Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Prepublished online as a Blood First Edition Paper on April 3, 2003; DOI 10.1182/blood-2003-01-0335.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-01-0335v1
102/3/916    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamaguchi, H.
Right arrow Articles by Young, N. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamaguchi, H.
Right arrow Articles by Young, N. S.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Neoplasia
Right arrow Red Cells
Right arrow Brief Reports
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 1 August 2003, Vol. 102, No. 3, pp. 916-918

HEMATOPOIESIS
Brief report

Mutations of the human telomerase RNA gene (TERC) in aplastic anemia and myelodysplastic syndrome

Hiroki Yamaguchi, Gabriela M. Baerlocher, Peter M. Lansdorp, Stephen J. Chanock, Olga Nunez, Elaine Sloand, and Neal S. Young

From the Hematology Branch, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD; Terry Fox Laboratory, BC Cancer Research Center, Vancouver; Department of Medicine, University of British Columbia, Vancouver, Canada; and the Section on Genomic Variation, Pediatric Oncology Branch, National Cancer Institutes, Advanced Technology Center, Gaithersburg, MD


    Abstract
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 References
 
Mutations in the human telomerase RNA (TERC) occur in autosomal dominant dyskeratosis congenita (DKC). Because of the possibility that TERC mutations might underlie seemingly acquired forms of bone marrow failure, we examined blood samples from a large number of patients with aplastic anemia (AA), paroxysmal nocturnal hemoglobinuria (PNH), and myelodysplasia (MDS). Only 3 of 210 cases showed heterozygous TERC mutations: both nucleotide 305 (n305) (G>A) and n322 (G>A) were within the conserved region (CR) 4–CR5 domain; n450 (G>A) was localized to the boxH/ACA domain. However, only one patient (with a mutation at n305 [G>A]) had clinical characteristics suggesting DKC; her blood cells contained short telomeres and her sister also suffered from bone marrow failure. Another 21 patients with short telomeres did not show TERC mutations. Our results suggest that cryptic DKC, at least secondary to mutations in the TERC gene, is an improbable diagnosis in patients with otherwise typical AA, PNH, and MDS.


    Introduction
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 References
 
Aplastic anemia (AA), pancytopenia, and a hypocellular bone marrow may be acquired or constitutional.1 Constitutional types of marrow failure, Fanconi anemia and dyskeratosis congenita (DKC), typically present in the first or second decade of life, frequently with associated physical anomalies.2,3 Detailed analysis of large families, collected in a DKC registry, allowed identification of several putatively etiologic genes in DKC. Mutations in the DKC1 gene occur in the X-linked form of the disease4,5; DKC1 encodes dyskerin, which binds to the human telomerase RNA (TERC).6 Subsequently, mutations in TERC were identified in autosomal dominant DKC.7 The involvement of these genes has implicated the telomerase complex in the pathophysiology of DKC.8-10

By analogy with Fanconi anemia, a diagnosis of DKC has been sought in patients with seemingly acquired AA. In a small study by Vulliamy et al,11 abnormalities in TERC were identified in more than 10% of patients with AA, apparently acquired late in life. We identified 2 families in which the probands presented with "acquired" AA but for whom stem cells could not be mobilized from matched sibling donors.12 In each kindred, a new mutation in TERC and short telomeres were observed in multiple family members, associated with very mild blood count abnormalities, except in the proband, and no physical anomalies.12 Because of the possibility that TERC mutations might underlie other cases of bone marrow failure, we undertook to examine a large number of blood samples from patients with AA, paroxysmal nocturnal hemoglobinuria (PNH), and myelodysplasia (MDS).


    Study design
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 References
 
Patients

Blood samples, previously collected and frozen, had been obtained from a total of 210 patients with bone marrow failure syndromes (150 AA, 55 MDS, and 13 PNH). Living patients provided informed consent for genetic testing according to protocols approved by the Institutional Review Board of the National Heart, Lung, and Blood Institute. For controls, we analyzed a panel of genomic DNA from 194 healthy donors, comprising 123 white, 23 Hispanic, 24 black, and 24 Asian individuals (http://snp500cancer.nci.nih.gov. Accessed May 13, 2003).

