Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 1 December 2003, Vol. 102, No. 12, pp. 4146-4152.
Prepublished online as a Blood First Edition Paper on July 10, 2003; DOI 10.1182/blood-2003-03-0971.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-03-0971v1
102/12/4146    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Freie, B.
Right arrow Articles by Clapp, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Freie, B.
Right arrow Articles by Clapp, D. W.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Neoplasia
Right arrow Red Cells
Right arrow Apoptosis
Right arrow Gene Expression
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

NEOPLASIA

Fanconi anemia type C and p53 cooperate in apoptosis and tumorigenesis

Brian Freie, Xiaxin Li, Samantha L. M. Ciccone, Kathy Nawa, Scott Cooper, Catherine Vogelweid, Laurel Schantz, Laura S. Haneline, Attilio Orazi, Hal E. Broxmeyer, Suk-Hee Lee, and D. Wade Clapp

From the Herman B. Wells Center for Pediatric Research, Departments of Microbiology and Immunology, Pediatrics, Medicine, Laboratory Animal Research Center, Pathology, Biochemistry, and the Walther Oncology Center, Indiana University School of Medicine, Indianapolis.


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Fanconi anemia (FA) is a recessive genomic instability syndrome characterized by developmental defects, progressive bone marrow failure, and cancer. FA is genetically heterogeneous, however; the proteins encoded by different FA loci interact functionally with each other and with the BRCA1, BRCA2, and ATM gene products. Although patients with FA are highly predisposed to the development of myeloid leukemia and solid tumors, the alterations in biochemical pathways responsible for the progression of tumorigenesis in these patients remain unknown. FA cells are hypersensitive to a range of genotoxic and cellular stresses that activate signaling pathways mediating apoptosis. Here we show that ionizing radiation (IR) induces modestly elevated levels of p53 in cells from FA type C (Fancc) mutant mice and that inactivation of Trp53 rescues tumor necrosis factor {alpha}-induced apoptosis in myeloid cells from Fancc-/- mice. Further, whereas Fancc-/- mice failed to form hematopoietic or solid malignancies, mice mutant at both Fancc and Trp53 developed tumors more rapidly than mice mutant at Trp53 alone. This shortened latency was associated with the appearance of tumor types that are found in patients with FA but not in mice mutant at Trp53 only. Collectively, these data demonstrate that p53 and Fancc interact functionally to regulate apoptosis and tumorigenesis in Fancc-deficient cells. (Blood. 2003;102:4146-4152)


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Fanconi anemia (FA) is an autosomal recessive disorder characterized by a progressive bone marrow failure, developmental defects, and cancer. Individuals with FA have a 500- to 1000-fold increased risk of developing myeloid leukemia and a range of solid tumors that preferentially affect the head and neck, skin, and gastrointestinal and genitourinary systems.1-4 Recent studies have identified the existence of 7 FA gene products (denoted FANCA-FANCG) that appear to function, at least in part, in a complex of signaling proteins that modulate genomic stability (for a review, see Joenje and Patel5). In addition, one gene product (FANCC) appears to have a role in modulating apoptosis in addition to its role in the FANCA-FANCG complex.6-8 The ways the different FA proteins interact with each other and with other biochemical pathways to maintain genomic stability and prevent tumor formation is an area of active investigation.

Although the mechanisms underlying tumor formation in patients with FA are incompletely understood, epidemiologic and experimental observations raise a number of possibilities. First, the development of malignant cells from primary cells frequently requires alterations in apoptosis or cell cycle control. Because myeloid malignancies predominantly occur in the context of progressive apoptotic depletion of hematopoietic progenitors in patients with FA9 and in Fancc-/- mice,10 it has been hypothesized that leukemogenesis results from an accumulation of mutations that precipitates the emergence of apoptotic-resistant precursors. Second, p53 is a pivotal sensor of genotoxic and nongenotoxic stress and activates signaling pathways that result in cell cycle arrest or apoptosis. The apoptosis in FANCC-deficient lymphoblasts has previously been shown to be due to activation of protein kinase R (PKR).11 Because p53 is a downstream effector of PKR,12-14 inactivation or polymorphisms of p53 or proteins in the p53 pathway may be an important target for cellular transformation in FA-associated myeloid malignancies. Third, patients with FA are predisposed to solid tumors, including epithelial and squamous cell carcinomas, which have a high rate of p53 alteration in sporadic malignancies.15,16 The risk of these solid tumors in patients with FA goes up markedly after 20 years of age and increases to a cumulative risk of 90% by 40 years of age.2 Finally, recent studies have positioned the FA proteins in a biochemical pathway that includes BRCA1 and BRCA2.17,18 In fact, truncating, hypomorphic mutations of BRCA2 were observed in the FA-D1 complementation group.18 Further, studies using Brca1 and Brca2 conditional knockout mice support a role for p53 in tumor progression.19-21

Although epidemiologic and biochemical data suggest a role for p53 in mediating apoptosis and cancer in FA, a previous study found that a dominant-negative p53 did not affect apoptosis in FANCC-deficient, immortalized lymphoblasts exposed to genotoxic stress.22 However, the use of immortalized cell lines that may have altered p53 function23 is an inherent limitation in those studies. Therefore, to model endogenous stresses incurred by the organism in vivo, we performed a genetic intercross of Fancc and Trp53 mutant mice to characterize how these genes interact in mediating apoptosis and tumorigenesis.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Cell culture

Primary murine embryo fibroblasts (MEFs) were obtained from day 12 to 14 mouse embryos derived from breeding of Fancc+/- mice. Embryos were obtained, and a small amount of tissue was used for polymerase chain reaction (PCR) analysis. Fibroblasts were derived by mincing embryos and culturing on tissue culture dishes in growth media consisting of Dulbecco modified Eagle/F12 media containing 10% fetal calf serum (FCS) supplemented with 2 mM L-glutamine and 100 U/mL penicillin and 100 U/mL streptomycin (Gibco BRL, Grand Island, NY). After 3 days of culture, plates were trypsinized and cells were expanded for experimental use or frozen. MEFs were maintained on the basis of a 3T3 protocol. All experiments using MEFs were performed with cells that were passage 4 to 6. For treating cells with ionizing radiation (IR), we used a Gammacell-40 exactor (Nordion, Ottawa, ON, Canada) containing a 137Cs source.

