|
|
Prepublished online as a Blood First Edition Paper on May 15, 2003; DOI 10.1182/blood-2003-02-0420.
 Previous Article | Table of Contents | Next Article 
Blood, 1 September 2003, Vol. 102, No. 5, pp. 1779-1787
IMMUNOBIOLOGY
Ex vivo characterization of human CD8+ T subsets with distinct replicative history and partial effector functions
Nathalie Rufer,
Alfred Zippelius,
Pascal Batard,
Mikaël J. Pittet,
Isabel Kurth,
Patricia Corthesy,
Jean-Charles Cerottini,
Serge Leyvraz,
Eddy Roosnek,
Markus Nabholz, and
Pedro Romero
From the Swiss Institute for Experimental Cancer Research, Epalinges,
Switzerland; Division of Clinical Onco-Immunology, Ludwig Institute for Cancer
Research, Lausanne Branch, University Hospital, Lausanne, Switzerland; Ludwig
Institute for Cancer Research, Lausanne Branch, University of Lausanne,
Epalinges, Switzerland; Multidisciplinary Oncology Center, University Hospital
(CHUV), Lausanne, Switzerland; and Division of Immunology and Allergology,
University Hospital of Geneva, Geneva, Switzerland.
 |
Abstract
|
|---|
After antigenic challenge, naive T lymphocytes enter a program of
proliferation and differentiation during the course of which they acquire
effector functions and may ultimately become memory cells. In humans, the
pathways of effector and memory T-cell differentiation remain poorly defined.
Here we describe the properties of 2 CD8+ T-lymphocyte subsets,
RA+CCR7–27+28+ and
RA+CCR7–27+28–, in
human peripheral blood. These cells display phenotypic and functional features
that are intermediate between naive and effector T cells. Like naive T
lymphocytes, both subsets show relatively long telomeres. However, unlike the
naive population, these T cells exhibit reduced levels of T-cell receptor
excision circles (TRECs), indicating they have undergone additional rounds of
in vivo cell division. Furthermore, we show that they also share effector-type
properties. At equivalent in vivo replicative history, the 2 subsets express
high levels of Fas/CD95 and CD11a, as well as increasing levels of effector
mediators such as granzyme B, perforin, interferon  , and tumor necrosis
factor  . Both display partial ex vivo cytolytic activity and can be
found among cytomegalovirus-specific cytolytic T cells. Taken together, our
data point to the presence of T cells with intermediate effector-like
functions and suggest that these subsets consist of T lymphocytes that are
evolving toward a more differentiated effector or effector-memory stage.
|
Introduction
|
|---|
As a result of an antigenic challenge, due, for example, to a viral
infection, naive T lymphocytes undergo changes in the expression of cell
surface molecules and in their migratory properties and proliferate. They
acquire effector functions and eventually some of them become memory
cells.1 Effector
CD8+ T cells kill antigen-bearing target cells by secreting
granules containing granzyme and perforin or through the engagement of Fas on
the target cell. Effector lymphocytes have the capacity to migrate to
extralymphoid sites and to home to the site of infection. Once the antigenic
challenge subsides, the number of effector cells decreases drastically, but
another class of antigen-specific cells appears, the memory T lymphocytes.
Memory T cells produced after a primary immune response are long-lived. They
can be distinguished from naive T cells because they respond more efficiently
to antigenic recall (due, probably, to less stringent requirements for
activation), secrete enhanced levels of cytokines, and express other cell
surface molecules.1
Thus, in response to a second encounter with antigen, memory T cells can
usually eliminate pathogens before any disease symptoms are detectable. The
understanding of the lineage relationships between naive, effector, and memory
T cells is a central question in immunology. Although the formation of naive
cells is reasonably well understood, the signals and pathways that control the
generation of effector and memory T cells are still controversial.
To understand the mechanisms that underlie memory and effector formation,
various phenotypic cell surface markers have been used to distinguish primed T
lymphocytes from naive cells. In humans, CD45RA and CD27 monoclonal antibodies
(mAbs) have been used to define naive (N; RA+27+),
effector (E; RA+27–), and memory (M;
RA–27+) CD8+
subpopulations.2
More recently, based on simultaneous staining for CD45RA and CCR7, lymphocytes
described as memory cells could be further segregated into so-called
central-memory (RA–CCR7+) and effector-memory
(RA–CCR7–)
cells.3,4
Whereas the term "central-memory" (CM) refers to cells that lack
immediate effector function and express lymph node homing receptors, the term
"effector-memory" (EM) refers to cells that share numerous
features with effector (RA+27–) T lymphocytes.
Indeed, on in vitro stimulation EM cells rapidly produce effector cytokines
such as interferon (IFN-) and express perforin granules, and
they home preferentially to peripheral
tissues.3 However,
the precise function of each of these subsets as well as their lineage
relationship still remains elusive.
Longitudinal studies performed in mice suggest a linear model for effector
and memory T-cell formation according to which memory T cells are formed by a
small fraction of effector cells that do not undergo apoptosis
(N EM). However, accumulating data tend to support an alternative
model according to which effector and memory cells are formed by distinct
pathways (for a review, see Kaech et
al5). In this model,
naive T cells can bypass the effector cell stage and develop directly into
memory or CM T cells. Indeed, Sallusto and
Lanzavecchia6 have
proposed that the duration of antigenic stimulation and the type and the
amount of cytokines present during priming determine whether lymphocytes
differentiate into effector cells (E or EM or both) or into CM cells that lack
effector function and home preferentially to lymph nodes. Yet another
model7,8
proposes that CD8 T cells differentiate from precursor (N) through an
intermediate (CM/EM) to a fully differentiated effector (E) stage.
Here, by combining phenotypic cell surface marker characterization with
assays allowing us to trace the relative numbers of cell divisions in vivo, we
identify 2 subsets of circulating CD8+ T lymphocytes
(RA+CCR7–27+28+/–)
whose proliferative history places them between naive and effector T cells.
Both subsets express intermediate levels of effector mediators, such as
granzyme B, perforin, and IFN-, and display relative potent cytolytic
activity. Our data suggest that these subsets descend from recently activated
T cells and are committed to become differentiated effector or effector-memory
T cells or both.
|
Materials and methods
|
|---|
mAbs and major histocompatibility complex (MHC)/peptide
multimers
The following mAbs were purchased from Becton Dickinson or BD PharMingen
(San Diego, CA): anti–CD27-fluorescin isothiocyanate (FITC) and
-phycoerythrin (PE), anti–CD28-PE and -allophycocyanin (APC),
anti–CD8-FITC and -APC/Cy7, anti–CD57-PE, anti–HLA-DR-PE,
anti–CD11a-PE, anti–CD95-FITC, anti–CD56-PE,
anti–CD94-PE, and goat antirat IgG-APC. Other sources of mAbs were:
Beckman Coulter, Marseille, France (anti–CD158b-PE and
anti–CD45RA-ECD) and Caltag Laboratories, Burlingame, CA (goat antirat
IgG-PE). Anti-CCR7 rat IgG mAb 3D12 was provided by Drs M. Lipp and R. Forster
(Max Delbrück Institute, Berlin, Germany). Antigranzyme B–FITC and
antiperforin-FITC mAbs were obtained from Hölzel Diagnostika (Köln,
Germany) and Alexis (Lausen, Switzerland), respectively. Synthesis of PE- and
APC-labeled HLA-A*0201/CMV pp65495-503 (NLVPMVATV;
HCMV-19) multimers
was performed as previously
described.10,11
Cell preparation and flow cytometry
Peripheral blood samples were collected from 20 healthy donors, aged 20 to
70 years, with a normal proportion of CD8+ T lymphocytes (average,
22%; range, 12%-34%). Peripheral blood mononuclear cells (PBMCs) were obtained
by density centrifugation using Ficoll-Hypaque (Pharmacia, Uppsala, Sweden).
