|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, 1 June 2004, Vol. 103, No. 11, pp. 4142-4149. Prepublished online as a Blood First Edition Paper on February 19, 2004; DOI 10.1182/blood-2003-01-0285.
HEMATOPOIESIS The interferon regulatory factor ICSBP/IRF-8 in combination with PU.1 up-regulates expression of tumor suppressor p15Ink4b in murine myeloid cellsFrom the Laboratory of Cellular Oncology, National Cancer Institute, Bethesda, MD; and Laboratory of Molecular Growth Regulation, National Institute of Child Health and Human Development, Bethesda, MD.
CDKN2B (INK4B), which encodes the cyclin-dependent kinase inhibitor p15INK4b, is up-regulated by many cytokines found in hematopoietic environments in vivo. In human acute myeloid leukemias (AMLs), it is inactivated with high frequency. To gain insight into the regulatory pathways leading to the normal activation of p15Ink4b expression, we examined interferon  (IFN)–induced transcription. Using reporter gene assays in murine myeloid cells M1, we determined that a 328-bp fragment, located 117 to 443 bp upstream of the translation initiation site, was sufficient to activate transcription. Both the interferon consensus sequence-binding protein/interferon regulatory factor 8 (ICSBP/IRF-8) and PU.1 were able to increase transcription from this region. It was determined that both ICSBP and PU.1 must bind to DNA to form a stable PU.1/ICSBP binding complex. Interestingly, introduction of the ICSBP into ICSBP-null Tot2 cells led to a significant increase in p15Ink4b RNA expression. This regulation of the Ink4b promoter is apparently myeloid specific because both ICSBP and PU.1 are myeloid commitment factors. Importantly, this provides a mechanism to explain in part the tumor suppressor activity of ICSBP, since ICSBP-deficient mice develop a chronic myelogenous leukemia (CML)–like disease and a high percentage of human AML and CML lack ICSBP transcripts.
The INK4 family of tumor suppressors play an important role in the development of neoplastic diseases.1,2 In particular, one of its members, p15INK4b, is inactivated with high frequency in hematopoietic neoplasms. This protein, like other family members, is a cyclin-dependent kinase inhibitor (CDKI), acting at the early G1 phase of the cell cycle. It binds to CDK4 and CDK6 inhibiting the interaction of the kinases with cyclin Ds. The CDKN2B (INK4B) gene, which encodes this protein, is inactivated by hypermethylation in approximately 80% of all acute myeloid leukemias (AMLs) and a high proportion of acute lymphocytic leukemias (ALLs) and myelodysplastic syndromes (MDSs). In addition, it is deleted in approximately 50% of all ALLs.1 Ink4b-deficient mice develop a lymphoproliferative disease and a low incidence of angiosarcomas and have an increased susceptibility to retrovirus-induced myeloid leukemia.3,4
According to recent studies, p15INK4b functions in pathways that involve extrinsic signaling. For example, its expression is up-regulated in myeloid cells at the RNA level in response to interleukin-6 (IL-6)5-7 in lymphoid cells in response to type 1 interferon (IFN
Since much of the research on p15INK4b strongly indicates that it is involved in the physiologic control of hematopoietic cell growth, it is important to understand how its expression is regulated at the transcription level through cytokines. To date, little is known about how the Ink4b promoter is regulated in myeloid cells, although studies have looked at its response in human and mouse epithelial cells following treatment with TGF
In the present study, we specifically examined the transcriptional response of the Ink4b gene to treatment with type 1 IFN in murine myeloid cells. We chose to look at the IFN response for 2 reasons. First, type 1 IFN is used as a treatment to inhibit progression of human chronic myelogenous leukemia (CML) and little is known about its growth inhibitory mechanisms. Second, autocrine expression of IFN
Cells