Mouse models

Mice containing a disruption of the Fancc gene were generously provided by Dr Manuel Buchwald (University of Toronto, Hospital for Sick Children).24 These mice were back-crossed for 10 generations into the C57BL/6J strain. Mice were genotyped using PCR to detect wild-type and mutant Fancc alleles as described.8 Mice harboring a disruption of the Trp53 gene have been previously described25 and were obtained in the C57BL/6J strain from Jackson Laboratories (Bar Harbor, ME). Trp53 genotype was determined using a PCR method and primer sequences as provided by the Jackson Laboratories. Fancc and Trp53 compound heterozygous mice were generated by mating Fancc+/- mice with Trp53+/- mice. The F2 generation was produced by crossing the compound heterozygotes derived from the F1 mice, and these mice were monitored long term for tumors and morbidity. Due to the low frequency of Fancc-/-Trp53-/- mice obtained, some mice of this genotype were generated by crossing Fancc+/- with Trp53-/- mice.

Histology and immunohistochemistry

Mice that were moribund were killed, and autopsies were performed by a veterinary pathologist. Tissues and tumors were fixed in 10% formalin, and paraffin sections were obtained. Immunohistochemistry was used to specifically identify the lineage of malignant cells in some tumors using Mac-2 (M3/38; Cedarlane Laboratories, Hornby, ON, Canada) antibody, which is a widely accepted marker of tissue macrophages/monocytes in myeloid malignancy.26 Immunohistochemistry was performed as recommended by the antibody supplier. Donkey antirat secondary antibody (Jackson Immunoresearch Labs, West Grove, PA) was detected using the streptavidin-horseradish peroxidase (HRP) LSAB2 system (Dako, Carpinteria, CA).

Immunoblotting

Whole-cell protein extracts were obtained from cells in lysis buffer (100 mM Tris-Cl [tris(hydroxymethyl)aminomethane], pH 7.4, 0.1% NP-40, 150 mM NaCl, 1 mM dithiothreitol [DTT]), and quantitated using the Bradford assay. Equivalent amounts of protein were electrophoresed on 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels, transferred to polyvinylidene difluoride (PVDF) Immobilon-P membranes (Millipore, Billerica, MA) and proteins were detected by Western blotting and the enhanced chemiluminescence (ECL) system (Amersham-Pharmacia, Piscataway, NJ). Polyclonal antibodies p21waf-cip1 (C-19) and actin (C-19) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA), and antibody to p53 (Ab1) was obtained from Oncogene Research Products (Boston, MA). All antibodies were used as specified by the manufacturer.

p53-binding assay

Binding of p53 to its consensus sequence was assessed from irradiated, whole cell extracts as previously described,27,28 using a modified procedure to precipitate oligonucleotide-bound p53 protein. The p53 consensus sequence TACAGAACATGTCTAAGCATGCTGGGGACT conjugated to agarose beads as well as beads containing a control p53 consensus sequence were obtained (Santa Cruz Biotechnology). Briefly, lymphocytes were obtained from the spleens of mice and cultured at a density of 1 x 106 cells/mL in 2.2 µg/mL concanavalin A for 48 hours. Cells were treated with IR, and whole-cell extracts were obtained in lysis buffer containing 0.5% NP-40, 150 mM NaCl, 20 mM HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid), pH 7.9, 1 mM DTT, 10 µg/mL pepstatin and 10 µg/mL aprotonin, and 1 mM phenylmethylsulfonyl fluoride (PMSF). Equivalent amounts of protein (100-500 µg) were incubated in the presence of the agarose bead/oligonucleotide conjugate. Incubation was carried out in binding buffer (10% glycerol, 2.5 mM MgCl2, 50 mM NaCl, 20 mM HEPES, pH 7.9, 0.5 mM DTT), followed by extensive washing of the beads in binding buffer. Electrophoresis of active p53 protein bound to the beads was carried out on 10% SDS-PAGE gels and was detected by Western blot with anti-p53 antibody.

Hematopoietic progenitor assays

Hematopoietic progenitors assays were performed by plating in triplicate 5 x 104 bone marrow low-density cells per milliliter. Cultures were established in 1% Iscove modified Dulbecco medium (IMDM) methylcellulose culture medium, with 30% FCS, 50 ng/mL recombinant murine Steel factor (Immunex, Seattle, WA), 1 U/mL recombinant human erythropoietin (Amgen, Thousand Oaks, CA), 5% vol/vol pokeweed mitogen spleen conditioned media (PWMSCM), and 0.1 mmol hemin (Sigma, St Louis, MO). Cells were incubated at 37°C, 5% CO2, and lowered (5%) O2. Bone marrow cells were cultured in methylcellulose progenitor assays with increasing concentrations of mitomycin C (Sigma), and recombinant murine tumor necrosis factor {alpha} (TNF-{alpha}; R&D Systems, Minneapolis, MN) to generate dose-response curves for Fancc-/- and Fancc+/+ hematopoietic progenitor cells. Granulocyte-macrophage colony-forming unit (CFU-GM) colonies were scored on day 7 of culture by an investigator who was blinded to the genotypes of the cultures.