Our experimental procedures involve 2 steps that exclude contamination with
natural killer (NK) cells. First, CD8+ T lymphocytes were
positively enriched from cryopreserved or fresh PBMCs using
anti-CD8–coated magnetic microbeads (Miltenyi Biotech, Bergish Gladbach,
Germany), a procedure that eliminates most NK cells because they are not
efficiently retained by the magnet. Cells were stained with appropriate mAbs
in phosphate-buffered saline (PBS), 0.2% bovine serum albumin (BSA), and 50
µM EDTA (ethylenediaminetetraacetic acid) for 20 minutes at 4°C and
either directly analyzed or sorted into defined populations on a FACSVantage
SE, using CellQuest software (Becton Dickinson). Immediate reanalysis of the
isolated populations revealed more than 95% purity
(CD3+CD8+). Second, FACS analysis and sorting was
performed on gated CD8bright T cells, allowing the exclusion of any
residual contaminating NK cells in the sorted populations (< 2%). In the
experiments with cytomegalovirus (CMV)–specific T lymphocytes, cells
were first stained with either PE- or APC-labeled CMV multimers for 1 hour at
room temperature (RT) in PBS, 0.2% BSA, 50 µM EDTA, and then with
appropriate mAbs. Intracellular content of granzyme B and perforin was
measured in freshly isolated CD8+ T lymphocytes without previous
stimulation. In brief, after staining with appropriate mAbs cells were fixed
for 20 minutes at RT in PBS containing 1% formaldehyde, 2% glucose, and 5 mM
sodium azide. Fixation was followed by permeabilization with PBS/0.1% saponin
(Fluka, Buchs, Switzerland)/0.2% BSA/50 µM EDTA and staining with granzyme
B–FITC or perforin-FITC mAbs (both for 20 minutes at RT).
Quantification of TRECs by real-time PCR
The amount of signal joint (sj) T-cell receptor excision circles (TRECs) in
5 to 15 x 104 sorted CD8+ T subsets was determined
by real-time quantitative polymerase chain reaction (PCR) using the ABI PRISM
7700 Sequence Detector TaqMan system (Applied Biosystems, Rotkreuz,
Switzerland) as previously
described.12,13
In brief, after cell lysis in 100 mg/L proteinase K (Roche Diagnostics,
Mannheim, Germany) for 2 hours at 56°C followed by 15 minutes at 95°C,
PCR was performed in a final volume of 25 µL containing 5 µL cell
extract, 12.5 µL TaqMan Universal Master Mix including
AmpliTaq Gold (Applied Biosystems), 500 nM of each primer
(sj-5' forward: CACATCCCTTTCAACCATGCT; sj-3' reverse:
GCCAGCTGCAGGGTTTAGG), and 125 nM TaqMan probe
(FAM-ACACCTCTGGTTTTTGTAAAGGTGCCCACT-TAMRA). After one cycle of 2 minutes at
50°C followed by an initial 10 minutes of denaturation at 95°C, 40
cycles of 30 seconds at 95°C and 1 minute at 65°C were performed. The
number of TRECs in a given sample was estimated by comparing the CT value
obtained with a standard curve obtained from PCRs performed with 10-fold
serial dilutions of an internal standard provided by Dr Daniel Douek (Vaccine
Research Center, National Institute of Allergy and Infectious Diseases,
Bethesda, MD). The dilutions contained between 107 and
101 copies of sjTREC, and 4 reactions were run with each dilution.
Thus, the lowest limit of quantification was considered to be 10 copies of the
target sequence (< 10 copies/sample was quoted as below the quantification
limit of the assay). In all PCR assays, the correlation coefficient of the
standard curve was more than or equal to 0.997, whereas the slope varied
between –3.52 and –3.67. The TREC analysis was performed on young
healthy individuals (< 36 years of age) because aging inversely correlates
with the TREC
levels.12 Because
the TREC content of naive cells from younger individuals is significantly
higher compared to that of elderly donors, this allows an increased resolution
in the quantification of the TREC levels within the different CD8 T-cell
subpopulations (data not shown).
cDNA amplification and 5-cell RT-PCR
We first purified CD8+ T cells in 2 rounds of positive sorting
by magnetic beads and a MiniMACS device (Miltenyi Biotech). The resulting
cells were more than 98% CD3+CD8+. Second, to avoid
contamination of small populations by more abundant subsets, 10 x
103 T cells of each subset were sorted by flow cytometry and 5-cell
aliquots of the purified subsets were then resorted directly into wells of
96-V bottom plates. The procedures for cDNA preparation, cDNA amplification as
well as the reverse transcription-PCR (RT-PCR) were recently described in
detail.14 We used
the following primers: CD3: 5'-CGTTCAGTTCCCTCCTTTTCTT-3',
rev-5'-GATTAGGGGGTTGGTAGGGAGTG-3'; CCR7:
5'-CCAGGCCTTATCTCCAAGACC-3',
rev-5'-GCATGTCATCCCCACTCTG-3'; granzyme B:
5'-GCAGGAAGATCGAAAGTGCGA-3',
rev-5'-GCATGCCATTGTTTCGTCCAT-3'; perforin:
5'-TTCACTGCCACGGATGCCTAT-3',
rev-5'-GCGGAATTTTAGGTGGCCA-3'; FasL,
5'-GAGCCAGACAAATGGAGGAA-3',
rev-5'-GAAGTGAAGATGCTGCCAGTG-3'; IFN-:
5'-GCCAACCTAAGCAAGATCCCA-3',
rev-5'-GGAAGCACCAGGCATGAAATC-3'; tumor necrosis factor
(TNF-): 5'-CTGCCTTGGCTCAGACATGTT-3',
rev-5'-CAGTTGGTCACCAAATCAGCA-3'; CD94:
5'-GTGGGAGAATGGCTCTGCAC-3',
rev-5'-TGAGCTGTTGCTTACAGATATAACGA-3'. Typically, we used either
H20 or Daudi B-cell line extract as negative PCR control;
103 PBMCs from a healthy individual was used as positive
control.
Cytolytic activity
Cytolytic activity was tested in a CD3 mAb-mediated 51Cr-release
assay. In brief, FcR-bearing P815 target cells were radiolabeled with
Na51CrO4 (Perkin Elmer, Boston, MA) for 1 hour at
37°C. Sorted CD8+ T subsets were incubated with P815 target
cells (103 cells/well) at varying effector-target ratios in the
presence or absence of 300 ng/mL anti-CD3 mAb (OKT3). After 4 hours at
37°C, supernatants were collected and counted on a gamma counter. Percent
of lysis was calculated as (experimental release – spontaneous release)
x 100/(total release – spontaneous release).
Telomere fluorescence in situ hybridization and flow cytometry
All procedures have been described
previously.15,16
Telomere fluorescence was calculated by subtracting the mean fluorescence of
the background control (no probe) from the mean fluorescence obtained from
cells hybridized with the telomere probe after calibration with FITC-labeled
fluorescent beads (Quantum TM-24 Premixed; Bangs Laboratories, Fishers, IN)
and conversion into molecules of equivalent soluble fluorochrome (MESF) units.
The following equation was used to estimate the telomere length in base pair:
bP = MESF x
0.495.15
Telomerase repeat amplification protocol assay
Telomerase activity was measured with the telomerase repeat amplification
protocol (TRAP) assay using a telomerase substrate (TS) primer as
described.17 Cell
extracts were obtained from 5 x 104 to 15 x
104 sorted CD8+ T-cell subsets. As positive control we
used extracts from CD8+ T lymphocytes stimulated for 5 days with 1
µg/mL phytohemagglutinin (PHA; Sodiag, Losone, Switzerland) and 150 U/mL
recombinant interleukin 2 (rIL-2) in the presence of 1 x
106/mL irradiated feeder cells. Extension of the TS primer by
telomerase was performed for 30 minutes at 30°C in the presence of
[-32P] deoxyguanosine triphosphate (dGTP) and the products
generated were amplified by 27 cycles of PCR at 94°C for 30 seconds and
60°C for 30 seconds using the ACX anchored return primer. One half of the
amplified products were resolved on a 15% polyacrylamide gel and visualized by
a phosphoimaging system.
|
Results
|
|---|
Identification of an
RA+CCR7–27+ T-cell subset within the
circulating CD8+ compartment of healthy individuals
Human antigen–specific T lymphocytes can be separated into
functionally different populations using combinations of cell surface markers
such as CD45RA and CCR7 or
CD27.2,3
However, the relationship between CCR7 and CD27 expression on peripheral blood
CD8 lymphocytes has not yet been precisely determined. To do so we analyzed
the distribution of the CD27 surface antigen in the 4 different subsets of
CD8+ T lymphocytes previously defined on the basis of CD45RA and
CCR7 expression3:
naive (N; RA+CCR7+), effector (E;
RA+CCR7–), central-memory (CM;
RA–CCR7+), and effector-memory (EM;
RA–CCR7–;
Figure 1A,C). Staining of
peripheral blood CD8+ T lymphocytes with antibodies to CD45RA,
CCR7, and CD27 revealed the presence of 6 discrete subpopulations in the blood
from a representative healthy individual
(Figure 1B,D). Naive
RA+CCR7+ T cells (N) uniformly expressed CD27.