The murine myeloid cell line M121 was maintained in RPMI 1640 medium supplemented with 10% heat-inactivated horse serum. For induction of growth arrest or differentiation, cells were seeded at a concentration of 2 x 105/mL and cultivated in medium containing 344 U/mL IFN Plasmids and primers The mammalian expression vectors pcDNA HA and pcDNA HA PU.1, encoding the murine full-length, wild-type PU.1 protein, were obtained from Harrinder Singh and described in Eisenbeis et al.24 The plasmids pcXN2, pcXN2 ICSBP, and pcDNA ICSBP expressing murine full-length, wild-type ICSBP were described in Minucci et al25 and Thornton et al.26 The ICSBP DNA-binding mutant pcDNA ICSBP K79E and the ICSBP interactivation domain mutant pcDNA ICSBP R289E were described in Tsujimura et al27 and Tamura et al.23 The plasmid pmp15 containing the genomic murine Ink4b DNA was a generous gift of Marcos Malumbres and is described in Malumbres et al.28 The plasmid was used as a template to determine the sequence of the Ink4b upstream region together with the following primers: -576/-595 bp, 5'gctagttcatctctaggcgg3'; -1075/-1094 bp, 5'cctgtcattaaaaccctctc3'; and -1630/-1649 bp, 5'ccagcaggttgatattgatg3'. Reporter vectors were constructed using the pGL3 luciferase reporter vectors pGL3-Basic and pGL3-Promoter (Promega, Madison, WI). Promoter regions were amplified using pmp15 as a template and the following primers: -1891/-1872 bp, 5'cagccaccggtctacctcaa3'; -1277/-1261 bp, 5'cagccgttcccacacag3'; -1006/-985bp, 5'gctctttattacatatgataac3'; -688/-669 bp, 5'ggatccttgggatgtgttat3'; -444/-424 bp, 5'ctaaataaagacctctgctcc3'; -293/-271 bp, 5'ctatttgtctcatgacgtcacca3'; -213/-193 bp, 5'tgcagaacgctgcagctcagt3' as forward primers and -117/-134 bp, 5'ggaacgctcgagcgctag3'; and -193/-213 bp, 5'actgagctgcagcgttctgca3' as reverse primers. The bp position is shown in reference to the translation start point as described in Malumbres et al28 (GenBank accession no. U66084 [GenBank] ). The resulting amplification products were cloned in the appropriate luciferase vector. Mutations of potential PU.1 and Sp1 binding sites were introduced by site-directed mutagenesis using the QuickChange Multi Site–Directed Mutagenesis Kit (Stratagene, La Jolla, CA). The 2 proximal PU.1 sites at position -364 bp and -357 bp were mutated with 5'ccggccacggtaagttaac-gactcttaagcttaaagttctgcgcagg3' and the downstream PU.1 site at -320 bp with 5'ggcgtctaagatcggccgactctctcaagataccacccc3'. Mutated bases are shown in bold. The nonmutated sequence is depicted in Figure 3.
Preparation of RNA, Northern blot analysis, and semiquantitative RT-PCR
Total RNA was prepared and analyzed by Northern analysis as described.7 The following cDNA fragments were used as probes: Ink4b, 1.3-kb EcoRI fragment29; PU.1, 0.9-kb HindIII/ApaI fragment30; ICSBP, 1.9-kb EcoRI fragment31; Preparation of protein lysates and Western blot analysis
Protein extracts and immunoblotting were prepared as described.7,33 The blots were probed with p15Ink4b (catalog no. sc-1429; Santa Cruz Biotechnology, Santa Cruz, CA) or Preparation of nuclear extracts
Nuclear extracts were prepared as reported in Marecki et al34 using a modified procedure originally described by Schreiber et al.35 The murine myeloid cell line M1 was plated at a concentration of 2 x 105/mL and stimulated for 16 hours with IFN Electrophoretic mobility shift assays (EMSA)
Complementary oligonucleotides spanning the region from -311 bp to -336 bp (30-bp probe), -311 bp to -362 bp (60-bp probe), or -375 bp to -336 bp (40-bp probe) of the Ink4b promoter region containing the predicted PU.1 and ICSBP binding sites (Figure 3) were annealed and labeled by filling in 3' recessed ends with DNA polymeraseI Klenow fragment (New England BioLabs, Beverly, MA) and [ Chromatin immunoprecipitation assay Chromatin immunoprecipitation (ChIP) analysis was performed as described previously36 with some modifications. Proteins were cross-linked to the genomic DNA in M1 cells by addition of formaldehyde (1% wt/vol) directly to culture medium and incubated for 30 minutes at room temperature. Glycine (125 mM) was added to the reaction and incubated for an additional 5 minutes to stop the reaction. The cells were washed twice with ice-cold PBS, resuspended in nuclei-releasing buffer (5 mM piperazine diethanesulfonic acid [PIPES], pH 8.0; 85 mM KCl; 0.5% NP40), swelled on ice for 10 minutes, and homogenized in a Dounce homogenizer to facilitate the release of the nuclei. Nuclei were pelleted at 2700g, resuspended in nuclei lysis buffer (50 mM Tris-HCl, pH 8.1; 10 mM EDTA; 1% sodium dodecyl sulfate [SDS]) supplemented with proteases inhibitors (Complete; Roche Applied Science), and sonicated twice for 30 seconds. After centrifugation at 2700g the supernatant was incubated with Staph A cells for 15 minutes at 4° C. The Staph A cells were removed from the chromatin solution by centrifugation. Precleared chromatin from 2 x 107 cells was incubated overnight at 4° C either with 2 µgaffinity-purified rabbit polyclonal antibody to PU.1 (Santa Cruz Biotechnology), or 3 µL rabbit polyclonal serum to murine ICSBP37 or control immunoglobulin G (IgG) antibody. A control reaction with no antibody was also included in the experiment. The immune complexes were precipitated by a 15-minute incubation at 4° C with preblocked Staph A cells and