Measurement of cell hypersensitivity and apoptosis assay

MEFs were treated with 50 ng/mL TNF-{alpha} and cultured for 72 hours. Viable cells were counted by trypan blue exclusion to assess viable cell numbers. To assess apoptosis, cells were fixed in paraformaldehyde after 48 hours of TNF-{alpha} treatment, and analyzed by terminal deoxynucleotidyl transferase-mediated deoxuridine triphosphate nick-end labeling (TUNEL) assay using the APO-direct system and annexin V (BD Biosciences, Mountain View, CA) as recommended by the manufacturer.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The expression and function of p53 protein in primary murine Fancc-deficient cells

To determine whether p53 was appropriately activated in Fancc-deficient cells, we first used primary cells from inbred Fancc-/- mice to investigate p53 function following DNA damage. Levels of p53 were measured by Western blotting in primary, passage 4 MEFs that were exposed to IR (Figure 1). The course of p53 induction in wild-type cells was consistent with previous reports detailing the cyclic behavior of p53 induction following IR.29 The amount of p53 protein observed following IR damage was modestly increased in Fancc-/- cells, analogous to previous studies using mitomycin C.22,30 In addition, the basal p53 level in Fancc-/- MEFs was modestly elevated (mean of 3.2 ± 0.5 x 103 normalized density units in Fancc-/- versus 1.2 ± 0.1 x 103 density units in Fancc+/+, n = 3). In other experiments, we used a consensus p53-binding assay to verify that p53 protein derived from Fancc-/- lymphocytes appropriately bound DNA (data not shown). Collectively, these data indicate that p53 protein is induced in primary Fancc mutant cells and is functional.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 1.. Evaluation of p53 protein in Fancc-/- cells. Radiation-induced p53 protein in Fancc-deficient cells. MEFs were treated with 10 Gy IR and cultured for the indicated time periods, and protein extracts (50 µg) were analyzed by Western blotting using antibody specific to p53. A representative of 3 independent experiments is shown. Total protein levels are normalized using actin as a control, shown in the bottom panel.

 

The hypersensitivity of Fancc-deficient cells to apoptosis is significantly p53 dependent

The role of p53 in executing apoptosis has been well characterized in response to stress, including inhibitory cytokines such as TNF-{alpha} and DNA damaging agents.12,31-33 Because Fancc-deficient cells are hypersensitive to cellular stresses that induce apoptosis, including TNF-{alpha} and interferon {gamma} (IFN-{gamma}),7,8,11,34,35 we investigated if functional p53 was required for the increased apoptosis observed in Fancc-/- cells. To test this hypothesis, we intercrossed Fancc and Trp53 mutant mice to generate F2 animals deficient at both loci (Fancc-/-Trp53-/-) and assessed the sensitivity of bone marrow-derived hematopoietic progenitor cells to TNF-{alpha}. Myeloid progenitor cells were initially used because these cells are hypersensitive to low concentrations of TNF-{alpha} and loss of this hypersensitivity is observed in myeloid malignancies in a FA experimental murine model10 and in patients with FA.9 Cultures were scored by an investigator who was blinded to the experimental genotypes. Consistent with previous studies,8 Fancc-deficient cells were hypersensitive to TNF-{alpha} (Figure 2A). Strikingly, this hypersensitivity was completely abrogated in cells lacking both Fancc and Trp53 (Figure 2A), indicating that the hypersensitivity of Fancc mutant cells to TNF-{alpha} is dependent on p53. We also tested whether the hypersensitivity of Fancc-/- myeloid progenitors to mitomycin C was p53 dependent. In contrast to progenitors deficient at Fancc only, the number of Fancc-/-Trp53-/- progenitors was rescued to wild-type levels at low concentrations of mitomycin C, indicating that this hypersensitivity was significantly p53 dependent (Figure 2B). The rescue of mitomycin C hypersensitivity was not maintained at higher mitomycin C doses, indicating that a p53-independent pathway of apoptosis also contributed to the hypersensitivity of Fancc-/- cells to mitomycin C.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 2.. The apoptotic hypersensitivity of Fancc-/- cells to TNF-{alpha} is p53 dependent. (A) Effect of p53 deficiency on the TNF-{alpha}-induced hypersensitivity of Fancc-/- progenitors. Hematopoietic progenitor colonies from bone marrow low density mononuclear cells were cultured in the presence of increasing amounts of TNF-{alpha}. Colonies were scored, and the data are plotted as percent of control CFU-GM colonies scored in the absence of TNF-{alpha}. Percent of control is shown on the y-axis, and the TNF-{alpha} dose is shown on the x-axis. The mean of each data point ± SD is shown. Each genotype is indicated by the corresponding symbol shown in the key. Statistics were assessed using the Student t test. The Fancc-/-Trp53+/+ genotypes were statistically different from all other groups (P < .001). A representative experiment conducted in triplicate cultures is shown. (B) Effect of p53 deficiency on the mitomycin C-induced hypersensitivity of Fancc-/- progenitors. Hematopoietic colonies were scored in the presence and absence of increasing doses of mitomycin C. The data are shown as percent of control (untreated) colony formation, and each genotype is indicated by the corresponding symbol shown in the legend. The mean of each data point ± SD is shown. The Fancc-/-Trp53-/- genotypes were statistically different from Fancc-/-Trp53+/+ progenitors from 2.5 to 50 nM mitomycin C concentrations (Student t test, P < .01). (C) The hypersensitivity of primary, Fancc-/- MEFs to TNF-{alpha} is dependent on p53. MEFs were cultured in the presence and absence of TNF-{alpha} (50 ng/mL), and were counted after 72 hours of culture. A representative experiment (n = 5) with similar results is shown. The change in cell number due to TNF-{alpha} treatment is expressed as percent of control, untreated cells for each genotype. Percent of control is shown on the y-axis, and the genotype is shown beneath each bar. Error bars indicate SD. Statistical analysis was performed using the Student t test. The differences between the Fancc+/+Trp53-/- and Fancc-/-Trp53-/- groups are not statistically significant.

 

We also measured TNF-{alpha} hypersensitivity to verify these observations in nonhematopoietic cells. MEFs of the same F2 genotypes were cultured in the presence and absence of TNF-{alpha} (Figure 2C). Like Fancc-deficient hematopoietic progenitors, the growth of Fancc-/- MEFs was abnormally sensitive to TNF-{alpha}. Genetic disruption of Trp53-/- abrogated this hypersensitivity phenotype in Fancc-/-Trp53-/- cells. In addition, consistent with previous studies in hematopoietic cells, the increased sensitivity of Fancc-/- MEFs to TNF-{alpha} was associated with increased apoptosis and this hypersensitivity was lost in cells deficient at both loci (data not shown). Taken together, these data show that the hypersensitivity of Fancc-deficient cells to cytokine-mediated apoptosis, and mitomycin C to an extent, is rescued by inactivation of Trp53.