Similarly, 97% of CM (RA–CCR7+)T cells were
CD27+. In contrast, E (RA+CCR7–) T
cells were split into 2 distinct subsets; 52% were CD27+ and 48%
CD27–. The latter subset presumably is identical with the
differentiated effector T-cell subpopulation identified by van Lier's
group,2,18
whereas the characteristics of
RA+CCR7–27+ T cells have not been
analyzed thus far. Note that CD27 cell surface expression on these cells is
lower than that on naive T cells (Figure
1B). Finally, among EM T cells, 76% were CD27+
(referred to as EM1) and 24% were CD27– (referred
to as EM2). Both populations were recently described by
others.8,19
The distribution of the 6 CD8+ T-cell subsets defined by different
patterns of CD45RA, CCR7, and CD27 expression was analyzed in 20 healthy
individuals ranging in age from 20 to 70 years
(Figure 1E). The
CD8+RA+CCR7–27+ subset was
found in all individuals (mean ± SD, 12% ± 9%; range, 2%-35%)
and its size was comparable to that of CM (mean ± SD, 8% ± 6%;
range, 1%-25%) or EM2 (mean ± SD, 8% ± 7%; range,
2%-28%) CD8+ populations. Thus, our results revealed the widespread
presence in peripheral blood of a CD8+ T-cell subset,
RA+CCR7–27+, that displays phenotypic
features intermediate between those of naive and of effector T cells.
View larger version (38K):
[in this window]
[in a new window]
|
Figure 1.. Differential expression of CD45RA, CCR7, and CD27 cell surface molecules
on total CD8+ T cells from healthy individuals. CD8+
gated cells were separated into 4 subsets (N, E, CM, EM) based on CD45RA and
CCR7 labeling as previously
described3 (A,C).
Each of these subsets was analyzed for CD27 expression (B), and 6
subpopulations of CD8+ T cells could be distinguished (D). The
percentage of CD27+ cells is indicated. Analysis performed on a
representative healthy donor is depicted by the black histogram. The
RA+CCR7–27+ T-cell subset (gray peak)
is referred to as "?" (unknown). The distribution of the 6 defined
CD8+ T-cell subsets among 20 healthy individuals ranging in age
from 20 to 70 years is shown in panel E as mean percentage (range). N
indicates naive; E, effector; CM, central-memory; and EM, effector-memory.
|
|
The CD8+RA+CCR7–27+
T-cell subset displays lower levels of TRECs than naive T cells and expresses
genes involved in effector functions
To gain more insight into the relationship between the
RA+CCR7–27+ T cells and the other
CD8+ subsets, we assessed the replicative history of these cells by
quantifying their content of TRECs. TRECs are stable DNA episomes formed
during T-cell receptor (TCR-) gene rearrangement. Because they
are not replicated during mitosis, they are diluted out with each cell
division.12
Purified CD8+ T cells isolated from 8 young healthy individuals
were sorted into RA+CCR7+27+ (N),
RA+CCR7–27+ (?), and
RA+CCR7–27– (E) subsets
(Figure 2A). In all individuals
tested, naive cells had the highest level of TRECs, whereas the number in
effectors was below the quantification limit of the assay ( 0.02 TREC
copies/100 cells). Interestingly, the
RA+CCR7–27+ T-cell subset contained
detectable TRECs in all healthy individuals (mean ± SD, 1.5% ±
1.1%), their level corresponding to 12% of the amount in naive cells. These
data indicate that the RA+CCR7–27+
cells have, on average, undergone 3 more cell divisions than the bulk of naive
cells. Furthermore, these results demonstrate that
CD45RA+CCR7– T cells do not exclusively define the
effector CD8 subset. Indeed,
RA+CCR7–27+ (?) T cells revealed
quantifiable TREC levels, whereas this was not the case for
RA+CCR7–27– (E) T cells and thus
could account for the measurable content of TRECs previously described within
the RA+CCR7–
subset.13
View larger version (73K):
[in this window]
[in a new window]
|
Figure 2.. The RA+CCR7–27+ T-cell subset
contains reduced but detectable TREC levels and expresses genes associated
with effector functions. (A) Real-time PCR quantification of TRECs was
performed on sorted RA+CCR7+27+ (N),
RA+CCR7–27+ (?), and
RA+CCR7–27– (E) CD8+ T
subsets from 8 healthy young individuals (age range, 20-36 years). Asterisk
indicates not detectable (sorted cell number was 5 x 104 to
105, lower quantification limit = 0.01%-0.02%). (B) Gene expression
analysis was performed on sorted N, (?), and E CD8+ T cells using a
modified RT-PCR protocol (see "Materials and methods"). Data from
10 independent 5-cell aliquots as well as negative (–) and positive (+)
controls are depicted. Comparable results were obtained in 5 healthy
individuals.
|
|
The RA+CCR7–27+ subset may consist
of naive T cells that have expanded in the course of the homeostatic
maintenance of T-cell numbers that has recently been described for human
T-helper cells.20
Alternatively, this T-lymphocyte class may comprise cells that are transiting
from a naive to a more differentiated stage following antigenic challenge. To
distinguish between these hypotheses, we then compared the expression level of
genes involved in effector or regulatory functions in the
RA+CCR7–27+ subset with that in naive
and effector populations. For this purpose we used a modified RT-PCR protocol
that relies on the detection of specific cDNAs after global amplification of
expressed
mRNAs.21,22
Because the method yields sufficient cDNA from as few as 5 cells, it allows
the analysis of gene expression in small purified subpopulations. In a recent
study, we showed that this method could detect CD3 transcripts in 60% to
90% of extracts from single CD3+
cells.14 This is
consistent with the finding that all samples of CD8+ cells analyzed
in the present study gave a CD3-specific PCR product. All naive T-cell samples
but none of the aliquots of effector T cells yielded a detectable
CCR7-specific product (Figure
2B). With a single exception this correlates with CCR7 cell
surface expression and rules out significant contamination of the naive
(RA+CCR7+27+) subpopulation with the
RA+CCR7–27+ (?) and
RA+CCR7–27– (E) T cells. As
expected, naive CD8+ T lymphocytes, which are not cytolytic and do
not produce cytokines, did not contain detectable granzyme B, perforin, FasL,
IFN-, or NK-receptor CD94 mRNA, and only rarely gave a TNF-
signal. In contrast, these mRNA transcripts were found in most (granzyme B,
CD94) or a significant fraction of effector T-lymphocyte aliquots. Transcript
analysis of RA+CCR7–27+ T cells
revealed the presence of all effector function–associated mRNAs in a
significant fraction of 5-cell aliquots from this population. We have not
determined the efficiency of the PCR amplification of the different mRNAs nor
do we have any information on the distribution of the number of transcripts
among the cells within a given subpopulation. Thus, the data shown cannot be
used to derive reliable estimates of the fraction of cells expressing a
particular gene. Among RA+CCR7–27+ cell
aliquots there is no obvious correlation between the presence of PCR products
corresponding to different effector function–associated genes. For
instance, one sample gave PCR products for granzyme B, IFN-, and CD94,
whereas another was positive for FasL, TNF-, and CD94
(Figure 2B). At this stage we
cannot decide whether this observation reflects a stochastic element in the
PCR-based amplification from very small transcript numbers, cell biologic
heterogeneity among RA+CCR7–27+ T
cells, or heterogeneity of gene expression among individual cells from a
homogeneous
population.23
We conclude that, unlike naive cells, a proportion of
RA+CCR7–27+ T cells express genes
associated with cytolytic T-cell effector functions. Moreover, based on the
TREC data, RA+CCR7–27+ T cells display
a replicative history that places them between naive and effector T
lymphocytes. These results suggest that the
RA+CCR7–27+ T-cell subset comprises
cells that are evolving from a naive toward a more differentiated stage (E or
EM stage or both). We refer to this population from here on as pre-effector
(pE) T lymphocytes. In previous reports, granzyme B–positive and
perforin-positive cells or CMV-specific cells have been observed among
RA+27+
cells.2,24,25
Together with our data and those reported by Wills et
al,8 this indicates
that the RA+27+ phenotype is not sufficient to identify
naive CD8+ T cells. Based on the gene expression profiles
presented, we conclude that at present naive T lymphocytes are best defined as
RA+CCR7+.
The CD8+ pE population includes CD28+ and
CD28– cells
To further characterize the pE subset, the expression of the cell surface
molecules involved in costimulatory and activation functions (CD57, CD28,
HLA-DR), in lymphocyte migration (CD11a), in differentiation processes
(CD95/Fas), and in functions of NK cells (CD56, CD94, and CD158b) was analyzed
(Figure 3). In line with our
previous observations, the RA+CCR7–27+
(pE) T cells shared phenotypic characteristics with antigen-primed cells; they
highly expressed CD11a and CD95 in all analyzed individuals (n = 8). A
fraction of these cells also expressed HLA-DR or NK receptors, whereas CD57
and early T-cell activation markers such as CD69 and CD25 could hardly be
detected (Figure 3A and data
not shown). Finally, pE cells showed intermediate side-scatter
(SSC)/granularity properties when compared to naive and effector T cells.