collected by centrifugation. The precipitates were washed 5 times with immunoprecipitation buffer (100 mM Tris-HCl, pH 9.0; 500 mM LiCl, 1% NP40, 1% deoxycholic acid), resuspended in 300 µL elution buffer (50 mM NaHCO3, 1% SDS), and vortexed for 20 minutes at room temperature. Released Staph A cells were separated from the supernatant by centrifugation. Supernatant containing immunoprecipitated, cross-linked chromatin was transferred to a new tube supplemented with NaCl and RNase A (final concentration 300 mM and 30 µg/µL, respectively). To reverse formaldehyde cross-linking, the samples were incubated 5 hours at 67° C and the genomic DNA was ethanol precipitated. The pellets were resuspended in proteinase K buffer (10 mM Tris-HCl, pH 7.5; 5 mM EDTA, and 0.25% SDS) and treated with proteinase K (200 µg/µL) for 2 hours at 45° C. Immunoprecipitated DNA was further cleaned by phenol extraction and ethanol precipitation with glycogen. The pellet was dissolved in Tris-EDTA buffer and used in PCR analysis. Ink4b and c-myb promoter DNAs were detected by PCR analysis using HotStarTaq Master Mix Kit (Qiagen, Valencia, CA) and specific primers: p15diag+, 5'ggcctgggctaaataaagacct3'; and p15diag-, 5'ttcgccggccgtgagattgctaca3' for Ink4b; and Myb-pr1 as 5'gcacaagttcctgagaactg3', and Myb-pr1 as 5'aatacagtcagccctgtgg3' for c-myb. After 35 cycles of amplification, PCR products were separated on a 1.5% agarose gel containing ethidium bromide. DNA transfections and reporter gene analyses
Transfection of M1 cells was carried out by electroporation using 5 x 106 cells in 0.5 mL RPMI medium containing 0.5 µg pRL-TK (Promega), a Renilla luciferase vector to control for transfection efficiency, 3.0 µg of a luciferase reporter construct, and 20 µg of PU.1 and/or ICSBP expression plasmid or the corresponding empty vector. Purified DNA with an endotoxin level of less than 0.04 endotoxin units (EU)/µg of DNA was purchased from Qbiogene (Carlsbad, CA) or Lofstrand Labs Limited (Gaithersburg, MD). Electroporation was performed at 275 V with a pulse length of 50 milliseconds in an Electro Square Porator ECM 830 (BTX, San Diego, CA). The cells were plated at a density of 2 x 105/mL and, if indicated in the text, treated with IFN
The tumor suppressor p15Ink4b is up-regulated in M1 cells in response to IFN treatment
Differentiation toward the macrophage lineage and/or growth arrest can be induced by a variety of different stimuli and cytokines in the murine myeloid cell line, M1.38 It was previously shown that IL-6 causes up-regulation of p15Ink4b mRNA,6,7 and we presume its up-regulation promotes the growth arrest associated with IL-6–induced differentiation. We were interested in determining if IFN
Deletion analysis of the Ink4b promoter region
Since we were interested in the ability of IFN
PU.1 and ICSBP increase Ink4b promoter activity
The -444/-117-bp promoter fragment was studied further because it showed the highest promoter activity in both the absence and presence of IFN
M1 cells were transfected with the luciferase vector construct pGL3-Basic (-444/-117) and cotransfected with plasmids expressing PU.1, ICSBP, or both. The cells were cultivated in the presence or absence of IFN
Although PU.1 and ICSBP consistently induced transcription from the Ink4b promoter, we observed variability in the degree of PU.1/ICSBP-induced activation and this appeared to be due to a response to cell density– and/or stress-related activation following electroporation. In any case, we consistently observed at least a 2- to 3-fold increase in activation following transfection of ICSBP and PU.1. This range of increase is consistent with that observed by others.41
IFN
Localization of the PU.1 binding site in the Ink4b promoter region involved in the transcriptional response to IFN Experiments were performed to determine which of the 3 potential PU.1 binding sites are responsible for the stimulatory effect of PU.1 on p15Ink4b expression (Figure 3). The PU.1 sites were mutated in pGL3-Basic (-444/-117; Figure 5A) and the resulting vectors were analyzed for reporter gene activity. Mutation of the 2 upstream PU.1 binding sites (-364 bp and -357 bp) did not show any inhibitory effect on promoter activity compared with the nonmutated, original sequence. However, mutation of the PU.1 binding site at -320 bp lead to a significant drop in promoter activity. The same effect was observed with the construct harboring the deletion of all 3 potential PU.1 binding sites. Thus, the PU.1 binding site closest to the transcription start point (-320 bp) alone is responsible for the positive regulatory effect of PU.1 in this promoter region.