Telomere fluorescence in situ hybridization and flow cytometry

The average length of telomere repeats at chromosome ends in individual peripheral blood leukocytes was measured by flow–fluorescence in situ hybridization (flow-FISH) as previously reported.13,14

Mutation analysis of the TERC gene

The polymerase chain reaction (PCR) primers for amplification of around chromosome 3q26.3, including promoter and transcription region of TERC, were designed. We defined the first nucleotide of TERC transcription region as nucleotide 1 (n1). TERCF1-1; (n1660) GAGCTCATATAGAGCAGAACAAG, and TERCR4; GGTGACGGATGCGCACGAT (n502), and TERCF4; (n150) TCATGGCCGGAAATGGAACT, and TERCR7-1; and TGCACTTGTCTGTAGTTCAAGGAG (n1939) were amplified to detect deletions of the TERC gene. PCR amplification of the genomic DNA was performed by Advantage-GC2PCR kit (BD Biosciences Clontech, Palo Alto, CA). The PCR conditions were as follows: preheating at 94°C for 3 minutes; followed by 35 cycles of 94°C for 30 seconds, 58°C for 50 seconds, and 68°C for 3 minutes; and a final extension at 68°C for 5 minutes.

We designed 2 pair primers for sequencing. Primer sequences are as follows: TERCF4 and TERCseqR1; GTTTGCTCTAGAATGAACGGTGG, TERCseqF2; GTCTAACCCTAACTGAGAAGGGC, and TERCR4. Reactions for direct sequencing of the PCR products were performed with BigDye Terminator ver3.1 (Perkin-Elmer Cetus, Fremont, CA).


    Results and discussion
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 References
 
TERC abnormalities in unselected bone marrow failure patients

We sought large deletions in TERC by PCR, but none were found (data not shown) (however, our screening method would not detect novel deletions of TERC whose borders fell outside the limits of our primers). Direct sequencing showed only 3 heterozygous TERC mutations among 210 patient samples examined, for an approximate frequency in the range of 1.5% (Table 1). Both n305 (G>A) and n322 (G>A) were within the CR4-CR5 domain; n450 (G>A) was located in the boxH/ACA domain (Table 1; Figure 1). Of 22 patients in whom telomere length was previously determined to be short compared with age-matched controls,15 only 1 showed a TERC mutation: n305 (G>A) (Table 2).


View this table:
[in this window]
[in a new window]
 
Table 1.. TERC mutations and polymorphisms

 


View larger version (41K):
[in this window]
[in a new window]
 
Figure 1.. Mutations and polymorphisms of TERC gene. The schematic of the TERC gene showing the positions of mutations and polymorphisms identified in patients and healthy controls.

 

View this table:
[in this window]
[in a new window]
 
Table 2.. Summary of patients' background with TERC mutation

 

All vertebrate telomerase RNAs share 4 highly conserved structural regions: a pseudoknot domain, a CR4-CR5 domain, a boxH/ACA domain, and a CR7 domain.6,16 The pseudoknot and CR4-CR5 domains are known to be necessary for telomerase activity.6,17 A sister of the patient with the n305 (G>A) mutation also suffered from bone marrow failure; we had previously measured an extremely short telomere length for the patient (Table 2). Mouse mutations in the homologous P6 region of CR4-CR5 domain of murine telomere RNA, corresponding to the J6/5 unpaired region of human telomere RNA,16 abolish the ability to reconstitute an active telomerase complex.18 Therefore, telomere shortening and pancytopenia in this patient were probably secondary to this single nucleotide substitution.

Because telomeres are believed to play an important role in the maintenance of chromosome integrity, genetic instability has been attributed to age-related loss of telomeric DNA in hematopoietic stem cells6 in the pathogenesis of de novo MDS.19 However, we found only a single MDS patient with a TERC mutation (n322 [G>A]), at the J6/5 unpaired region of the CR4/CR5 domain (Table 1; Figure 1). No telomere length data were available for this archived case. While it remains possible that telomeric shortening was related to the hematologic disease, TERC mutations in general were certainly not prevalent in the MDS patients that we studied. For the n450 (G>A) substitution, a pathogenic role is uncertain in the absence of either telomere data or a suggestive family history (Table 2); furthermore, this patient had a more typical course for acquired AA, with a good and sustained response to immunosuppressive therapy (Table 2). Additionally, we found the n467 (T>C) substitution at the 3' downstream region in a single AA patient (Table 1); the biologic significance of this substitution is unclear.