View larger version (47K):
[in this window]
[in a new window]
|
Figure 3.. Expression of cell surface molecules. (A) The pE T-cell subset
shares cell surface molecules with effector T lymphocytes. Purified CD8 T
cells were stained with CD8, CCR7, CD45RA, CD27 mAbs and other mAbs as
indicated. Histograms show the proportion of positive cells among
RA+CCR7+27+ (N),
RA+CCR7–27+ (pE), and
RA+CCR7–27– (E) gated subsets.
These results were consistent in 8 healthy individuals. Note that our
experimental procedure (see "Materials and methods" for details)
to analyze N, pE, and E CD8 T subpopulations allows the exclusion of any
residual contaminating NK cells as shown by anti-CD3 costaining. (B) Analysis
of CD28 expression on N, pE, and E CD8+ T-cell subsets. Naive and
effector T cells displayed, respectively,
RA+CCR7+27+28+ and
RA+CCR7–27–28–
phenotypes. In contrast, the pE CD8 subset contained CD28+ as well
as CD28– cells. Accordingly, pE T cells are split into
pE1
(RA+CCR7–27+28+) and
pE2
(RA+CCR7–27+28–)
subsets.
|
|
Recent studies have proposed that CD27+CD28+ T cells
differentiate through a CD27+CD28– to a
CD27–CD28–
stage.26 According
to this model, CD8+ T cells sequentially down-regulate CCR7, CD28,
and CD27 surface expression, while up-regulating expression of molecules that
confer cytolytic activity. We found that around half of the pE T cells (mean
± SD, 48% ± 15%; range, 29%-78%; n = 8) expressed CD28, forming
a distinct CD28+ subpopulation
(Figure 3B). We refer to the
RA+CCR7–27+28+ pE cells as
pE1, and to the
RA+CCR7–27+28–
population as pE2. The goal of the next studies was to determine
whether pE1 and pE2 cells are 2 functionally distinct
CD8+ T-cell subsets or 2 sequential stages of the T-cell
differentiation pathway (pE1pE2E/EM).
Both pE1 and pE2 subsets exhibit ex vivo
killing activity, but pE2 T cells express increased levels of
granzyme B and perforin
To investigate whether pE1 and pE2 subsets differed
in the expression of genes involved in T-cell effector functions, we compared
the presence of the corresponding mRNAs in 5-cell aliquots of these
populations (Figure 4A). The
proportion of samples containing detectable IFN- and TNF-
transcripts was similar in both subsets. However, the number of samples
positive for granzyme B and CD94 mRNA was higher in the pE2
population. Thus, the gene expression profile of pE2 cells
resembles more closely that of the effector population. These results
correlated with the analysis of granzyme B expression by intracellular
staining for this enzyme (Figure
4B). Around 40% of total pE
(RA+CCR7–27+), but only 16% of
pE1 (RA+CCR7–28+) contained
detectable granzyme B protein. Note that these percentages clearly exceed the
minimum estimates of the frequency of granzyme B mRNA-containing cells,
suggesting that the RT-PCR analysis significantly underestimates the
proportion of granzyme B–expressing cells in these populations.
According to both mRNA analysis (Figure
4A) and intracellular staining
(Figure 4B), both pE subsets
express perforin but levels are lower than in the E subset. An extended study
of 4 healthy donors confirmed that there is a gradual increase of granzyme B
and perforin protein from pE1 through pE2 to E T cells,
as summarized in Table 1.
View larger version (37K):
[in this window]
[in a new window]
|
Figure 4.. Expression of effector mediators in pE1 and pE2 T
cells. (A) Gene expression analysis was performed on sorted
RA+CCR7+27+28+ (N),
RA+CCR7–27+28+
(pE1),
RA+CCR7–27+28–
(pE2), and
RA+CCR7–27–28–
(E) CD8+ T cells by RT-PCR. The same set of primers as described in
Figure 2B was used. Data from 6
or 8 independent 5-cell aliquots are shown. These results are representative
of 2 healthy individuals; (–), negative; (+), positive controls. (B) The
proportion of granzyme B–positive or perforin-positive cells among N
(27+), pE1 (28+), pE (27+),
pE2 + E (28–), and E (27–) T
cells was determined by immunofluorescence. The pE population includes
pE1 (27+28+) and pE2
(27+28–) T cells. Note that the perforin signal is
considerably lower in pE than in E cells. (C) Ex vivo–sorted
CD8+,N,pE1,pE2, and E T cells were tested in
a redirected cytolytic assay against 51Cr-labeled P815 target
cells. The pE and E subsets were unable to lyse P815 cells in the absence of
CD3 mAbs (lysis 2%, data not shown). Data are representative of 2 healthy
donors.
|
|
View larger version (69K):
[in this window]
[in a new window]
|
Figure 6.. Both pE CD8+ T subsets display the same distinctive
replicative history. (A) Real-time PCR quantification of TRECs was
performed on sorted RA+CCR7+27+28+
(N), RA+CCR7–27+28+
(pE1),
RA+CCR7–27+28–
(pE2), and
RA+CCR7–27–28–
(E) CD8 subsets from 4 healthy individuals (< 35 years old). Asterisk
indicates not detectable (sorted cell number was 105, lower
quantification limit = 0.01%). (B) Telomere fluorescence analysis in sorted N,
pE1, pE2, and E CD8+ T cells. The telomere
fluorescence was converted to kilobase as described in "Materials and
methods." (C) Telomerase activity in cell extracts of sorted
28+DR+, 28+DR–, N,
pE1, pE2, E, pE1
(28+DR+), pE2 + E
(28–DR+), and EM1
(28+DR+) CD8+ T cells. As positive control,
we used cell extracts of in vitro PHA-activated CD8+ T cell (act.
CD8+). Data are representative of 4 healthy individuals.
|
|
Our results are in agreement with a model according to which there is a
differentiation pathway, NpE1pE2E,
from naive to effector cells. The observation that CD95/Fas expression was
high in both pE1 and pE2 subsets and similar to the
level in effector T cells (Table
1) suggests that CD95/Fas is an early event in the differentiation
process that occurs before granzyme B up-regulation. When we compared the
cytolytic activity of these cell populations, using a CD3 mAb-mediated
redirected 51Cr-release assay
(Figure 4C), we found, as
expected, that effector T cells displayed high lytic activity, whereas naive T
cells were inactive. Both pE1 and pE2 subsets had
comparable cytolytic activity, which was about 10 times lower than that of the
effector population.
pE2 and effector T-cell subsets contain CMV-specific T
lymphocytes
The common herpes virus, CMV, persists at low frequencies in healthy
individuals and provides a chronic stimulus to the immune system. CMV-specific
CD8+ T cells can eliminate virus-infected cells and may play a
major role in the control of these persistent infections. Previous studies
reported that CMV-specific CD8+ T cells belonged to 2 distinct
subsets, effector (E;
RA+CCR7–CD27–) and
effector-memory
(EM1;RA–CCR7–CD27+)
cells.7,24,27
To test whether CMV-specific T cells would be present as well in the 2 pE
subsets, we analyzed the phenotype of T cells staining with HLA-A2/CMVpeptide
tetramers from a healthy individual with a relatively high frequency ( 6%
of total CD8 T cells) of such cells. We observed that most of the
antigen-specific cells displayed the phenotype of pE2 (33%;
RA+CCR7–27+28–) or E
(62%;
RA+CCR7–27–28–)
CD8+ T cells (Figure
5A). Only a small proportion (< 5%) had pE1
(RA+CCR7–27+28+)
characteristics. RT-PCR analysis of sorted CMV-specific cells with pE and E
phenotypes showed that both subsets had a gene expression profile similar to
that of bulk pE2 and E CD8+ T-cell populations; they
contained granzyme B, perforin, IFN-, TNF-, and CD94 mRNA. These
data demonstrate that a considerable fraction of CMV-specific T cells from a
healthy individual displays the salient properties of the newly described
pE2 subset. These results were confirmed by analysis of other
healthy individuals with lower percentages of HLA-A2/CMV peptide
tetramers–specific CD8+ T cells (data not shown). Our
findings are consistent with those of Wills et
al,8 who observed
the presence of CMV-specific T cells in the
CD45RA+27+28– subpopulation.