Fancc and Trp53 cooperate in tumorigenesis

The increased p53 levels in Fancc-/- cells and ability of p53 to modulate apoptosis in Fancc-/- cells suggested that Fancc and Trp53 might cooperate in vivo. To test this hypothesis, compound Fancc and Trp53 heterozygotes were mated to produce offspring (F2) that were mutant at Trp53, Fancc, or both alleles. The expected mendelian frequency was obtained for all genotypes of the 399 mice generated from the intercross with the exception of mice that were nullizygous at both Fancc and Trp53. The actual number of viable animals with this genotype was only 1 of 70, compared to the expected frequency of 1 of 16 (P < .001 comparing number of viable embryos to predicted frequency), indicating a lethal developmental defect in approximately 75% of these embryos.

Although Fancc-/- mice do not spontaneously develop tumors, Trp53+/- and Trp53-/- mice have a high incidence of lymphoma and sarcoma. Mice from the Fancc and Trp53 genetic intercross were monitored weekly for tumor formation (Figure 3). A total of 107 mice of the 6 genotypes shown in the figure were monitored for 1.5 years. Consistent with previous studies, Fancc-/- mice did not develop tumors, and tumor formation and survival in Trp53+/- and Trp53-/- C57Bl/6 mice were comparable to previous studies using this mouse line.25 Trp53+/- and Trp53-/- mice had a median survival of 534 and 185 days, respectively. Importantly, absence of the Fancc gene significantly reduced the latency of tumor formation in both Fancc-/-Trp53+/- and Fancc-/-Trp53-/- mice with a median survival of 336 and 105 days, respectively (Figure 3).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 3.. Fancc and p53 cooperate in the progression of tumorigenesis in mice. Mice that were deficient for Fancc and Trp53 were monitored long term (1.5 years) for tumors (107 total mice). Mice were killed at the observance of tumors or significant morbidity. A Kaplan-Meier plot of percent survival (y-axis) as a function of time (x-axis) is shown. The genotypes are indicated next to each plot. Statistical significance of differences in survival between the groups was assessed by log rank analysis: P < .0001 comparing Fancc+/+Trp53-/- to Franc-/-Trp53-/-, and P < .005 comparing Fancc+/+Trp53+/- to Fancc-/-Trp53+/-.

 

Detailed histopathology was performed to determine the types of neoplasms in intercrossed mice (Table 1; Figure 4). The spectrum of tumors observed in Trp53+/- and Trp53-/- mice was similar to previous studies,25 which include osteosarcoma, lymphoma, and soft-tissue sarcomas. Although there was overlap in the spectrum of tumors observed in mice mutant at both Trp53 and Fancc compared to mice that are deficient at Trp53 only, several differences were observed. Consistent with prior studies, myeloid malignancies were not observed in either Trp53+/- or Trp53-/- mice that were wild-type at Fancc.25,36 One Fancc-/-Trp53+/- mouse had a myeloid malignancy, a histiocytic sarcoma with extensive myeloid invasion of the liver, spleen, and vertebrae (Figure 4A-F). Also, an undifferentiated spindle cell tumor of the neck (Figure 4G-H) and an ovarian tumor (Figure 4I) were observed in Fancc-/-Trp53+/- mice, but not Fancc+/+Trp53+/- mice. A majority of tumors derived from Fancc-/-Trp53+/- mice (4 of 5 analyzed) exhibited loss of heterozygosity of the normal p53 allele (data not shown). In addition, although the sample size of tumors was low in the Fancc-/-Trp53-/- group (due to the in utero demise of the majority of these animals), Fancc-/-Trp53-/- mice developed a medulloblastoma and an adenocarcinoma (Figure 4J-L), both of which have been observed in patients with FA37 but not in unmanipulated Trp53-/- mice.25,36


View this table:
[in this window]
[in a new window]
 
Table 1.. Location and type of tumors observed in mice from the FanccTrp53 intercross

 


View larger version (131K):
[in this window]
[in a new window]
 
Figure 4.. Histopathology of tumors in Fancc and Trp53 intercrossed mice. (A-F) Myeloid malignancy (histiocytic sarcoma) in a Fancc-/-Trp53+/- mouse. (A-B) Malignant histiocytes are observed in the red pulp of the spleen, indicated in panel A by the arrow. (C) Immunohistochemical characterization demonstrates that the malignant cells within the spleen are Mac-2+. (D-E) Malignant histiocytes are also observed in the liver as indicated by the arrow. (F) The malignant cells are shown to be Mac-2+ by immunohistochemical staining. (G-H) Dermal spindle cell tumor from the neck of a Fancc-/-Trp53+/- mouse shows a high mitotic index and undifferentiated cells with cigar-shaped nuclei. (I) Ovarian tumor from a Fancc-/-Trp53+/- mouse showing nests of round, tumor cells with rounded, pale nuclei. (J-K) Medulloblastoma of the cerebellum from a Fancc-/-Trp53-/- animal. Characteristic neoplastic cells with carrot-shaped nuclei, hyperchromatic coarse chromatin, and almost nonvisible cytoplasm, with frequent mitotic figures (indicated by arrows) are arranged in sheets with pseudo-rosette formations visible. (L) Adenocarcinoma of the prostate of a Fancc-/-Trp53-/- mouse shows malignant cells arranged in irregularly shaped glandular structures invading surrounding smooth muscle. Original magnifications: x 100 (G); x 200 (A,D,H,J); x 400 (B-C,E-F,I,K-L); and x 600 (H inset).