In conjunction with our data in Figure 5A that strongly indicated that the 320-bp PU.1 potential binding site is involved in IFN Mechanism of ICSBP's interaction with PU.1 at the Ink4b promoter
Regulation of promoter activity by PU.1 has been described by others to occur either by (1) binding of the PU.1 and an IRF to a PU.1/IRF composite element (adjacent sites) to form a complex or (2) tethering of an IRF to DNA through interaction with PU.1 in the absence of direct IRF binding.40 Since we did not find a PU.1/IRF composite element or complete ISRE sequence motif (binding site for IRFs) in the -444 bp to -117 bp promoter region, an indirect mode of binding initially seemed more likely. It was important, however, to clarify whether ICSBP is simply tethered to the DNA through PU.1 or could actually bind to the DNA itself. Therefore, we performed reporter gene assays using 2 ICSBP mutants described before by Tsujimura et al27 and Tamura et al23 to assist in the determination of the correct mechanism of this ICSBP promoter interaction. ICSBP K79E carries a mutation in the DNA binding domain that inhibits its binding to target elements. ICSBP R289E carries a mutation in the IRF association domain believed to be indispensable for interaction with PU.1.43 M1 cells were transfected with pGL3-Basic (-444/-117) and cotransfected with plasmids expressing ICSBP, ICSBP K79E, or ICSBP R289E. The cells were cultivated in the presence of IFN
As mentioned above, there is no consensus ISRE binding motif in the -444/-117-bp Ink4b promoter region and no composite element at the PU.1 site at -320. However, since our data with the ICSBP mutants suggested that ICSBP binds to DNA, we examined the DNA sequence more carefully for a motif that might at least have part of the consensus binding site for ISCBP.40 We found a sequence at -350 bp that matched the core of the ICSBP binding motif (Figure 3). In order to determine if this partial ICSBP binding site is able to facilitate ICSBP activation of the Ink4b promoter, we mutated the ICSBP core-binding sequence in pGL3-Basic (-444/-117) and subsequently analyzed it for reporter gene activity (Figure 6B). The degree of transactivation of mutated reporter construct pGL3-Basic (-444/-117)
To establish if binding of ICSBP to the proposed binding site 30 bp upstream of the -320 PU.1 binding site stabilizes the ICSBP/PU.1 binding to DNA, we carried out an EMSA with a radiolabeled oligonucleotide that spanned from -363 bp to -312 bp (Probe C) and that included potential binding sites for both transcription factors. Nuclear lysates were harvested from M1 cells treated for 16 hours with IFN PU.1 and ICSBP are both bound to the endogenous Ink4b promoter in M1 cells
To see if PU.1 and ICSBP proteins bind to the Ink4b promoter in vivo, we performed a ChIP analysis. M1 cells were treated with IFN
Expression of ICSBP in an ICSBP-/- myeloid progenitor cell line induces the expression of p15Ink4b Tamura and coworkers23 reported the establishment of an ICSBP-/- immature blast cell line, Tot2, from bone marrow cells of ICSBP knockout mice. Transduction of these cells with an ICSBP-expressing vector was shown to induce differentiation toward the macrophage lineage in association with growth arrest. We were interested in whether p15Ink4b expression is induced following expression of ICSBP and, therefore, might play a role in promoting growth arrest. We analyzed the cells using RT-PCR for p15Ink4b mRNA expression 2, 3, 4, and 6 days following transduction with the ICSBP-expressing vector and compared this expression with that in cells transfected with the empty vector (Figure 8). As early as 2 days following transduction of ICSBP, a significant level of RT-PCR product could be detected that continued to rise during the subsequent 4 days. In contrast to the ICSBP-expressing cells, there was only basal expression of the CDK inhibitor RNA in the control cells with exception of day 6 (where we observed a slight increase in p15Ink4b expression).