View larger version (76K):
[in this window]
[in a new window]
|
Figure 5.. Most of CMV-specific CD8+ T cells are found among
pE2 and effector subsets. (A) Phenotypic analysis of purified
CD8+ T cells from a healthy CMV carrier following staining with CMV
multimers and the indicated mAbs. (B) Gene expression analysis on sorted
RA+CCR7–27+ (pE) and
RA+CCR7–27– (E) CMV+
T-cell subsets by RT-PCR. The same set of primers as described in
Figure 2B was used. Data from 7
independent 5-cell aliquots are shown. The phenotype as well as the pattern of
gene expression of these CMV-specific T cells was stable over an interval of 8
months. The (–) indicates negative and (+) positive controls.
|
|
Both pE1 and pE2 subsets show reduced level of
TRECs but extended telomere lengths compared with naive T lymphocytes
To analyze the replicative history of the pE subsets we compared TREC
levels in RA+CCR7+27+28+ (N),
RA+CCR7–27+28+
(pE1),
RA+CCR7–27+28–
(pE2), and
RA+CCR7–27–28–
(E) populations sorted from 4 young healthy individuals
(Figure 6A). As expected, naive
T cells displayed high levels of TRECs, whereas the TRECs in effector T cells
were undetectable ( 0.01 TREC copies/100 cells). Both pE1 and
pE2 subsets showed a similar reduction of TREC levels, to about 14%
of those in naive cells in all individuals. These results indicate that both
pE1 and pE2 subsets have undergone 3 to 4 more divisions
than naive cells, implying that pE2 cells are not derived from
pE1 cells by further cell divisions.
Telomeres progressively shorten as a function of cell
division.28
Previous reports have shown that telomere length measurements are particularly
useful to assess the replicative in vivo history of
lymphocytes.16,29
When we measured the average telomere length in naive, pE1,
pE2, and effector CD8 subsets by flow cytometry–fluorescence
in situ
hybridization15
(flow FISH), we observed a reduction in mean telomere fluorescence in effector
compared with naive T cells that corresponded to a telomere shortening of
about 1.6 kb (Figure 6B). This
agrees with previously published
results.15,30
Surprisingly, both pE1 and pE2 subsets displayed
brighter telomere fluorescence compared with naive cells corresponding to an
increase in average telomere length by about 3 kb. Telomere length
measurements performed on another healthy donor also showed telomere length
elongation by about 1 kb in the pE subset. In a third individual, the average
telomere fluorescence of pE T cells was between that of naive and effector
cells (data not shown). These results are consistent with the conclusion from
the TREC data (Figure 6A) that
pE1 and pE2 subsets have a similar in vivo replicative
history. The finding that in the pE T cells of some healthy donors telomeres
are longer than in their naive T cells strongly suggests that telomeres can be
elongated during differentiation of naive into pE cells
(Figure 6B) as a result of
telomerase expression.
TRAP assays with extracts of FACS-sorted cells revealed no detectable
telomerase activity in naive, pE1, pE2, and E cells
(Figure 6C). Since Speiser et
al31 have recently
reported that, among CD8+ T lymphocytes, telomerase activity is
detectable in cells that express CD28 and the activation marker HLA-DR, we
carried out TRAP assays with the HLA-DR+ fraction of pE T cells
(Figure 3A) but failed to
detect telomerase activity (Figure
6C). On the other hand, the EM1
(RA–CCR7–28+DR+)
T-cell subset was clearly telomerase positive, indicating that this population
accounts for the previously described telomerase activity in
CD8+28+DR+ T
cells.31
|
Discussion
|
|---|
For many years antigen-experienced T lymphocytes have been classified into
2 distinct subpopulations—effector and memory
cells.32 Effectors
are generated early during the onset of an immune response and are capable of
migrating to the site of infection. Such cells are short-lived, produce
cytolytic effector mediators, and are capable ex vivo of killing target cells;
they are also more susceptible to activation-induced cell death (AICD). In
contrast, memory cells appear later in the immune response, lack ex vivo
cytotoxicity, and are long-lived. However, many questions concerning the role
of each subset as well as their lineage relationship to each other remain
unanswered. Recently, Sallusto and coworkers have used a mAb that recognizes
the chemokine receptor CCR7 to distinguish 2 subpopulations, designated
central-memory and effector-memory T cells, respectively, among
CD45RO+ T
cells.3 Although the
role of the so-called effector-memory cells is, at present unclear, these
observations, together with the characterization of the properties of
antigen-experienced T cells present after primary or during chronic infection
with influenza virus, Epstein-Barr virus (EBV), CMV, or
HIV7,8,24,26,27,33,34
challenge the simple classification of primed T cells into effector or memory
subsets.
In the present study we describe 2 populations of
CD45RA+CCR7–27+28+ and
CD45RA+CCR7–27+28–
cells within the circulating pool of CD8+ T cells of healthy
individuals. They share phenotypic and functional characteristics,
intermediate between those of naive and of effector cells. Their properties
suggest the existence of additional heterogeneity of primed T lymphocytes.
Both populations have a similar replicative history; they have undergone more
cell divisions than naive cells but fewer than effector cells. In some
individuals, their telomeres are, on average, longer than those of naive
cells, although they do not contain detectable telomerase activity. Thus,
unless they are derived from precursors with telomeres longer than those of
the majority of naive T cells, they must have passed through a stage in which
telomerase elongated their telomeres. They express mediators characteristic of
effector cells and have detectable cytolytic activity, albeit less than that
of effectors. The properties of these cells suggest that they represent
intermediate stages in the differentiation of naive to effector cells; hence
we propose the designation "pre-effectors," or pE cells. Both
CD28+ and CD28– pE subsets, referred to as
pE1 and pE2, respectively, have a similar in vivo
replicative history but the gene expression profile of the pE2
cells resembles more closely that of effector T cells. These results suggest
that pE2 cells have acquired further effector characteristics
without undergoing additional cell divisions.
Our data are also in agreement with a model according to which there is a
differentiation pathway, NpE1pE2E,
from naive to effector T lymphocytes. One way to test the validity of such a
model is to measure the TREC levels within the memory subpopulation. In this
regard, we found an average of 0.4 ± 0.2 TRECs/100 cells (n = 4, N.R.,
A.Z. et al, unpublished data, December 2002) in sorted CM
(CD8+RA–CCR7+27+) T cells
from young healthy individuals. These levels are within the same range as
those found for the pE cells (n = 8, 1.5 ± 1.1 TRECs/100 cells,
Figure 2A). Unless pE T cells
differentiate from CM T cells without cell division, these observations
support the notion that pE cells may descend from naive T cells rather than
from memory T cells. Their increased average telomere length, compared with
naive cells, indicates that activation was accompanied by induction of
telomerase
expression.35 In
line with these results, Plunkett et
al36 have recently
reported that during acute viral infection with EBV, virus-specific
CD8+ T lymphocytes did not have shorter telomeres after in vivo
clonal expansion. The telomeres of germinal center B cells that have undergone
extensive clonal expansion and selection are also longer than those of their
naive B-lymphocyte
precursors.37
Transient expression of telomerase was observed in both
studies.36,37
Because we could not detect telomerase activity in pE T lymphocytes from
peripheral blood, it would be of interest to find out whether such activity is
present in T lymphocytes isolated from lymph nodes. We observed a marked
telomere shortening in CD8+ effector T cells
(Figure 6C), and Plunkett et
al36 found short
telomeres in EBV-specific T cells several years after acute infection. This
implies that effector T cells have undergone further extensive cell
proliferation, without expressing telomerase
(Figure 6C, see lines effector
and pE2/E 28–DR+).
The comparison of the diversity of the T-cell repertoires in different
CD8+ T-cell subsets using
spectratyping,38
which measures the size heterogeneity of the  chain of the TCR
hypervariable CDR3 region (BV), is a tool to dissect the process of
CD8+ T-cell differentiation. Spectratypes from
CD8+RA+27– effector T cells reveal a
limited TCR repertoire with large expansions of particular BV families (Hamann
et al30 and data
not shown). In contrast, pE T cells express a more complex but still skewed
T-cell repertoire (data not shown). Observations made by
others8 have
revealed CMV-specific T cells with the same TCR clonotype sequence among
CD27+CD28– (that includes the pE2
subset) and CD27–CD28– (that includes the E
subset) CD8+ T cells. Although preliminary, these results further
support the model according to which pE and E cells represent different stages
of the same lineage.
As proposed by Appay and
colleagues,26
CD8+ T-cell differentiation may correlate with progressive loss of
CCR7, CD28, and CD27 surface expression and up-regulation of cytolytic
capacity. Our data are in agreement with this view, in that we have identified
CD8+ T lymphocytes with intermediate cell surface phenotypes and
partial effector functions in the peripheral blood from healthy individuals.
The same authors described that during primary infection with HIV-1, EBV, or
hepatitis C virus, the virus-specificT cells in the peripheral blood display a
27+28+/–
perforinlow
phenotype,26 which
resembles that of the pE T cells described in this report. Thus, peripheral
blood pE T cells may be in transit from the draining lymph nodes to the site
of inflammation where they complete their differentiation into differentiated
effector or effector-memory cells or both.