The absence of these particular mutations, even in the large number of normal controls that we examined (n = 388 chromosomes), strongly suggests that these are rare mutations and not common single-nucleotide polymorphisms (SNPs).20 However, testing of the ability of these TERC mutations to diminish telomerase activity in transfected cells in vitro is required to establish their pathogenic role.

Polymorphisms in TERC

We analyzed 194 healthy controls of different self-described ethnicities to determine if the variants represented polymorphisms.20 Most important was the n58 (G>A) substitution, which was observed in 5 blacks, and the n228 (G>A), found in a single black (Table 1). We also found the n21 (C>T) substitution at the 5' upstream region. Two black MDS patients and a single black AA patient showed the n58 (G>A) polymorphism, and a single AA patient showed the n228 (G>A) polymorphism21 (Table 1). For the n228 (G>A) polymorphism, this base pair is disrupted within a hypervariable paired region (Figure 1) and would not be predicted to be important in the required secondary structure of TERC.

Our results and data on a small number of patients reported in correspondence22,23 stand in particular contrast to those reported by Vulliamy et al11; the sequence substitution that they identified in their cases of idiopathic and presumed constitutional AA—n58 (G>A)—is unlikely to represent a true mutation, being present in a large proportion of healthy black individuals. When these cases are subtracted, the English series contains only 2 patients with a clinical diagnosis of constitutional AA with TERC mutations, at n72 (C>G) and n110-113 (deletion GACT).11

Finally, we and others have reported short telomeres in a substantial proportion of patients with AA.15,24,25 While many such examples were studied in the current study, TERC mutations were not found; of course, other components of the telomerase complex might be affected and thus explain the telomere shortening. Mutations in appropriate crucial regions of these genes could result in a phenotype similar to those associated with TERC abnormalities. Therefore, we cannot rigorously exclude cryptic DKC owing to mutations in telomerase complex components other than TERC in marrow failure syndromes.


    Footnotes
 
Submitted February 3, 2003; accepted March 22, 2003.

Prepublished online as Blood First Edition Paper, April 3, 2003; DOI 10.1182/blood-2003-01-0335.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Neal S. Young, Hematology Branch, National Heart, Lung, and Blood Institute, National Institutes of Health, 10 Center Dr, MSC 1652, Bethesda, MD 20892-1652; e-mail: youngn{at}nhlbi.nih.gov.


    References
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 References
 

  1. Young NS, Maciejewski JP. Aplastic anemia. In: Hoffman R, Benz E Jr, Shattil S, et al, eds. Hematology: Basic Principles and Practice. Philadelphia, PA: Churchill Livingstone; 2000; 297-331.

  2. Alter BP, Young NS. The bone marrow failure syndromes. In: Nathan DG, Oski, FA, eds. Hematology of Infancy and Childhood. Vol 1. 4th ed. Philadelphia, PA: WB Saunders; 1993: 216-316.

  3. Dokal I. Dyskeratosis congenita in all its forms. Br J Haematol. 2000;110: 768-779.[CrossRef][Medline] [Order article via Infotrieve]

  4. Heiss NS, Knight SW, Vulliamy TJ, et al. X-linked dyskeratosis congenita is caused by mutations in a highly conserved gene with putative nucleolar functions. Nat Genet. 1998;19: 32-38.[Medline] [Order article via Infotrieve]

  5. Knight SW, Heiss NS, Vulliamy TJ, et al. X-linked dyskeratosis congenita is predominantly caused by missense mutations in the DKC1 gene. Am J Hum Genet. 1999;65: 50-58.[CrossRef][Medline] [Order article via Infotrieve]

  6. Cong YS, Wright WE, Shay JW. Human telomerase and its regulation. Microbiol Mol Biol Rev. 2002;66: 407-425.[Abstract/Free Full Text]

  7. Vulliamy T, Marrone A, Goldman F, et al. The RNA component of telomerase is mutated in autosomal dominant dyskeratosis congenita. Nature. 2001;413: 432-435.[CrossRef][Medline] [Order article via Infotrieve]

  8. Mitchell JR, Wood E, Collins K. A telomerase component is defective in the human disease dyskeratosis congenita. Nature. 1999;402: 551-555.[CrossRef][Medline] [Order article via Infotrieve]

