tumor Necrosis Factor-{alpha}-induced Expression of 6-Sulfated Cell Recognition Glycans in Human T-lymphocytes J. Biol. Chem., December 12, 2008; 283(50): 34563 - 34570. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nystrom, A. Grahn, M. Lindh, M. Brytting, U. Mandel, G. Larson, and S. Olofsson Virus-induced transcriptional activation of host FUT genes associated with neo-expression of Ley in cytomegalovirus-infected and sialyl-Lex in varicella-zoster virus-infected diploid human cells Glycobiology, April 1, 2007; 17(4): 355 - 366. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-Y. Chen, H. Osada, L. F. Santamaria-Babi, and R. Kannagi Interaction of GATA-3/T-bet transcription factors regulates expression of sialyl Lewis X homing receptors on Th1/Th2 lymphocytes PNAS, November 7, 2006; 103(45): 16894 - 16899. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-X. Guo, D. Wang, H.-J. Shao, H.-L. Qiu, L. Xue, Z.-Z. Zhao, C.-G. Zhu, Y.-B. Shi, and W.-X. Li Transcription of Human Zinc Finger ZNF268 Gene Requires an Intragenic Promoter Element J. Biol. Chem., August 25, 2006; 281(34): 24623 - 24636. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ohmori, F. Fukui, M. Kiso, T. Imai, O. Yoshie, H. Hasegawa, K. Matsushima, and R. Kannagi Identification of cutaneous lymphocyte-associated antigen as sialyl 6-sulfo Lewis X, a selectin ligand expressed on a subset of skin-homing helper memory T cells Blood, April 15, 2006; 107(8): 3197 - 3204. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kikuchi, H. Shinohara, C. Nonomura, H. Ando, S. Takaku, H. Nojiri, and M. Nakamura Not core 2 {beta}1,6-N-acetylglucosaminyltransferase-2 or -3 but -1 regulates sialyl-Lewis x expression in human precursor B cells Glycobiology, March 1, 2005; 15(3): 271 - 280. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Patnaik, B. Potvin, and P. Stanley LEC12 and LEC29 Gain-of-Function Chinese Hamster Ovary Mutants Reveal Mechanisms for Regulating VIM-2 Antigen Synthesis and E-selectin Binding J. Biol. Chem., November 26, 2004; 279(48): 49716 - 49726. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Markine-Goriaynoff, L. Gillet, J. L. Van Etten, H. Korres, N. Verma, and A. Vanderplasschen Glycosyltransferases encoded by viruses J. Gen. Virol., October 1, 2004; 85(10): 2741 - 2754. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Dodon, Z. Li, S. Hamaia, and L. Gazzolo Tax protein of human T-cell leukaemia virus type 1 induces interleukin 17 gene expression in T cells J. Gen. Virol., July 1, 2004; 85(7): 1921 - 1932. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Koike, N. Kimura, K. Miyazaki, T. Yabuta, K. Kumamoto, S. Takenoshita, J. Chen, M. Kobayashi, M. Hosokawa, A. Taniguchi, et al. Hypoxia induces adhesion molecules on cancer cells: A missing link between Warburg effect and induction of selectin-ligand carbohydrates PNAS, May 25, 2004; 101(21): 8132 - 8137. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2003 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||