Longitudinal studies in which the turnover of the pE T cells can be
determined are necessary to account for the relative high proportion of these
cells in the total CD8+ compartment ( 10%;
Figure 1C) or in the
CMV-specific compartment ( 33%, Figure
5A) of healthy individuals. Our observations are consistent with
the hypothesis that pE T cells are antigen-specific cells that have not
encountered all the signals required for differentiation into effectors. They
may, for example, accumulate in the circulating pool over time in response to
persistent but low levels of antigen. A recent study of CD4+ T-cell
responses to antigenic stimulation in the
mouse,33 showing
that those effector T cells that have divided and differentiated the most are
recruited to the site of inflammation, supports this hypothesis. Other
partially activated subsets observed during the acute infection phase persist
after viral
clearance.33 A
conclusive answer to the questions concerning the function of CD8+
pE cells and their relationship with other subpopulations requires the
tracking of antigen-specific T cells in individuals during and after specific
immune responses against CMV, EBV, or influenza viruses.
In conclusion, by combining simultaneous analysis of 5-cell surface markers
(by flow cytometry) with analysis of gene expression (by RT-PCR), of
replicative history (by measurement of TRECs), and of telomere length (by flow
FISH) in sorted cells we have identified 2 subpopulations among primed
CD8+ T cells, with characteristics distinct from those of effector
as well as of memory T cells. Understanding the position of these subsets in
the process of CD8+ T-cell differentiation and their role in immune
responses will help us to improve vaccination and adoptive immunotherapy
strategies.
|
Acknowledgements
|
|---|
We are thankful to Drs H. Robson MacDonald, Daniel Speiser, and Joachim
Lingner for critically reading the manuscript; Dr Immanuel Lüscher and
Philippe Guillaume for synthesis of multimers; Dr Daniel Douek for providing
signal joint internal standard; and Dr Martin Lipp and Dr Reinhold Forster for
the anti-CCR7 mAb. We thank Séverine Reynard, Solange Visher, and
Martine van Overloop for excellent technical support and Dr Anne-Lyse Ducrest
for helpful discussions.
|
Footnotes
|
|---|
Submitted February 7, 2003;
accepted April 29, 2003.
Prepublished online as Blood First Edition Paper, May 15, 2003;
DOI 10.1182/blood-2003-02-0420.
Supported by the National Center of Competence in Research (NCCR) Molecular
Oncology program of the Swiss National Science Foundation (N.R.).
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked "advertisement" in accordance with 18 U.S.C. section
1734.
Reprints: Nathalie Rufer, Swiss Institute for Experimental Cancer
Research, 155 Chemin des Boveresses, CH-1066 Epalinges, Switzerland; e-mail:
nathalie.rufer{at}isrec.unil.ch.
|
References
|
|---|
- Cerottini JC, MacDonald HR. The cellular basis of T-cell memory.
Annu Rev Immunol. 1989;7:
77-89.[CrossRef][Medline]
[Order article via Infotrieve]
- Hamann D, Baars PA, Rep MH, et al. Phenotypic and functional
separation of memory and effector human CD8+ T cells. J Exp
Med. 1997;186:
1407-1418.[Abstract/Free Full Text]
- Sallusto F, Lenig D, Forster R, Lipp M, Lanzavecchia A. Two subsets
of memory T lymphocytes with distinct homing potentials and effector
functions. Nature.
1999;401:
708-712.[CrossRef][Medline]
[Order article via Infotrieve]
- Sallusto F, Mackay CR, Lanzavecchia A. The role of chemokine
receptors in primary, effector, and memory immune responses. Annu Rev
Immunol. 2000;18:
593-620.[CrossRef][Medline]
[Order article via Infotrieve]
- Kaech SM, Wherry EJ, Ahmed R. Effector and memory T-cell
differentiation: implications for vaccine development. Nat Rev
Immunol. 2002; 2:
251-262.[CrossRef][Medline]
[Order article via Infotrieve]
- Sallusto F, Lanzavecchia A. Exploring pathways for memory T cell
generation. J Clin Invest. 2001;
108: 805-806.[CrossRef][Medline]
[Order article via Infotrieve]
- Champagne P, Ogg GS, King AS, et al. Skewed maturation of memory
HIV-specific CD8 T lymphocytes. Nature.
2001;410:
106-111.[CrossRef][Medline]
[Order article via Infotrieve]
- Wills MR, Okecha G, Weekes MP, Gandhi MK, Sissons PJ, Carmichael
AJ. Identification of naive or antigen-experienced human CD8(+) T cells by
expression of costimulation and chemokine receptors: analysis of the human
cytomegalovirus-specific CD8(+) T cell response. J Immunol.
2002;168:
5455-5464.[Abstract/Free Full Text]
- Wills MR, Carmichael AJ, Mynard K, et al. The human cytotoxic
T-lymphocyte (CTL) response to cytomegalovirus is dominated by structural
protein pp65: frequency, specificity, and T-cell receptor usage of
pp65-specific CTL. J Virol. 1996;
70: 7569-7579.[Abstract]
- Altman JD, Moss PA, Goulder PJ, et al. Phenotypic analysis of
antigen-specific T lymphocytes. Science.
1996;274:
94-96.[Abstract/Free Full Text]
- Romero P, Dunbar PR, Valmori D, et al. Ex vivo staining of
metastatic lymph nodes by class I major histocompatibility complex tetramers
reveals high numbers of antigen-experienced tumor-specific cytolytic T
lymphocytes. J Exp Med.
1998;188:
1641-1650.[Abstract/Free Full Text]
- Douek DC, McFarland RD, Keiser PH, et al. Changes in thymic
function with age and during the treatment of HIV infection.
Nature. 1998;396:
690-695.[CrossRef][Medline]
[Order article via Infotrieve]
- Zippelius A, Pittet MJ, Batard P, et al. Thymic selection generates
a large T cell pool recognizing a self-peptide in humans. J Exp
Med. 2002;195:
485-494.[Abstract/Free Full Text]
- Bigouret V, Hoffmann T, Arlettaz L, et al. Monoclonal T cell
expansions in asymptomatic individuals and in patients with large granular
leukemia consist of cytotoxic effector T cells expressing the activating
CD94-NKG2C/E and NKD2D killer cell receptors. Blood.
2003;101:
3198-3204.[Abstract/Free Full Text]
- Rufer N, Dragowska W, Thornbury G, Roosnek E, Lansdorp PM. Telomere
length dynamics in human lymphocyte subpopulations measured by flow cytometry.
Nat Biotechnol. 1998;16:
743-747.[CrossRef][Medline]
[Order article via Infotrieve]
- Rufer N, Brummendorf TH, Kolvraa S, et al. Telomere fluorescence
measurements in granulocytes and T lymphocyte subsets point to a high turnover
of hematopoietic stem cells and memory T cells in early childhood. J
Exp Med. 1999;190:
157-167.[Abstract/Free Full Text]
- Kim NW, Wu F. Advances in quantification and characterization of
telomerase activity by the telomeric repeat amplification protocol (TRAP).
Nucleic Acids Res. 1997;25:
2595-2597.[Abstract/Free Full Text]
- Baars PA, Ribeiro Do Couto LM, Leusen JH, et al. Cytolytic
mechanisms and expression of activation-regulating receptors on effector-type
CD8+CD45RA+CD27– human T cells.
J Immunol. 2000;165:
1910-1917.[Abstract/Free Full Text]
- Tomiyama H, Matsuda T, Takiguchi M. Differentiation of human CD8(+)
T cells from a memory to memory/effector phenotype. J Immunol.
2002; 168:
5538-5550.[Abstract/Free Full Text]
- Kimmig S, Przybylski GK, Schmidt CA, et al. Two subsets of naive T
helper cells with distinct T cell receptor excision circle content in human
adult peripheral blood. J Exp Med.
2002;195:
789-794.[Abstract/Free Full Text]
- Brady G, Iscove NN. Construction of cDNA libraries from single
cells. Methods Enzymol. 1993;
225: 611-623.[Medline]
[Order article via Infotrieve]
- Sauvageau G, Lansdorp PM, Eaves CJ, et al. Differential expression
of homeobox genes in functionally distinct CD34+ subpopulations of
human bone marrow cells. Proc Natl Acad Sci U S A.
1994;91:
12223-12227.[Abstract/Free Full Text]
- Levsky JM, Shenoy SM, Pezo RC, Singer RH. Single-cell gene
expression profiling. Science.