This study presents a model to explain how the expression of the tumor suppressor p15Ink4b in myeloid cells is controlled in response to treatment with the growth inhibitory cytokine IFN . Data here shows that the transcription factors PU.1 and ICSBP bind to DNA and regulate transcription from the promoter in myeloid cells in response to this type I IFN. The role of ICSBP in regulating the promoter was further substantiated in an experiment where its ectopic expression in an ICSBP-null hematopoietic cell line resulted in a dramatic increase in p15Ink4b RNA. The regulation of the Ink4b promoter by ICSBP and PU.1 is interesting for 2 reasons. First, both p15Ink4b and ICSBP are proposed tumor suppressors. The finding that ICSBP positively regulates the expression of another tumor suppressor provides an explanation for its own tumor suppressive function. Second, both PU.1 and ICSBP are myeloid commitment factors, suggesting that the observed regulation of p15Ink4b expression by these factors is lineage specific. The fact that the ICSBP product regulates the Ink4b promoter shows that the 2 genes are in the same pathway of growth control. It had been previously found that ICSBP-deficient mice develop a CML-like disease and that 66% of all AML and 79% of all CML patients have reduced levels of ICSBP or no expression at all.17,19 Functions of ICSBP that would explain this tumor suppressor role have been elusive until now. Therefore, our observation that ICSBP regulates p15Ink4b expression provides, at least in part, an explanation for ICSBP's role in growth inhibition. It was also demonstrated recently that ICSBP inhibits growth of Bcr/Abl-transformed cells by activating several genes that interfere with the c-Myc pathway.44
PU.1 has been shown to be important not only for lineage commitment of hematopoietic progenitors into myeloid cells and B cells but also for terminal differentiation of myeloid cells into macrophages.45-47 ICSBP is also a myeloid commitment factor.17 For example, ICSBP-/- mice harbor an increased number of myeloid progenitor cells compared with normal mice. These myeloid cells have impaired macrophage differentiation and mature mainly into granulocytes. Although, we did not observe a composite element for ICSBP and PU.1 in the Ink4b promoter, similar to that found in the gp91phox promoter and in other myeloid specific promoters,40 we found a consensus binding site for PU.1 and a partial consensus binding site for ICSBP that was 30 bp upstream. We provide evidence that both binding sites are used to form a stable complex that is active in transcription of the Ink4b promoter. Even though ICSBP and PU.1 are present in cells prior to treatment with IFN
The Myc-interacting zinc finger protein 1 (Miz-1) has been shown recently to be instrumental in regulating p15Ink4b expression in TGF Administration of type I interferons is an important treatment for CML patients in chronic phase. These agents are also widely used in the treatment of myeloproliferative disorders.51 The study presented here suggests a mechanism to explain how IFN may inhibit growth. The INK4b gene is not usually inactivated in CMLs as it is in AML. Therefore, the fact that IFN is effective for treatment of CML, but not AML, could be correlated with the INK4b promoter status. It would be interesting to determine if p15INK4b expression is up-regulated in CML in response to the IFN treatment.
We are grateful to Marcos Malumbres for kindly providing us with the plasmid pmp15, harboring the genomic Ink4b promoter sequence, which enabled us to do this study. Additionally, we thank Harinder Singh for providing us with the PU.1 expression plasmids, John Brady for sharing his expertise in EMSA technology, Carol Stocking for invaluable and stimulating discussions, and Jan Markus for critical reading of the manuscript. J.B. is on leave from the Cancer Research Institute, Slovak Academy of Sciences, Bratislava, Slovak Republic.
Submitted January 29, 2003; accepted February 9, 2004.
Prepublished online as Blood First Edition Paper, February 19, 2004; DOI 10.1182/blood-2003-01-0285.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Linda Wolff, Laboratory of Cellular Oncology, National Cancer Institute, Bethesda, MD 20892-4263; e-mail: lwolff{at}helix.nih.gov.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Top
Abstract
Introduction
)
(Pepro-Tech, Rocky Hill, NJ), 50 ng/mL lipopolysaccharide (LPS; Sigma, St Louis, MO), or IL-6. The IL-6 stocks were prepared as described recently.
ICSBP. An expression plasmid for ICSBP or the corresponding empty vector was cotransfected .The samples were analyzed for luciferase activity 24 hours following transfection. Shown are relative values normalized for Renilla luciferase activity. Error bars depict standard error. (C) EMSA analysis was performed using nuclear extracts (NEs) from M1 cells and radiolabeled oligonucleotides spanning the Ink4b promoter region from -364 bp to -312 bp (Probe C). The -320 bp PU.1 binding site, as well as the potential ICSBP binding site at -360 bp, are present in this region. For lanes 2 to 7, nuclear extract from cells that were cultivated in the presence of IFN