 


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
p53 is a critical sensor of cell stress and modulator of apoptosis to a broad range of stimuli. Recent data have demonstrated that the apoptotic function of p53 is critical in protection from tumorigenesis.38,39 Our genetic evidence indicates that the increased stress-induced apoptosis observed in Fancc-deficient cells is, at least in part, p53 dependent. Apoptosis in hematopoietic progenitors was abrogated in the absence of p53 at all doses of the cytotoxic cytokine TNF-{alpha}, which does not induce DNA damage. Disruption of Trp53 in Fancc-/- cells reduced apoptosis to that of Fancc+/+ cells at low but not high doses of mitomycin C, indicating that apoptosis induced by cross-linking agents in Fancc mutant cells was only partially p53 dependent. DNA cross-linking agents, including mitomycin C, induce breaks and lesions that signal the activation of p53,40 and induce apoptosis largely by p53-dependent mechanisms.41 However, in our studies there was a significant p53-independent mechanism of apoptosis mediating the hypersensitivity of Fancc-deficient cells to mitomycin C, as was also observed previously in other FANCC-deficient cells.22 A potential candidate to consider in future studies that may mediate apoptosis in Fancc-deficient cells is the p53-related protein, p73. p73 is able to activate the transcription of p53-dependent promoters.42 In addition, others have shown that p73 functions in the absence of p53 in mediating apoptosis induced by cross-linking and other proapoptotic agents.43,44 Therefore, functional p73 may be able to induce apoptosis in the absence of p53 in Fancc-/-Trp53-/- cells as the dose of mitomycin C is increased.

FA proteins have been implicated in a range of "caretaker" functions including DNA repair, cell cycle control, apoptosis, and redox modulation that collectively function to maintain genomic integrity (for a review, see Joenje and Patel5). There are at least 3 potential mechanisms to explain the cooperation between Trp53 and Fancc. First, abnormalities in FA functions can lead to basal and genotoxic-induced chromosome instability. In this model p53 is activated following stress to limit cell growth or to initiate apoptosis of oncogenic cells as a mechanism of tumor avoidance. Thus, we speculate that the modestly increased p53 protein levels observed in Fancc-deficient cells in the current report (Figure 1) following genotoxic or nongenotoxic stress could be a result of intrinsic genomic instability present in these cells, which is detected by the signaling network that activates p53. An important priority in future studies will be to examine the role of p53 in suppressing genetic mutations in Fancc-deficient mice using a marker of genetic instability such as hypoxanthine-guanine phosphoribosyltransferase.

A second possibility is suggested by studies linking the function of the FA protein members with the BRCA1-dependent mono-ubiquitination of FANCD2, and the identification of BRCA2 mutations in the FA-D1 complementation group. BRCA1 was reported to physically interact with p53.45,46 Further, mammary cells from Brca1 knockout mice undergo increased apoptosis that is alleviated in the absence of Trp53 and acquire mammary cell malignancies on loss of p53 function.19 Interestingly, like Fancc-/- mice, basal p53 protein was increased in Brca1 conditional mutant mice, compared to wild-type mice.21 In contrast, whereas Fancc-/- cells have slightly increased p53 activity following DNA damage, Brca1-/- cells have reduced levels of induced p53 protein compared to wild-type controls. Therefore, although FA proteins functionally interact with BRCA1,17 based on the current and previously published21 murine models, the specific cooperation that p53 has with Fancc and Brca1, respectively, is distinct. Studies have also demonstrated cooperation between BRCA2 and p53. In one study, the activity and function of p53 in Brca2-deficient cells was elevated, analogous to our studies.47 Further, loss of p53 in conditional Brca2-deficient mice is associated with a decreased latency of tumorigenesis.20 The precise biochemical relationship between p53 and Brca2 may be due to an interaction of these proteins with the homologous recombination machinery, because a physical association between Brca2 and p53 has been demonstrated in a complex that also contains Rad51.48 These studies therefore raise the interesting possibility that Fancc also may functionally interact with p53 in a DNA repair or cell cycle pathway.

Lastly, Fancc may affect the p53 network by negatively regulating PKR. Fancc was recently shown to directly interact with the Hsp70 protein, and this interaction inhibits the function of PKR in executing apoptosis.35,49 Given that p53 is activated by PKR,13,14 these studies suggest the possibility that Fancc could function in a complex that is closely associated with regulating p53 function via PKR.

Although Fancc-/- mice with intact Trp53 do not develop tumors, genetic loss of both Fancc and Trp53 results in a markedly shortened latency of tumorigenesis in a Trp53 gene dose-dependent fashion. Further, the spectrum of tumors observed in the intercrossed mice overlaps with that observed in patients with FA. The data are consistent with the hypothesis that loss of p53 or its effectors has an important role in malignant progression in human FA tumors, particularly considering that patients with FA are highly predisposed to head and neck cancers and epithelial malignancies.3 Others have shown that inactivation of p53 occurs in the majority of these types of malignancies, usually by either mutation15 or inactivation due to papilloma virus infection.50-54 Data from this report support the rationale for a thorough evaluation of the p53 pathway in malignancies in patients with FA.

In summary, the present study in mice has identified p53 as an important cofactor with Fancc in suppressing tumorigenesis. Our findings establish that p53 is an important modulator of apoptosis in Fancc-deficient mice in vitro and is consistent with the observations that mice mutant at both loci acquire tumors at an accelerated rate in vivo. Finally, these mice provide a model to address fundamental aspects of FA and to test molecular therapeutic strategies.


    Acknowledgements
 
We thank Lee Ann Baldridge for excellent technical assistance with immunohistochemistry. We also thank Dr Kevin Shannon, Department of Pediatrics, University of California San Francisco, for reading the manuscript.


    Footnotes
 
Submitted March 31, 2003; accepted June 23, 2003.

Prepublished online as Blood First Edition Paper, July 10, 2003; DOI 10.1182/blood-2003-03-0971.

Supported by National Institutes of Health grants RO1 HL 63219 (D.W.C.), NIDDK P30 DK49218 (D.W.C.), 1RO1 HL56416 (H.E.B.), RO1 HL67384 (H.E.B.), IT32 DK07519 (S.L.M.C.), NIH 1K08HL DK04071-01 (L.S.H.), and the Riley Children's Foundation.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: D. Wade Clapp, Cancer Research Institute, 1044 W Walnut St, R4/408, Indianapolis, IN 46202; e-mail: dclapp{at}iupui.edu.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Auerbach AD, Allen RG. Leukemia and preleukemia in Fanconi anemia patients. A review of the literature and report of the International Fanconi Anemia Registry. Cancer Genet Cytogenet. 1991;51: 1-12.[CrossRef][Medline] [Order article via Infotrieve]

  2. Rosenberg PS, Greene MH, Alter BP. Cancer incidence in persons with Fanconi's anemia. Blood. 2002

  3. Kutler DI, Auerbach AD, Satagopan J, et al. High incidence of head and neck squamous cell carcinoma in patients with Fanconi anemia. Arch Otolaryngol Head Neck Surg. 2003;129: 106-112.[Abstract/Free Full Text]

  4. Kutler DI, Singh B, Satagopan J, et al. A 20-year perspective on the International Fanconi Anemia Registry (IFAR). Blood. 2003;101: 1249-1256.[Abstract/Free Full Text]

  5. Joenje H, Patel KJ. The emerging genetic and molecular basis of Fanconi anaemia. Nat Rev Genet. 2001;2: 446-457.[CrossRef][Medline] [Order article via Infotrieve]

  6. Cumming RC, Liu JM, Youssoufian H, Buchwald M. Suppression of apoptosis in hematopoietic factor-dependent progenitor cell lines by expression of the FAC gene. Blood. 1996;88: 4558-4567.[Abstract/Free Full Text]

  7. Rathbun RK, Faulkner GR, Ostroski MH, et al. Inactivation of the Fanconi anemia group C gene augments interferon-gamma-induced apoptotic responses in hematopoietic cells. Blood. 1997;90: 974-985.[Abstract/Free Full Text]

  8. Haneline LS, Broxmeyer HE, Cooper S, et al. Multiple inhibitory cytokines induce deregulated progenitor growth and apoptosis in hematopoietic cells from Fac-/- mice. Blood. 1998;91: 4092-4098.[Abstract/Free Full Text]

  9. Lensch MW, Rathbun RK, Olson SB, Jones GR, Bagby GC Jr. Selective pressure as an essential force in molecular evolution of myeloid leukemic clones: a view from the window of Fanconi anemia. Leukemia. 1999;13: 1784-1789.[CrossRef][Medline] [Order article via Infotrieve]

  10. Haneline LS, Li X, Ciccone SL, et al. Retroviral-mediated expression of recombinant Fancc enhances the repopulating ability of Fancc-/- hematopoietic stem cells and decreases the risk of clonal evolution. Blood. 2003;101: 1299-1307.[Abstract/Free Full Text]

  11. Pang Q, Keeble W, Diaz J, et al. Role of double-stranded RNA-dependent protein kinase in mediating hypersensitivity of Fanconi anemia complementation group C cells to interferon gamma, tumor necrosis factor-alpha, and double-stranded RNA. Blood. 2001;97: 1644-1652.[Abstract/Free Full Text]

  12. Yeung MC, Lau AS. Tumor suppressor p53 as a component of the tumor necrosis factor-induced, protein kinase PKR-mediated apoptotic pathway in human promonocytic U937 cells. J Biol Chem. 1998;273: 25198-25202.[Abstract/Free Full Text]

  13. Cuddihy AR, Li S, Tam NW, et al. Double-stranded-RNA-activated protein kinase PKR enhances transcriptional activation by tumor suppressor p53. Mol Cell Biol. 1999;19: 2475-2484.[Abstract/Free Full Text]

  14. Cuddihy AR, Wong AH, Tam NW, Li S, Koromilas AE. The double-stranded RNA activated protein kinase PKR physically associates with the tumor suppressor p53 protein and phosphorylates human p53 on serine 392 in vitro. Oncogene. 1999;18: 2690-2702.[CrossRef][Medline] [Order article via Infotrieve]

  15. Somers KD, Merrick MA, Lopez ME, Incognito LS, Schechter GL, Casey G. Frequent p53 mutations in head and neck cancer. Cancer Res. 1992;52: 5997-6000.[Abstract/Free Full Text]

  16. Prime SS, Thakker NS, Pring M, Guest PG, Paterson IC. A review of inherited cancer syndromes and their relevance to oral squamous cell carcinoma. Oral Oncol. 2001;37: 1-16.[CrossRef][Medline] [Order article via Infotrieve]

  17. Garcia-Higuera I, Taniguchi T, Ganesan S, et al. Interaction of the Fanconi anemia proteins and BRCA1 in a common pathway. Mol Cell. 2001;7: 249-262.[CrossRef][Medline] [Order article via Infotrieve]

  18. Howlett NG, Taniguchi T, Olson S, et al. Biallelic inactivation of BRCA2 in Fanconi anemia. Science. 2002;297: 606-609.[Abstract/Free Full Text]

  19. Xu X, Wagner KU, Larson D, et al. Conditional mutation of Brca1 in mammary epithelial cells results in blunted ductal morphogenesis and tumour formation. Nat Genet. 1999;22: 37-43.[CrossRef][Medline] [Order article via Infotrieve]

  20. Jonkers J, Meuwissen R, van der Gulden H, Peterse H, van der Valk M, Berns A. Synergistic tumor suppressor activity of BRCA2 and p53 in a conditional mouse model for breast cancer. Nat Genet. 2001;29: 418-425.[CrossRef][Medline] [Order article via Infotrieve]

  21. Xu X, Qiao W, Linke SP, et al. Genetic interactions between tumor suppressors Brca1 and p53 in apoptosis, cell cycle and tumorigenesis. Nat Genet. 2001;28: 266-271.[CrossRef][Medline] [Order article via Infotrieve]

  22. Kruyt FA, Dijkmans LM, van den Berg TK, Joenje H. Fanconi anemia genes act to suppress a cross-linker-inducible p53-independent apoptosis pathway in lymphoblastoid cell lines. Blood. 1996;87: 938-948.[Abstract/Free Full Text]

  23. Mauser A, Saito S, Appella E, Anderson CW, Seaman WT, Kenney S. The Epstein-Barr virus immediate-early protein BZLF1 regulates p53 function through multiple mechanisms. J Virol. 2002;76: 12503-12512.[Abstract/Free Full Text]

  24. Chen M, Tomkins DJ, Auerbach W, et al. Inactivation of Fac in mice produces inducible chromosomal instability and reduced fertility reminiscent of Fanconi anaemia. Nat Genet. 1996;12: 448-451.[CrossRef][Medline] [Order article via Infotrieve]

  25. Jacks T, Remington L, Williams BO, et al. Tumor spectrum analysis in p53-mutant mice. Curr Biol. 1994;4: 1-7.[Medline] [Order article via Infotrieve]

  26. Eischen CM, Rehg JE, Korsmeyer SJ, Cleveland JL. Loss of Bax alters tumor spectrum and tumor numbers in ARF-deficient mice. Cancer Res. 2002;62: 2184-2191.[Abstract/Free Full Text]

  27. Wu Y, Huang H, Miner Z, Kulesz-Martin M. Activities and response to DNA damage of latent and active sequence-specific DNA binding forms of mouse p53. Proc Natl Acad Sci U S A. 1997;94: 8982-8987.[Abstract/Free Full Text]

  28. Luo JL, Yang Q, Tong WM, Hergenhahn M, Wang ZQ, Hollstein M. Knock-in mice with a chimeric human/murine p53 gene develop normally and show wild-type p53 responses to DNA damaging agents: a new biomedical research tool. Oncogene. 2001;20: 320-328.[CrossRef][Medline] [Order article via Infotrieve]

  29. Lev Bar-Or R, Maya R, Segel LA, Alon U, Levine AJ, Oren M. Generation of oscillations by the p53-Mdm2 feedback loop: a theoretical and experimental study. Proc Natl Acad Sci U S A. 2000;97: 11250-11255.[Abstract/Free Full Text]

  30. Kupfer GM, D'Andrea AD. The effect of the Fanconi anemia polypeptide, FAC, upon p53 induction and G2 checkpoint regulation. Blood. 1996;88: 1019-1025.[Abstract/Free Full Text]

  31. Klefstrom J, Arighi E, Littlewood T, et al. Induction of TNF-sensitive cellular phenotype by c-Myc involves p53 and impaired NF-kappaB activation. EMBO J. 1997;16: 7382-7392.[CrossRef][Medline] [Order article via Infotrieve]

  32. Ameyar M, Shatrov V, Bouquet C, et al. Adenovirus-mediated transfer of wild-type p53 gene sensitizes TNF resistant MCF7 derivatives to the cytotoxic effect of this cytokine: relationship with c-myc and Rb. Oncogene. 1999;18: 5464-5472.[CrossRef][Medline] [Order article via Infotrieve]

  33. Kastan MB, Onyekwere O, Sidransky D, Vogelstein B, Craig RW. Participation of p53 protein in the cellular response to DNA damage. Cancer Res. 1991;51: 6304-6311.[Abstract/Free Full Text]

  34. Rathbun RK, Christianson TA, Faulkner GR, et al. Interferon-gamma-induced apoptotic responses of Fanconi anemia group C hematopoietic progenitor cells involve caspase 8-dependent activation of caspase 3 family members. Blood. 2000;96: 4204-4211.[Abstract/Free Full Text]

  35. Pang Q, Christianson TA, Keeble W, Koretsky T, Bagby GC. The anti-apoptotic function of Hsp70 in the PKR-mediated death signaling pathway requires the Fanconi anemia protein, FANCC. J Biol Chem. 2002;277: 49638-49643.[Abstract/Free Full Text]

  36. Donehower LA, Harvey M, Slagle BL, et al. Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature. 1992;356: 215-221.[CrossRef][Medline] [Order article via Infotrieve]

  37. Alter BP. Cancer in Fanconi anemia, 1927-2001. Cancer. 2003;97: 425-440.[CrossRef][Medline] [Order article via Infotrieve]

  38. Schmitt CA, Fridman JS, Yang M, Baranov E, Hoffman RM, Lowe SW. Dissecting p53 tumor suppressor functions in vivo. Cancer Cell. 2002;1: 289-298.[CrossRef][Medline] [Order article via Infotrieve]

  39. Hemann MT, Fridman JS, Zilfou JT, et al. An epi-allelic series of p53 hypomorphs created by stable RNAi produces distinct tumor phenotypes in vivo. Nat Genet. 2003;33: 396-400.[CrossRef][Medline] [Order article via Infotrieve]

  40. Tishler RB, Calderwood SK, Coleman CN, Price BD. Increases in sequence specific DNA binding by p53 following treatment with chemotherapeutic and DNA damaging agents. Cancer Res. 1993;53: 2212-2216.[Abstract/Free Full Text]

  41. Xu C, Meikrantz W, Schlegel R, Sager R. The human papilloma virus 16E6 gene sensitizes human mammary epithelial cells to apoptosis induced by DNA damage. Proc Natl Acad Sci U S A. 1995;92: 7829-7833.[Abstract/Free Full Text]

  42. Jost CA, Marin MC, Kaelin WG Jr. p73 is a simian [correction of human] p53-related protein that can induce apoptosis. Nature. 1997;389: 191-194.[CrossRef][Medline] [Order article via Infotrieve]

  43. Irwin M, Marin MC, Phillips AC, et al. Role for the p53 homologue p73 in E2F-1-induced apoptosis. Nature. 2000;407: 645-648.[CrossRef][Medline] [Order article via Infotrieve]

  44. Gong JG, Costanzo A, Yang HQ, et al. The tyrosine kinase c-Abl regulates p73 in apoptotic response to cisplatin-induced DNA damage. Nature. 1999;399: 806-809.[CrossRef][Medline] [Order article via Infotrieve]

  45. Zhang H, Somasundaram K, Peng Y, et al. BRCA1 physically associates with p53 and stimulates its transcriptional activity. Oncogene. 1998;16: 1713-1721.[CrossRef][Medline] [Order article via Infotrieve]

  46. Chai YL, Cui J, Shao N, Shyam E, Reddy P, Rao VN. The second BRCT domain of BRCA1 proteins interacts with p53 and stimulates transcription from the p21WAF1/CIP1 promoter. Oncogene. 1999;18: 263-268.[CrossRef][Medline] [Order article via Infotrieve]

  47. Connor F, Bertwistle D, Mee PJ, et al. Tumorigenesis and a DNA repair defect in mice with a truncating Brca2 mutation. Nat Genet. 1997;17: 423-430.[CrossRef][Medline] [Order article via Infotrieve]

  48. Marmorstein LY, Ouchi T, Aaronson SA. The BRCA2 gene product functionally interacts with p53 and RAD51. Proc Natl Acad Sci U S A. 1998;95: 13869-13874.[Abstract/Free Full Text]

  49. Pang Q, Keeble W, Christianson TA, Faulkner GR, Bagby GC. FANCC interacts with Hsp70 to protect hematopoietic cells from IFN-gamma/TNF-alpha-mediated cytotoxicity. Embo J. 2001;20: 4478-4489[CrossRef][Medline] [Order article via Infotrieve]

  50. Werness BA, Levine AJ, Howley PM. Association of human papillomavirus types 16 and 18 E6 proteins with p53. Science. 1990;248: 76-79.[Abstract/Free Full Text]

  51. Crook T, Wrede D, Tidy J, Scholefield J, Crawford L, Vousden KH. Status of c-myc, p53 and retinoblastoma genes in human papillomavirus positive and negative squamous cell carcinomas of the anus. Oncogene. 1991;6: 1251-1257.[Medline] [Order article via Infotrieve]

  52. Balz V, Scheckenbach K, Gotte K, Bockmuhl U, Petersen I, Bier H. Is the p53 inactivation frequency in squamous cell carcinomas of the head and neck underestimated? Analysis of p53 exons 2-11 and human papillomavirus 16/18 E6 transcripts in 123 unselected tumor specimens. Cancer Res. 2003;63: 1188-1191.[Abstract/Free Full Text]

  53. Scheffner M, Munger K, Byrne JC, Howley PM. The state of the p53 and retinoblastoma genes in human cervical carcinoma cell lines. Proc Natl Acad Sci U S A. 1991;88: 5523-5527.[Abstract/Free Full Text]

  54. Mao EJ, Schwartz SM, Daling JR, Oda D, Tickman L, Beckmann AM. Human papilloma viruses and p53 mutations in normal pre-malignant and malignant oral epithelia. Int J Cancer. 1996;69: 152-158.[CrossRef][Medline] [Order article via Infotrieve]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Hum Mol GenetHome page
S. T. Bakker, H. J. van de Vrugt, M. A. Rooimans, A. B. Oostra, J. Steltenpool, E. Delzenne-Goette, A. van der Wal, M. van der Valk, H. Joenje, H. te Riele, et al.
Fancm-deficient mice reveal unique features of Fanconi anemia complementation group M
Hum. Mol. Genet., September 15, 2009; 18(18): 3484 - 3495.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. Rani, J. Li, and Q. Pang
Differential p53 Engagement in Response to Oxidative and Oncogenic Stresses in Fanconi Anemia Mice
Cancer Res., December 1, 2008; 68(23): 9693 - 9702.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Taniguchi and A. D. D'Andrea
Molecular pathogenesis of Fanconi anemia: recent progress
Blood, June 1, 2006; 107(11): 4223 - 4233.
[Abstract] [Full Text] [PDF]


Home page
Toxicol PatholHome page
K. A. McAllister, C. D. Houle, J. Malphurs, T. Ward, N. K. Collins, W. Gersch, L. Wharey, J. C. Seely, L. Betz, L. M. Bennett, et al.
Spontaneous and Irradiation-Induced Tumor Susceptibility in Brca2 Germline Mutant Mice and Cooperative Effects with a p53 Germline Mutation
Toxicol Pathol, February 1, 2006; 34(2): 187 - 198.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Bijangi-Vishehsaraei, M. R. Saadatzadeh, A. Werne, K. A. W. McKenzie, R. Kapur, H. Ichijo, and L. S. Haneline
Enhanced TNF-{alpha}-induced apoptosis in Fanconi anemia type C-deficient cells is dependent on apoptosis signal-regulating kinase 1
Blood, December 15, 2005; 106(13): 4124 - 4130.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Rubio-Moscardo, J. Climent, R. Siebert, M. A. Piris, J. I. Martin-Subero, I. Nielander, J. Garcia-Conde, M. J. S. Dyer, M. J. Terol, D. Pinkel, et al.
Mantle-cell lymphoma genotypes identified with CGH to BAC microarrays define a leukemic subgroup of disease and predict patient outcome
Blood, June 1, 2005; 105(11): 4445 - 4454.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
X. Li, M. M. Le Beau, S. Ciccone, F.-C. Yang, B. Freie, S. Chen, J. Yuan, P. Hong, A. Orazi, L. S. Haneline, et al.
Ex vivo culture of Fancc-/- stem/progenitor cells predisposes cells to undergo apoptosis, and surviving stem/progenitor cells display cytogenetic abnormalities and an increased risk of malignancy
Blood, May 1, 2005; 105(9): 3465 - 3471.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Houghtaling, L. Granville, Y. Akkari, Y. Torimaru, S. Olson, M. Finegold, and M. Grompe
Heterozygosity for p53 (Trp53+/-) Accelerates Epithelial Tumor Formation in Fanconi Anemia Complementation Group D2 (Fancd2) Knockout Mice
Cancer Res., January 1, 2005; 65(1): 85 - 91.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. R. Saadatzadeh, K. Bijangi-Vishehsaraei, P. Hong, H. Bergmann, and L. S. Haneline
Oxidant Hypersensitivity of Fanconi Anemia Type C-deficient Cells Is Dependent on a Redox-regulated Apoptotic Pathway
J. Biol. Chem., April 16, 2004; 279(16): 16805 - 16812.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-03-0971v1
102/12/4146    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Freie, B.
Right arrow Articles by Clapp, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Freie, B.
Right arrow Articles by Clapp, D. W.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Neoplasia
Right arrow Red Cells
Right arrow Apoptosis
Right arrow Gene Expression
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2003 by American Society of Hematology         Online ISSN: 1528-0020