2002;297:
836-840.[Abstract/Free Full Text]
- Gamadia LE, Rentenaar RJ, Baars PA, et al. Differentiation of
cytomegalovirus-specific CD8(+)T cells in healthy and immunosuppressed virus
carriers. Blood. 2001;98:
754-761.[Abstract/Free Full Text]
- Kern F, Khatamzas E, Surel I, et al. Distribution of human
CMV-specific memory T cells among the CD8pos. subsets defined by CD57, CD27,
and CD45 isoforms. Eur J Immunol.
1999;29:
2908-2915.[CrossRef][Medline]
[Order article via Infotrieve]
- Appay V, Dunbar PR, Callan M, et al. Memory CD8+ T cells
vary in differentiation phenotype in different persistent virus infections.
Nat Med. 2002;8:
379-385.[CrossRef][Medline]
[Order article via Infotrieve]
- Pittet MJ, Zippelius A, Speiser DE, et al. Ex vivo IFN-gamma
secretion by circulating CD8 T lymphocytes: implications of a novel approach
for T cell monitoring in infectious and malignant diseases. J
Immunol. 2001;166:
7634-7640.[Abstract/Free Full Text]
- Harley CB, Futcher AB, Greider CW. Telomeres shorten during ageing
of human fibroblasts. Nature.
1990;345:
458-460.[CrossRef][Medline]
[Order article via Infotrieve]
- Weng NP, Levine BL, June CH, Hodes RJ. Human naive and memory T
lymphocytes differ in telomeric length and replicative potential. Proc
Natl Acad Sci U S A. 1995;92:
11091-11094.[Abstract/Free Full Text]
- Hamann D, Kostense S, Wolthers KC, et al. Evidence that human
CD8+CD45RA+CD27– cells are induced by
antigen and evolve through extensive rounds of division. Int
Immunol. 1999;11:
1027-1033.[Abstract/Free Full Text]
- Speiser DE, Migliaccio M, Pittet MJ, et al. Human CD8(+) T cells
expressing HLA-DR and CD28 show telomerase activity and are distinct from
cytolytic effector T cells. Eur J Immunol.
2001;31:
459-466.[CrossRef][Medline]
[Order article via Infotrieve]
- Volkert M, Marker O, Bro-Jorgensen K. Two populations of T
lymphocytes immune to the lymphocytic choriomeningitis virus. J Exp
Med. 1974; 139:
1329-1343.[Abstract]
- Roman E, Miller E, Harmsen A, et al. CD4 effector T cell subsets in
the response to influenza: heterogeneity, migration, and function. J
Exp Med. 2002;196:
957-968.[Abstract/Free Full Text]
- De Rosa SC, Brenchley JM, Roederer M. Beyond six colors: a new era
in flow cytometry. Nat Med.
2003;9:
112-117.[CrossRef][Medline]
[Order article via Infotrieve]
- Weng NP, Hathcock KS, Hodes RJ. Regulation of telomere length and
telomerase in T and B cells: a mechanism for maintaining replicative
potential. Immunity.
1998;9:
151-157.[CrossRef][Medline]
[Order article via Infotrieve]
- Plunkett FJ, Soares MV, Annels N, et al. The flow cytometric
analysis of telomere length in antigen-specific CD8+ T cells during
acute Epstein-Barr virus infection. Blood.
2001;97:
700-707.[Abstract/Free Full Text]
- Weng NP, Granger L, Hodes RJ. Telomere lengthening and telomerase
activation during human B cell differentiation. Proc Natl Acad Sci U S
A. 1997;94:
10827-10832.[Abstract/Free Full Text]
- Roux E, Dumont-Girard F, Starobinski M, et al. Recovery of immune
reactivity after T-cell-depleted bone marrow transplantation depends on thymic
activity. Blood. 2000;96:
2299-2303.[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
C. Jandus, G. Bioley, D. Dojcinovic, L. Derre, L. Baitsch, S. Wieckowski, N. Rufer, W. W. Kwok, J.-M. Tiercy, I. F. Luescher, et al.
Tumor Antigen-Specific FOXP3+ CD4 T Cells Identified in Human Metastatic Melanoma: Peptide Vaccination Results in Selective Expansion of Th1-like Counterparts
Cancer Res.,
October 15, 2009;
69(20):
8085 - 8093.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Cantisan, J. Torre-Cisneros, R. Lara, A. Rodriguez-Benot, F. Santos, J. Gutierrez-Aroca, I. Gayoso, M. Gonzalez-Padilla, M. Casal, A. Rivero, et al.
Age-Dependent Association between Low Frequency of CD27/CD28 Expression on pp65 CD8+ T Cells and Cytomegalovirus Replication after Transplantation
Clin. Vaccine Immunol.,
October 1, 2009;
16(10):
1429 - 1438.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Billerbeck, N. Nakamoto, B. Seigel, H. E. Blum, K.-M. Chang, and R. Thimme
Determinants of in vitro expansion of different human virus-specific FoxP3+ regulatory CD8+ T cells in chronic hepatitis C virus infection
J. Gen. Virol.,
July 1, 2009;
90(7):
1692 - 1701.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. M. Iancu, P. Corthesy, P. Baumgaertner, E. Devevre, V. Voelter, P. Romero, D. E. Speiser, and N. Rufer
Clonotype Selection and Composition of Human CD8 T Cells Specific for Persistent Herpes Viruses Varies with Differentiation but Is Stable Over Time
J. Immunol.,
July 1, 2009;
183(1):
319 - 331.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Dimitrov, C. Benedict, D. Heutling, J. Westermann, J. Born, and T. Lange
Cortisol and epinephrine control opposing circadian rhythms in T cell subsets
Blood,
May 21, 2009;
113(21):
5134 - 5143.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Lecuroux, I. Girault, A. Urrutia, J.-M. Doisne, C. Deveau, C. Goujard, L. Meyer, M. Sinet, and A. Venet
Identification of a particular HIV-specific CD8+ T-cell subset with a CD27+ CD45RO-/RA+ phenotype and memory characteristics after initiation of HAART during acute primary HIV infection
Blood,
April 2, 2009;
113(14):
3209 - 3217.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. E.D. Chamuleau, T. M. Westers, L. van Dreunen, J. Groenland, A. Zevenbergen, C. M. Eeltink, G. J. Ossenkoppele, and A. A. van de Loosdrecht
Immune mediated autologous cytotoxicity against hematopoietic precursor cells in patients with myelodysplastic syndrome
Haematologica,
April 1, 2009;
94(4):
496 - 506.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Kuttruff, S. Koch, A. Kelp, G. Pawelec, H.-G. Rammensee, and A. Steinle
NKp80 defines and stimulates a reactive subset of CD8 T cells
Blood,
January 8, 2009;
113(2):
358 - 369.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. G. Casado, O. DelaRosa, G. Pawelec, E. Peralbo, E. Duran, F. Barahona, R. Solana, and R. Tarazona
Correlation of effector function with phenotype and cell division after in vitro differentiation of naive MART-1-specific CD8+ T cells
Int. Immunol.,
January 1, 2009;
21(1):
53 - 62.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. A. DeBenedette, D. M. Calderhead, H. Ketteringham, A. H. Gamble, J. M. Horvatinovich, I. Y. Tcherepanova, C. A. Nicolette, and D. G. Healey
Priming of a Novel Subset of CD28+ Rapidly Expanding High-Avidity Effector Memory CTL by Post Maturation Electroporation-CD40L Dendritic Cells Is IL-12 Dependent
J. Immunol.,
October 15, 2008;
181(8):
5296 - 5305.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Brignone, C. Grygar, M. Marcu, K. Schakel, and F. Triebel
A Soluble Form of Lymphocyte Activation Gene-3 (IMP321) Induces Activation of a Large Range of Human Effector Cytotoxic Cells
J. Immunol.,
September 15, 2007;
179(6):
4202 - 4211.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Derre, M. Bruyninx, P. Baumgaertner, E. Devevre, P. Corthesy, C. Touvrey, Y. D. Mahnke, H. Pircher, V. Voelter, P. Romero, et al.