  9. Comolli LR, Smirnov I, Xu L, Blackburn EH, James TL. A molecular switch underlies a human telomerase disease. Proc Natl Acad Sci U S A. 2002;99: 16998-17003.[Abstract/Free Full Text]

  10. Theimer CA, Finger LD, Trantirek L, Feigon J. Mutations linked to dyskeratosis congenita cause changes in the structural equilibrium in telomerase RNA. Proc Natl Acad Sci U S A. 2003;100: 449-454.[Abstract/Free Full Text]

  11. Vulliamy T, Marrone A, Dokal I, Mason PJ. Association between aplastic anaemia and mutations in telomerase RNA. Lancet. 2002;359: 2168-2170.[CrossRef][Medline] [Order article via Infotrieve]

  12. Fogarty PF, Yamaguchi H, Wiestner A, et al. Late presentation of dyskeratosis congenita detected as mutations in the hTERC gene in "acquired" aplastic anemia. Lancet. (submitted).

  13. Baerlocher GM, Mak J, Tien T, Lansdorp PM. Telomere length measurements by fluorescence in situ hybridization and flow cytometry: tips and pitfalls. Cytometry. 2002;47: 89-99.[CrossRef][Medline] [Order article via Infotrieve]

  14. Rufer N, Dragowska W, Thornbury G, Roosnek E, Lansdorp PM. Telomere length dynamics in human lymphocyte subpopulations measured by flow cytometry. Nat Biotechnol. 1998;16: 743-747.[CrossRef][Medline] [Order article via Infotrieve]

  15. Brummendorf TH, Maciejewski JP, Mak J, Young NS, Lansdorp PM. Telomere length in leukocyte subpopulations of patients with aplastic anemia. Blood. 2001;97: 895-900.[Abstract/Free Full Text]

  16. Chen JL, Blasco MA, Greider CW. Secondary structure of vertebrate telomerase RNA. Cell. 2000;100: 503-514.[CrossRef][Medline] [Order article via Infotrieve]

  17. Martin-Rivera L, Blasco MA. Identification of functional domains and dominant negative mutations in vertebrate telomerase RNA using an in vivo reconstitution system. J Biol Chem. 2001;276: 5856-5865.[Abstract/Free Full Text]

  18. Chen JL, Opperman KK, Greider CW. A critical stem-loop structure in the CR4-CR5 domain of mammalian telomerase RNA. Nucleic Acids Res. 2002;30: 592-597.[Abstract/Free Full Text]

  19. Ohyashiki JH, Ohyashiki K, Fujimura T, et al. Telomere shortening associated with disease evolution patterns in myelodysplastic syndromes. Cancer Res. 1994;54: 3557-3560.[Abstract/Free Full Text]

  20. Kruglyak L, Nickerson DA. Variation is the spice of life. Nat Genet. 2001;27: 234-236.[CrossRef][Medline] [Order article via Infotrieve]

  21. Bryan TM, Marusic L, Bacchetti S, Namba M, Reddel RR. The telomere lengthening mechanism in telomerase-negative immortal human cells does not involve the telomerase RNA subunit. Hum Mol Genet. 1997;6: 921-926.[Abstract/Free Full Text]

  22. Calado RT, Pintao MC, Silva WA Jr, Falcao RP, Zago MA. Aplastic anaemia and telomerase RNA mutations [letter]. Lancet. 2002;360: 1608.[Medline] [Order article via Infotrieve]

  23. Kawar NM, Ivanovich J, Rothbaum RJ, et al. Human telomerase RNA mutation in patients with bone marrow failure [abstract]. Blood. 2002;100: 232a.

  24. Ball SE, Gibson FM, Rizzo S, Tooze JA, Marsh JC, Gordon-Smith EC. Progressive telomere shortening in aplastic anemia. Blood. 1998;91: 3582-3592.[Abstract/Free Full Text]

  25. Lee JJ, Kook H, Chung IJ, et al. Telomere length changes in patients with aplastic anaemia. Br J Haematol. 2001;112: 1025-1030.[CrossRef][Medline] [Order article via Infotrieve]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
R. T. Calado, W. T. Yewdell, K. L. Wilkerson, J. A. Regal, S. Kajigaya, C. A. Stratakis, and N. S. Young
Sex hormones, acting on the TERT gene, increase telomerase activity in human primary hematopoietic cells
Blood, September 10, 2009; 114(11): 2236 - 2243.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H.-Y. Du, E. Pumbo, J. Ivanovich, P. An, R. T. Maziarz, U. M. Reiss, D. Chirnomas, A. Shimamura, A. Vlachos, J. M. Lipton, et al.
TERC and TERT gene mutations in patients with bone marrow failure and the significance of telomere length measurements
Blood, January 8, 2009; 113(2): 309 - 316.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
H. He, Y. Wang, X. Guo, S. Ramchandani, J. Ma, M.-F. Shen, D. A. Garcia, Y. Deng, A. S. Multani, M. J. You, et al.
Pot1b Deletion and Telomerase Haploinsufficiency in Mice Initiate an ATR-Dependent DNA Damage Response and Elicit Phenotypes Resembling Dyskeratosis Congenita
Mol. Cell. Biol., January 1, 2009; 29(1): 229 - 240.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. J. Walne, T. Vulliamy, R. Beswick, M. Kirwan, and I. Dokal
TINF2 mutations result in very short telomeres: analysis of a large cohort of patients with dyskeratosis congenita and related bone marrow failure syndromes
Blood, November 1, 2008; 112(9): 3594 - 3600.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
T. M. Errington, D. Fu, J. M. Y. Wong, and K. Collins
Disease-Associated Human Telomerase RNA Variants Show Loss of Function for Telomere Synthesis without Dominant-Negative Interference
Mol. Cell. Biol., October 15, 2008; 28(20): 6510 - 6520.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. K. Alder, J. J.-L. Chen, L. Lancaster, S. Danoff, S.-c. Su, J. D. Cogan, I. Vulto, M. Xie, X. Qi, R. M. Tuder, et al.
Short telomeres are a risk factor for idiopathic pulmonary fibrosis
PNAS, September 2, 2008; 105(35): 13051 - 13056.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
D. Hockemeyer, W. Palm, R. C. Wang, S. S. Couto, and T. de Lange
Engineered telomere degradation models dyskeratosis congenita
Genes & Dev., July 1, 2008; 22(13): 1773 - 1785.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. T. Calado and N. S. Young
Telomere maintenance and human bone marrow failure
Blood, May 1, 2008; 111(9): 4446 - 4455.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
G. Aubert and P. M. Lansdorp
Telomeres and Aging
Physiol Rev, April 1, 2008; 88(2): 557 - 579.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. M. Lansdorp
Telomeres, stem cells, and hematology
Blood, February 15, 2008; 111(4): 1759 - 1766.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Marrone, A. Walne, H. Tamary, Y. Masunari, M. Kirwan, R. Beswick, T. Vulliamy, and I. Dokal
Telomerase reverse-transcriptase homozygous mutations in autosomal recessive dyskeratosis congenita and Hoyeraal-Hreidarsson syndrome
Blood, December 15, 2007; 110(13): 4198 - 4205.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
C. K. Garcia, W. E. Wright, and J. W. Shay
Human diseases of telomerase dysfunction: insights into tissue aging
Nucleic Acids Res., December 3, 2007; 35(22): 7406 - 7416.
[Abstract] [Full Text] [PDF]


Home page
haematolHome page
A. Marrone, P. Sokhal, A. Walne, R. Beswick, M. Kirwan, S. Killick, M. Williams, J. Marsh, T. Vulliamy, and I. Dokal
Functional characterization of novel telomerase RNA (TERC) mutations in patients with diverse clinical and pathological presentations
Haematologica, August 1, 2007; 92(8): 1013 - 1020.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
M. Y. Armanios, J. J.-L. Chen, J. D. Cogan, J. K. Alder, R. G. Ingersoll, C. Markin, W. E. Lawson, M. Xie, I. Vulto, J. A. Phillips III, et al.
Telomerase Mutations in Families with Idiopathic Pulmonary Fibrosis
N. Engl. J. Med., March 29, 2007; 356(13): 1317 - 1326.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Z.-T. Xin, A. D. Beauchamp, R. T. Calado, J. W. Bradford, J. A. Regal, A. Shenoy, Y. Liang, P. M. Lansdorp, N. S. Young, and H. Ly
Functional characterization of natural telomerase mutations found in patients with hematologic disorders
Blood, January 15, 2007; 109(2): 524 - 532.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. S. Young, R. T. Calado, and P. Scheinberg
Current concepts in the pathophysiology and treatment of aplastic anemia
Blood, October 15, 2006; 108(8): 2509 - 2519.
[Abstract] [Full Text] [PDF]


Home page
Br Med BullHome page
I. Dokal
Fanconi's anaemia and related bone marrow failure syndromes
Br. Med. Bull., October 5, 2006; (2006) ldl007v2.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Jaras, A. Edqvist, J. Rebetz, L. G. Salford, B. Widegren, and X. Fan
Human short-term repopulating cells have enhanced telomerase reverse transcriptase expression
Blood, August 1, 2006; 108(3): 1084 - 1091.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. J. Vulliamy, A. Marrone, S. W. Knight, A. Walne, P. J. Mason, and I. Dokal
Mutations in dyskeratosis congenita: their impact on telomere length and the diversity of clinical presentation
Blood, April 1, 2006; 107(7): 2680 - 2685.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
I. Cheung, M. Schertzer, A. Rose, and P. M. Lansdorp
High incidence of rapid telomere loss in telomerase-deficient Caenorhabditis elegans
Nucleic Acids Res., January 10, 2006; 34(1): 96 - 103.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Armanios, J.-L. Chen, Y.-P. C. Chang, R. A. Brodsky, A. Hawkins, C. A. Griffin, J. R. Eshleman, A. R. Cohen, A. Chakravarti, A. Hamosh, et al.
Haploinsufficiency of telomerase reverse transcriptase leads to anticipation in autosomal dominant dyskeratosis congenita
PNAS, November 1, 2005; 102(44): 15960 - 15964.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Beier, S. Balabanov, T. Buckley, K. Dietz, U. Hartmann, M. Rojewski, L. Kanz, H. Schrezenmeier, and T. H. Brummendorf
Accelerated telomere shortening in glycosylphosphatidylinositol (GPI)-negative compared with GPI-positive granulocytes from patients with paroxysmal nocturnal hemoglobinuria (PNH) detected by proaerolysin flow-FISH
Blood, July 15, 2005; 106(2): 531 - 533.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
H. Yamaguchi, R. T. Calado, H. Ly, S. Kajigaya, G. M. Baerlocher, S. J. Chanock, P. M. Lansdorp, and N. S. Young
Mutations in TERT, the Gene for Telomerase Reverse Transcriptase, in Aplastic Anemia
N. Engl. J. Med., April 7, 2005; 352(14): 1413 - 1424.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Ly, R. T. Calado, P. Allard, G. M. Baerlocher, P. M. Lansdorp, N. S. Young, and T. G. Parslow
Functional characterization of telomerase RNA variants found in patients with hematologic disorders
Blood, March 15, 2005; 105(6): 2332 - 2339.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
B. P. Alter
Bone Marrow Failure: A Child Is Not Just a Small Adult (But an Adult Can Have a Childhood Disease)
Hematology, January 1, 2005; 2005(1): 96 - 103.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Marrone, D. Stevens, T. Vulliamy, I. Dokal, and P. J. Mason
Heterozygous telomerase RNA mutations found in dyskeratosis congenita and aplastic anemia reduce telomerase activity via haploinsufficiency
Blood, December 15, 2004; 104(13): 3936 - 3942.
[Abstract] [Full Text] [PDF]


Home page
ASH ANNUAL MEETING ABSTRACTSHome page
R. T. Calado, H. Ly, H. Yamaguchi, G. M. Baerlocher, S. Kajigaya, S. J. Chanock, P. M. Lansdorp, and N. S. Young
Mutations in TERT, the Gene Encoding Telomerase Reverse Transcriptase, in "Acquired" Aplastic Anemia Inhibit Enzymatic Function by a Dominant Negative Mechanism of Action.
Blood (ASH Annual Meeting Abstracts), November 16, 2004; 104(11): 3 - 3.
[Abstract]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-01-0335v1
102/3/916    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamaguchi, H.
Right arrow Articles by Young, N. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamaguchi, H.
Right arrow Articles by Young, N. S.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Neoplasia
Right arrow Red Cells
Right arrow Brief Reports
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2003 by American Society of Hematology         Online ISSN: 1528-0020