In Vivo Persistence of Codominant Human CD8+ T Cell Clonotypes Is Not Limited by Replicative Senescence or Functional Alteration
J. Immunol.,
August 15, 2007;
179(4):
2368 - 2379.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. L. Alves, E. M. M. van Leeuwen, E. B. M. Remmerswaal, N. Vrisekoop, K. Tesselaar, E. Roosnek, I. J. M. ten Berge, and R. A. W. van Lier
A New Subset of Human Naive CD8+ T Cells Defined by Low Expression of IL-7R{alpha}
J. Immunol.,
July 1, 2007;
179(1):
221 - 228.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Wolfl, J. Kuball, W. Y. Ho, H. Nguyen, T. J. Manley, M. Bleakley, and P. D. Greenberg
Activation-induced expression of CD137 permits detection, isolation, and expansion of the full repertoire of CD8+ T cells responding to antigen without requiring knowledge of epitope specificities
Blood,
July 1, 2007;
110(1):
201 - 210.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Romero, A. Zippelius, I. Kurth, M. J. Pittet, C. Touvrey, E. M. Iancu, P. Corthesy, E. Devevre, D. E. Speiser, and N. Rufer
Four Functionally Distinct Populations of Human Effector-Memory CD8+ T Lymphocytes
J. Immunol.,
April 1, 2007;
178(7):
4112 - 4119.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Monteiro, C. Evaristo, A. Legrand, A. Nicoletti, and B. Rocha
Cartography of gene expression in CD8 single cells: novel CCR7- subsets suggest differentiation independent of CD45RA expression
Blood,
April 1, 2007;
109(7):
2863 - 2870.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Barbey, P. Baumgaertner, E. Devevre, V. Rubio-Godoy, L. Derre, G. Bricard, P. Guillaume, I. F. Luescher, D. Lienard, J.-C. Cerottini, et al.
IL-12 Controls Cytotoxicity of a Novel Subset of Self-Antigen-Specific Human CD28+ Cytolytic T Cells
J. Immunol.,
March 15, 2007;
178(6):
3566 - 3574.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Tabiasco, E. Devevre, N. Rufer, B. Salaun, J.-C. Cerottini, D. Speiser, and P. Romero
Human Effector CD8+ T Lymphocytes Express TLR3 as a Functional Coreceptor
J. Immunol.,
December 15, 2006;
177(12):
8708 - 8713.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Carrasco, D. Godelaine, A. Van Pel, T. Boon, and P. van der Bruggen
CD45RA on human CD8 T cells is sensitive to the time elapsed since the last antigenic stimulation
Blood,
November 1, 2006;
108(9):
2897 - 2905.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Appay, C. Jandus, V. Voelter, S. Reynard, S. E. Coupland, D. Rimoldi, D. Lienard, P. Guillaume, A. M. Krieg, J.-C. Cerottini, et al.
New Generation Vaccine Induces Effective Melanoma-Specific CD8+ T Cells in the Circulation but Not in the Tumor Site
J. Immunol.,
August 1, 2006;
177(3):
1670 - 1678.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Meng, H. Harlin, J. P. O'Keefe, and T. F. Gajewski
Induction of Cytotoxic Granules in Human Memory CD8+ T Cell Subsets Requires Cell Cycle Progression
J. Immunol.,
August 1, 2006;
177(3):
1981 - 1987.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. E. Speiser, P. Baumgaertner, C. Barbey, V. Rubio-Godoy, A. Moulin, P. Corthesy, E. Devevre, P.-Y. Dietrich, D. Rimoldi, D. Lienard, et al.
A Novel Approach to Characterize Clonality and Differentiation of Human Melanoma-Specific T Cell Responses: Spontaneous Priming and Efficient Boosting by Vaccination
J. Immunol.,
July 15, 2006;
177(2):
1338 - 1348.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. S. Warren, P. M. Rana, D. T. Rieger, K. A. Hewitt, J. E. Dahlstrom, and A. L. Kent
CD8 T cells expressing killer Ig-like receptors and NKG2A are present in cord blood and express a more naive phenotype than their counterparts in adult blood
J. Leukoc. Biol.,
June 1, 2006;
79(6):
1252 - 1259.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Condomines, P. Quittet, Z.-Y. Lu, L. Nadal, P. Latry, E. Lopez, M. Baudard, G. Requirand, C. Duperray, J.-F. Schved, et al.
Functional Regulatory T Cells Are Collected in Stem Cell Autografts by Mobilization with High-Dose Cyclophosphamide and Granulocyte Colony-Stimulating Factor.
J. Immunol.,
June 1, 2006;
176(11):
6631 - 6639.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. M. Serrano, T. Pfeiffer, S. Olivares, T. Numbenjapon, J. Bennitt, D. Kim, D. Smith, G. McNamara, Z. Al-Kadhimi, J. Rosenthal, et al.
Differentiation of naive cord-blood T cells into CD19-specific cytolytic effectors for posttransplantation adoptive immunotherapy
Blood,
April 1, 2006;
107(7):
2643 - 2652.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Bondanza, V. Valtolina, Z. Magnani, M. Ponzoni, K. Fleischhauer, M. Bonyhadi, C. Traversari, F. Sanvito, S. Toma, M. Radrizzani, et al.
Suicide gene therapy of graft-versus-host disease induced by central memory human T lymphocytes
Blood,
March 1, 2006;
107(5):
1828 - 1836.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Baumgaertner, N. Rufer, E. Devevre, L. Derre, D. Rimoldi, C. Geldhof, V. Voelter, D. Lienard, P. Romero, and D. E. Speiser
Ex vivo Detectable Human CD8 T-Cell Responses to Cancer-Testis Antigens
Cancer Res.,
February 15, 2006;
66(4):
1912 - 1916.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Migliaccio, P. M. S. Alves, P. Romero, and N. Rufer
Distinct Mechanisms Control Human Naive and Antigen-Experienced CD8+ T Lymphocyte Proliferation
J. Immunol.,
February 15, 2006;
176(4):
2173 - 2182.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Baeten, S. Louis, C. Braud, C. Braudeau, C. Ballet, F. Moizant, A. Pallier, M. Giral, S. Brouard, and J.-P. Soulillou
Phenotypically and Functionally Distinct CD8+ Lymphocyte Populations in Long-Term Drug-Free Tolerance and Chronic Rejection in Human Kidney Graft Recipients
J. Am. Soc. Nephrol.,
January 1, 2006;
17(1):
294 - 304.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Emu, E. Sinclair, D. Favre, W. J. Moretto, P. Hsue, R. Hoh, J. N. Martin, D. F. Nixon, J. M. McCune, and S. G. Deeks
Phenotypic, Functional, and Kinetic Parameters Associated with Apparent T-Cell Control of Human Immunodeficiency Virus Replication in Individuals with and without Antiretroviral Treatment
J. Virol.,
November 15, 2005;
79(22):
14169 - 14178.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. D. Fritsch, X. Shen, G. P. Sims, K. S. Hathcock, R. J. Hodes, and P. E. Lipsky
Stepwise Differentiation of CD4 Memory T Cells Defined by Expression of CCR7 and CD27
J. Immunol.,
November 15, 2005;
175(10):
6489 - 6497.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Amyes, A. J. McMichael, and M. F. C. Callan
Human CD4+ T Cells Are Predominantly Distributed among Six Phenotypically and Functionally Distinct Subsets
J. Immunol.,
November 1, 2005;
175(9):
5765 - 5773.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Willinger, T. Freeman, H. Hasegawa, A. J. McMichael, and M. F. C. Callan
Molecular Signatures Distinguish Human Central Memory from Effector Memory CD8 T Cell Subsets
J. Immunol.,
November 1, 2005;
175(9):
5895 - 5903.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. J. Dunne, L. Belaramani, J. M. Fletcher, S. F. de Mattos, M. Lawrenz, M. V. D. Soares, M. H. A. Rustin, E. W.-F. Lam, M. Salmon, and A. N. Akbar
Quiescence and functional reprogramming of Epstein-Barr virus (EBV)-specific CD8+ T cells during persistent infection
Blood,
July 15, 2005;
106(2):
558 - 565.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. K. Ahn, J.-M. Seo, J. Yu, F. S. Oh, H. Chung, and H. G. Yu
Down-Regulation of IFN-{gamma}-Producing CD56+ T Cells after Combined Low-Dose Cyclosporine/Prednisone Treatment in Patients with Behcet's Uveitis
Invest. Ophthalmol. Vis. Sci.,
July 1, 2005;
46(7):
2458 - 2464.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
I. Munitic, P. E. Ryan, and J. D. Ashwell
T Cells in G1 Provide a Memory-Like Response to Secondary Stimulation
J. Immunol.,
April 1, 2005;
174(7):
4010 - 4018.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Sabbaj, M. K. Ghosh, B. H. Edwards, R. Leeth, W. D. Decker, P. A. Goepfert, and G. M. Aldrovandi
Breast Milk-Derived Antigen-Specific CD8+ T Cells: An Extralymphoid Effector Memory Cell Population in Humans
J. Immunol.,
March 1, 2005;
174(5):
2951 - 2956.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Mallard, F. Vernel-Pauillac, T. Velu, F. Lehmann, J.-P. Abastado, M. Salcedo, and N. Bercovici
IL-2 Production by Virus- and Tumor-Specific Human CD8 T Cells Is Determined by Their Fine Specificity
J. Immunol.,
March 15, 2004;
172(6):
3963 - 3970.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction