Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 15 June 2004, Vol. 103, No. 12, pp. 4636-4643.
Prepublished online as a Blood First Edition Paper on March 2, 2004; DOI 10.1182/blood-2003-09-3068.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-09-3068v1
103/12/4636    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Piekarz, R. L.
Right arrow Articles by Bates, S. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Piekarz, R. L.
Right arrow Articles by Bates, S. E.
Related Collections
Right arrow Neoplasia
Right arrow Apoptosis
Right arrow Cell Cycle
Right arrow Gene Expression
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

NEOPLASIA

T-cell lymphoma as a model for the use of histone deacetylase inhibitors in cancer therapy: impact of depsipeptide on molecular markers, therapeutic targets, and mechanisms of resistance

Richard L. Piekarz, Robert W. Robey, Zhirong Zhan, Ganesh Kayastha, Anousheh Sayah, Amina H. Abdeldaim, Sonia Torrico, and Susan E. Bates

From the Cancer Therapeutics Branch, Center for Cancer Research, National Cancer Institute (NCI), National Institutes of Health (NIH), Bethesda, MD.


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Depsipeptide (FK228) is a novel histone deacetylase inhibitor currently in clinical trials and the first to demonstrate clinical activity in patients. Responses have been observed in patients with T-cell lymphomas, despite prior treatment with multiple chemotherapeutic agents. To better understand the effects of histone deacetylase inhibitors on T-cell lymphoma, the human T-cell lymphoma cell line HUT78 was tested for sensitivity and molecular response to depsipeptide. Treatment with depsipeptide, as well as other histone deacetylase inhibitors, caused induction of histone acetylation, induction of p21 expression, and substantial apoptosis without significant cell cycle arrest. Treatment with the caspase inhibitor z-VAD-fmk significantly inhibited depsipeptide-induced apoptosis, enabling detection of cell cycle arrest. Treatment with depsipeptide increased expression of the interleukin-2 (IL-2) receptor, and combination with the IL-2 toxin conjugate denileukin diftitox resulted in more than additive toxicity. Cells selected for resistance to depsipeptide overexpressed the multidrug resistance pump, P-glycoprotein (Pgp). However, cells selected for resistance to depsipeptide in the presence of a Pgp inhibitor had a Pgp-independent mechanism of resistance. These studies confirm the activity of depsipeptide in a T-cell lymphoma model and suggest a general sensitivity of T-cell lymphoma to histone deacetylase inhibitors, an emerging new class of anticancer agents. (Blood. 2004;103:4636-4643)


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The histone deacetylase inhibitors (HDIs) are a new class of antineoplastic agents currently being evaluated in clinical trials. HDIs induce growth arrest usually associated with cellular differentiation or apoptosis. Alterations in the enzymes controlling histone acetylation and deacetylation have been shown to be a direct mechanism of transformation in some malignancies.1 The consequence of a decrease in histone acetylation is a decreased expression of cell cycle inhibitors and other genes involved in regulating a differentiated phenotype.2

Depsipeptide (FK228) is an HDI that has in vitro and in vivo cytotoxic activity.3 Several families of HDIs have been characterized. These include the short-chain fatty acids, such as sodium butyrate and valproic acid; the organic hydroxamic acids, such as trichostatin A (TSA) and suberanilohydroxamic acid (SAHA); the benzamides, such as CI-994 and MS-27-275; the cyclic tetrapeptides, such as trapoxin A; and the bicyclic depsipeptides, such as depsipeptide. Similar to other HDIs, depsipeptide has been shown to induce cell cycle arrest, cellular differentiation, and apoptosis. Depsipeptide induces a p53-independent/p21-dependent G1 arrest and a p21-independent G2/M arrest. In addition, depsipeptide causes alterations in gene expression, including increased expression of p21 and cyclin E and decreased expression of cyclin D1 and c-myc.4-6

T-cell lymphomas are composed of a spectrum of clinical phenotypes ranging from low-grade, cutaneous T-cell lymphomas (CTCLs) to highly aggressive peripheral T-cell lymphomas. Except for early-stage CTCL, response to chemotherapy is typically limited. In a phase 1 trial of depsipeptide conducted at the National Cancer Institute (NCI), responses were observed in patients with T-cell lymphoma, and a phase 2 trial of depsipeptide in these patients is ongoing.7,8

The interleukin-2 (IL-2) receptor is a marker of T-cell differentiation and is expressed in some T-cell malignancies.9,10 The IL-2 receptor, IL-2R, is composed of the {alpha}, {beta}, and {gamma} subunits. All 3 subunits complexed together, IL-2R{alpha}{beta}{gamma}, confer high-affinity binding to IL-2, while the combined {beta}{gamma} subunits, IL-2R{beta}{gamma}, have intermediate affinity.11,12 The {beta} subunit, CD122 or p75, is important for ligand internalization, and the {gamma} subunit, CD132 or p64, is important for signal transduction.13 Therapies that target the IL-2 receptor have been developed for the treatment of T-cell lymphoma. Denileukin diftitox (DAB389IL-2 or Ontak) is a fusion molecule of IL-2 to diphtheria toxin and has been shown to have efficacy in patients with T-cell lymphoma.14,15 In addition, antibodies to the IL-2 receptor, specifically the {alpha} subunit (CD25 or Tac), are also in clinical trials. Differentiating agents, such as retinoids, have been shown to increase the expression of the IL-2 receptor subunits in malignant T cells.16 Recent studies have demonstrated that both retinoids and the histone deacetylase inhibitor arginine butyrate increase sensitivity of the HUT78 cutaneous T-cell lymphoma cell line to denileukin diftitox.17,18 Since depsipeptide, like other HDIs, is able to induce markers of differentiation, we postulated that it could also increase expression of the IL-2 receptor subunits. Induction of the IL-2 receptor could allow for combination therapies with depsipeptide.

Since depsipeptide appears to be effective clinically, it is important to understand mechanisms that could limit its efficacy. Using the COMPARE analysis of the NCI drug screen, depsipeptide was found to segregate with other agents that are transported by P-glycoprotein (Pgp).19 Cell lines that overexpress Pgp are resistant to depsipeptide, and this resistance is reversed by Pgp inhibitors.19 Differentiating agents, including the HDIs, have been shown to induce the expression of Pgp.20-22 These studies suggest that depsipeptide could induce its own mechanism of resistance. To evaluate resistance mechanisms other than Pgp, cells were selected for resistance to depsipeptide in combination with an inhibitor of Pgp. This strategy has previously been successful at identification of non-Pgp mechanisms of resistance.23-26

We thus initiated laboratory studies to evaluate the molecular effects of depsipeptide in a human T-cell lymphoma cell line as a corollary to ongoing clinical studies. Our goal in these studies was to identify molecular changes following exposure to depsipeptide that could be used as biomarkers of response to depsipeptide, or other HDIs, in tumors of patients being treated with these agents. Histone acetylation, gene expression, cell cycle arrest, and apoptosis were evaluated to demonstrate the effects of depsipeptide. With the goal of testing HDIs in combination with other antineoplastic agents, we tested the effects of depsipeptide on the expression of the IL-2 receptor subunits. These were chosen since agents targeting the IL-2 receptor are already in clinical use or in clinical development for patients with T-cell lymphoma. A final goal was to evaluate mechanisms of resistance that may play a role in limiting response to depsipeptide. The HDIs induce expression of P-glycoprotein, which has been shown to confer resistance to depsipeptide. We asked whether depsipeptide induced or selected for multidrug resistance protein 1 (MDR-1) expression in the HUT78 cell line. To investigate non-Pgp mechanisms of resistance to HDIs, we also selected cells in the presence of a Pgp inhibitor.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Cell lines and materials

The human HUT78 cells were purchased from the American Type Culture Collection (Manassas, VA). The cells were maintained in RPMI 1640 supplemented with 10 mM Hepes (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid), 1 mM pyruvate, penicillin 100 U/mL, streptomycin 100 µg/mL (all from Biofluids, Camarillo, CA), and 10% fetal calf serum (GIBCO, Grand Island, NY) at 37°Cin5%CO2. Depsipeptide, provided by Fujisawa Pharmaceutical (Osaka, Japan), was dissolved to 5 mg/mL in 4:1 propylene glycol and ethanol and then diluted to 100 µg/mL in dimethyl sulfoxide (DMSO) and stored at -20°C. For experiments, depsipeptide was further diluted in cell culture media. The z-VAD-fmk (Enzyme Systems Products, Livermore, CA) was dissolved in DMSO. Cells were treated with 100 µM, with control cells being treated with the same concentration of DMSO, for 1 hour prior to the addition of depsipeptide. Cells cycle arrest and annexin V analysis were performed at 48 hours.

Selection of depsipeptide-resistant cell lines

HUT78 cells were selected in a stepwise fashion with increasing concentrations of depsipeptide in the absence (Dp) or presence (DpVp) of 5 µM verapamil. For experiments with these cell lines, depsipeptide and verapamil were removed from the culture media 2 weeks prior to plating.

Flow cytometry

Apoptosis was measured using the annexin V-fluorescein isothiocyanate (annexin V-FITC) Apoptosis Detection Kit (BD Biosciences, San Diego, CA) according to the manufacturer's instructions. For surface protein expression of IL-2R{alpha} and IL-2R{beta}, cells were incubated for 30 minutes with phycoerythrin-labeled antihuman CD25 (IL-2R{alpha}) or CD122 (IL-2R{beta}) antibody (both from BD Biosciences) or a negative control antibody (BD Biosciences) in phosphate-buffered saline (PBS) containing 2% bovine serum albumin (BSA) in PBS for 30 minutes. Cell surface Pgp expression was determined by incubating cells in the anti-Pgp antibody, MRK-16 (Kamiya Biomedical, Seattle, WA), or a negative control antibody in 2% BSA in PBS for 30 minutes, washing the cells, then incubating them with a phycoerythrin secondary antibody (Vector Laboratories, Burlingame, CA) for 30 minutes. Dead cells were excluded based on propidium iodide staining. For cell cycle studies, HUT78 cells were washed with PBS, centrifuged, and resuspended in 500 µL staining solution (0.1 mg/mL propidium iodide and 0.6% Triton-X in PBS) to which 500 µL RNAse A solution (200 U/mL in PBS) was added. The cells were allowed to incubate for 30 minutes at room temperature and were subsequently analyzed using a FACSort flow cytometer (Becton Dickinson, San José, CA). The program ModFit LT version 2.0 (Verity Software, Topsham, ME) was used to determine the percentage of cells in each phase of the cell cycle.

Rhodamine 123 efflux analysis was performed as previously described.19,27 Briefly, cells were resuspended in complete media (phenol red-free Iscove modified Eagle medium [IMEM] with 10% fetal calf serum) containing 0.5 µg/mL rhodamine 123 (Sigma Chemical, St Louis, MO), with or without 2.5 µg/mL valspodar, a Pgp inhibitor, and incubated for 30 minutes at 37°C in 5% CO2. Cells were then washed once in cold complete medium and then incubated for 1 hour at 37°C in substrate-free media continuing with or without valspodar. Subsequently, cells were washed twice with cold Dulbecco PBS and placed on ice in the dark until analyzed. Cells were analyzed on a FACSort flow cytometer. For all samples, at least 10 000 events were collected. Debris was eliminated by gating on forward versus side scatter and dead cells were excluded based on propidium iodide staining.

Cytotoxicity assay

Cytotoxicity assays were performed in 96-well dishes with 5 x 103 cells per well. For experiments testing sensitivity to depsipeptide, sodium butyrate, TSA, and MS-275, cells were placed in varying concentrations of depsipeptide for 72 hours. Combination studies with denileukin diftitox were performed by incubating cells in depsipeptide for 48 hours, adding denileukin diftitox, and continuing with depsipeptide for an additional 72 hours. Cell viability was assayed using Owen reagent (MTS [3-(4,5 dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl-2-(4-sulfophenyl)-2H-tetrazolium]) purchased as the Cell Titer 96 Aqueous One Solution Cell Proliferation Assay reagent (Promega, Madison, WI). Assays were performed according to the manufacturer's directions. Experiments were performed in triplicate.

Protein isolation and immunoblot analysis

Protein was prepared by washing treated HUT78 cells in PBS and resuspending in lysis buffer (0.02 M Tris [pH 7.4], 1% Triton X-100, and 0.02% beta-mercaptoethanol) with 2 ng/mL aprotinin and sonicating at 50% for 2 minutes in a water bath (Misonix, Farmingdale, NY). Protein concentration was measured using the BCA Protein Assay (Pierce, Rockford, IL). Extracts were then subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to Immobilon-P polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, MA). Blots were incubated in primary antibody overnight at 4°C. Antibodies used were antiacetylated histone H3 and anti-PARP (anti-poly(adenosine diphosphate-ribose) polymerase; Upstate Biotechnology, Waltham, MA), anti-CD25 and anti-CD122 (Santa Cruz Biotechnology, Santa Cruz, CA), anti-p21 (Transduction Laboratories, Bedford, MA), and anti-glyceraldehyde phosphate dehydrogenase (anti-GAPDH; American Research Products, Belmont, MA). Blots were incubated in secondary antibody for 1 hour at room temperature. Secondary antibodies used were horseradish peroxidase-conjugated antirabbit or antimouse antibody (Amersham, Piscataway, NJ). Chemiluminescence was carried out using an enhanced chemiluminescence (ECL) detection kit (SuperSignal West Pico Chemiluminescent Substrate; Pierce or Amersham) according to manufacturer's instructions.

RNA isolation and RT-PCR

RNA was extracted using the RNeasy kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. Reverse transcription of 1 µg of total RNA using 0.1 µg/µL random primer was performed with cDNA equivalent to 250 ng total RNA used for polymerase chain reaction (PCR). Amplification was performed for 30 cycles as previously described.28 Water was amplified a total of 40 cycles to detect possible contamination. Forty microliters of each PCR product was separated by gel electrophoresis and stained with 2 µg/mL ethidium bromide for analysis on a Fotoeclipse densitometer (Fotodyne, Hartland, WI). The primers used for PCR are as follows: MDR-128 forward: GCCTGGCAGCTGGAAGACAAATACACAAAATT, reverse: CAGACAGCAGCTGACAGTCCAAGAACAGGACT; IL-2R{alpha}29 forward: GAATTTATCATTTCGTGGTGGGGCA, reverse: TCTTCTACTCTTCCTCTGTCTCCG; IL-2R{beta}29 forward: ATCTCCCTCCAAGTTGTCC, reverse: TGCTTCTGCTTGAGAGTCAGC; and rRNA30 forward: AAACTCTGGTGGAGGTCCGT, reverse: CTTACCAAAAGTGGCCCACTA.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Depsipeptide cell cycle effects and cytotoxicity

The HUT78 T-cell lymphoma cell line was established from cells isolated from a patient with cutaneous T-cell lymphoma31 and, unlike other available T-cell lymphoma cell lines, has no evidence of human T-cell lymphotropic virus 1 (HTLV-1) infection. Figure 1A shows the results of cytotoxicity assays with depsipeptide performed on these cells. An observed 50% inhibitory concentration (IC50) of 0.75 ng/mL (1.4 nM) following a 72-hour exposure indicates a marked sensitivity to depsipeptide. Valspodar did not increase sensitivity to depsipeptide, indicating that this cell line does not express Pgp, a known mechanism of resistance to depsipeptide.19



View larger version (30K):
[in this window]
[in a new window]
 
Figure 1.. Cytotoxicity assay, cell cycle, and annexin V analysis of HUT78 cell line treated with depsipeptide. (A) HUT78 cells were treated for 3 days with varying concentrations of depsipeptide. Cytotoxicity assay was performed using Owen reagent as described in "Materials and methods." Data shown represent more than 3 experiments and are graphed on a linear scale. The cytotoxicity assay was performed in the absence or presence of 1 µg/mL valspodar, an inhibitor of Pgp. (B) Cell cycle analysis was performed using cells treated with or without depsipeptide (DP) at 0, 1, or 2 ng/mL for 48 and 72 hours. (C) Plot of annexin V staining of cells from the same experiment treated for 72 hours.

 

While depsipeptide, and other HDIs, cause cell cycle arrest in many cell lines, only minimal G1 and G2/M cell cycle arrest was observed in the HUT78 cell line. Figure 1B shows a cell cycle analysis with increasing time and concentration of depsipeptide (DP), where any suggestion of cell cycle arrest occurred concurrently with significant apoptosis. After 48 hours, for example, the G1 population decreased from 48% to 41%, while the G2/M population decreased from 14.6% to 6.3% following treatment with 2 ng/mL depsipeptide. More than 40% of cells were undergoing apoptosis, as detected by an increasing sub-G1 fraction. This was confirmed by increasing annexin V staining by flow cytometry (Figure 1C). At higher concentrations of depsipeptide, apoptosis was observed at earlier time points. Thus, instead of the cell cycle arrest frequently observed in cell lines derived from malignant epithelial cells, apoptosis was favored in the HUT78 cells.

Molecular response to depsipeptide

Protein was isolated at several time points from cells treated with varying concentrations of depsipeptide for evaluation of molecular response. As shown in Figure 2A, depsipeptide induced histone acetylation. Induction of p21 was observed, with increasing levels noted with increasing time and concentration. Furthermore, expression of p21 paralleled the level of histone acetylation, with higher levels of histone acetylation and p21 expression detected with increasing concentrations of depsipeptide. GAPDH, previously demonstrated to be unaffected by HDIs, was used as a control for gel loading.32 As observed with annexin V staining, increasing PARP degradation was observed with higher concentrations of depsipeptide. Treatment of cells with 4 ng/mL depsipeptide for 24 hours led to significant cell death. To understand whether cell death in this cell line was caspase mediated, the multi-caspase inhibitor z-VAD-fmk was used. Cells were treated with z-VAD-fmk for 1 hour prior to the addition of depsipeptide and were exposed to both agents together for 48 hours. Treatment with z-VAD-fmk resulted in a 2-fold increase in survival (from 25% to 50%) in cells treated with 2 ng/mL (Figure 2B) and 3-fold (from 16% to 50%) in cells treated with 4 ng/mL (data not shown). Interestingly, with the inhibition of apoptosis, a G2/M arrest, previously undetected following exposure to depsipeptide alone, became apparent.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 2.. Immunoblot analysis of depsipeptide-treated HUT78 cells. (A) HUT78 cells were treated for 24 to 48 hours with 0, 1, 2, or 4 ng/mL depsipeptide, as indicated. Whole cell lysates were prepared and 7 µg/mL proteins were separated by PAGE. Immunoblots were performed as described in "Materials and methods" using antibodies against acetylated histone H3, demonstrating the direct effect of depsipeptide on the cells; p21, indicating that depsipeptide is able to induce gene expression, as previously described; and PARP, to demonstrate the apoptotic effect of depsipeptide. GAPDH confirms equivalent loading of proteins. (B) HUT78 cells were pretreated with caspase inhibitor z-VAD-fmk (100 µM) or equal amount of DMSO as control for 1 hour prior to the addition of 2 ng/mL depsipeptide. Cells were exposed to both agents together for an additional 48 hours. Cells cycle arrest and annexin V analysis was performed as described in "Materials and methods."

 

Sensitivity of HUT78 cell line to other HDIs

To evaluate whether the sensitivity of the HUT78 cells to depsipeptide represents a general susceptibility to HDIs, we treated HUT78 cells with sodium butyrate, TSA, or MS-275. The observed IC50s were 0.2 mM for sodium butyrate, 100 nM for TSA, and 1 µM for MS-275 (Figure 3A). Figure 3B shows cell cycle effects and annexin V staining of HUT78 cells treated for 48 hours at IC50 doses. As observed for depsipeptide, these agents induced apoptosis with little to no effect on cell cycle. Figure 3C shows histone acetylation and p21 induction in the cells following treatment with each of the 3 HDIs.



View larger version (51K):
[in this window]
[in a new window]
 
Figure 3.. Cytotoxicity assay, cell cycle, and annexin V analysis of HUT78 cell line treated with other HDIs. (A) Cytotoxicity assay was performed on HUT78 cells treated for 3 days with varying concentrations of sodium butyrate (NaBu), trichostatin A (TSA), or MS-275 in the presence or absence of valspodar. Data are shown on a logarithmic scale. (B) Cell cycle analysis and annexin V staining shown for cells treated for 48 hours. (C) HUT78 cells were treated for 48 hours with the amount of depsipeptide, TSA, NaBu, or MS-275 as indicated. Whole cell lysates were prepared, and 10 µg/mL of proteins were separated by PAGE. Immunoblots were performed using antibodies against acetylated histone H3, demonstrating histone deacetylase activity of the individual HDIs, and p21, demonstrating the induction of gene expression by each individual HDI.

 

Alterations in gene expression

Next, reverse transcriptase-PCR (RT-PCR) analysis was used to evaluate alterations in gene expression in HUT78 cells treated with depsipeptide. One gene of interest is the MDR-1 gene, previously shown to be induced by HDIs and other differentiating agents. Table 1 shows that, at concentrations and time points associated with induction of p21 expression, there was a greater than 30-fold increase in MDR-1 expression, based on a quantitative RT-PCR assay and normalization of MDR-1 expression to that of rRNA expression.


View this table:
[in this window]
[in a new window]
 
Table 1.. Induction of MDR-1, CD25, and CD122 mRNA by depsipeptide

 

Since the IL-2 receptor is a target for the treatment of CTCL and differentiating agents have been demonstrated to increase both the expression of the IL-2 receptor and sensitivity to agents that target the IL-2 receptor, we examined the effect of depsipeptide on the expression of the IL-2 receptor subunits. By RT-PCR there was a 19-fold induction of the IL-2R{alpha} subunit mRNA and a greater than 2-fold increase of IL-2R{beta} subunit mRNA (Table 1). For reasons not yet understood, the kinetics of gene induction for the IL-2 receptor subunits vary from the kinetics of the MDR-1 gene.

Induction of sensitivity to other antineoplastic agents

Considering the observed induction of IL-2R{alpha} and IL-2R{beta} mRNA, we evaluated the effect of IL-2-targeted therapy in combination with depsipeptide. DAB389IL-2 (denileukin diftitox) is a fusion protein that combines the active domains of diphtheria toxin with IL-2 and is currently used in the treatment of T-cell lymphomas. As shown in Figure 4, we observed a more than additive effect when the HUT78 cells were pretreated with depsipeptide for 48 hours followed by treatment with combined depsipeptide with DAB389IL-2 for an additional 72 hours. When HUT78 cells were treated with DAB389IL-2 alone, a 72% cell survival was observed. When cells were treated with 0.66 ng/mL of depsipeptide without the addition of DAB389IL-2, there was a 79% cell survival. In contrast, when the cells were treated with 0.66 ng/mL of depsipeptide for 2 days prior to the addition of DAB389IL-2, only 20% of the cells survived following the combined treatment.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 4.. Sensitization of HUT78 cells to DAB389IL-2 (denileukin diftitox) by depsipeptide. HUT78 cells were first exposed to depsipeptide or control treatment for 48 hours; denileukin diftitox (DAB389IL-2) was then added for 72 hours. Cytotoxicity assay was performed as described in "Materials and methods." Error bars indicate standard error of triplicates.

 

Drug resistance

In order to characterize potential mechanisms of resistance to depsipeptide in CTCL, we selected HUT78 cells for resistance to depsipeptide. Since depsipeptide induced the expression of MDR-1 in HUT78 cells and is transported by the MDR-1 gene product Pgp, we selected cells in the presence and absence of a Pgp inhibitor, verapamil. Cell lines were selected in a stepwise process for approximately 1 year and were maintained in 12 ng/mL depsipeptide. For these analyses, cells were cultured in the absence of drug for 2 weeks. In cell lines selected in depsipeptide alone (Dp cells), the observed IC50 was approximately 8 ng/mL for cells, representing a greater than 10-fold resistance to depsipeptide. These cells were sensitized to depsipeptide when treated with the Pgp inhibitor, valspodar (Figure 5A). The observed IC50 for the cells selected in the presence of verapamil (DpVp cells) exceeded 50 ng/mL. Combination with valspodar did not significantly increase sensitivity to depsipeptide. Expression of Pgp was evaluated by using an antibody, MRK-16, that detects Pgp on the cell surface by flow cytometry, and function of Pgp was evaluated by the efflux of rhodamine 123. No Pgp was detected in the parent cell line, consistent with the observation that valspodar did not increase sensitivity to depsipeptide by cytotoxicity assay. As expected, Dp cells selected for resistance to depsipeptide alone had significant levels of detectable Pgp and rhodamine 123 efflux. Cells selected for resistance to depsipeptide in the presence of verapamil had slight expression of Pgp and minimal rhodamine efflux, indicating that resistance is not mediated by Pgp. Increased histone acetylation was observed in both the Dp and DpVp cells following treatment with 25 and 100 ng/mL depsipeptide, respectively, suggesting that in both cell lines, any reduction in histone acetylation that might result from drug resistance mechanisms can be overcome by increased doses of depsipeptide.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 5.. Cytotoxicity assay, MRK-16 staining, rhodamine 123 efflux, and molecular response to depsipeptide of resistant HUT78 cells. HUT78 cells were selected for resistance to depsipeptide in the absence (HUT78Dp) or presence of 5 µg/mL of verapamil (HUT78DpVp). For these experiments, cells were first grown out of depsipeptide and verapamil for 2 weeks. (A) Cells were treated with depsipeptide for 3 days with or without 1 µg/mL of valspodar, an inhibitor of Pgp, and cytotoxicity assays were performed. Data are shown on a logarithmic scale. (B) The panels on the left show the results of cells stained with the Pgp-specific antibody, MRK-16 (dashed line), or with an isotype-specific antibody as a control (solid line). In the right panel, Pgp function was assayed by the ability of the cells to efflux rhodamine. Cells were first incubated with rhodamine 123 and then incubated for 1 hour in the absence of rhodamine, both steps in the absence (solid line) or presence (dashed line) of valspodar. (C) HUT78, HUT78Dp, and HUT78DpVp cells were treated overnight with the indicated amount of depsipeptide. Whole cell lysates were prepared, and 10 µg/mL of proteins were separated by PAGE. Immunoblots were performed using antibodies against acetylated histone H3, demonstrating histone deacetylase activity of the individual HDIs, and GAPDH, to confirm equivalent loading of proteins.

 


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
To extend the observed responses to depsipeptide in patients with T-cell lymphoma, we sought an in vitro model to examine the molecular effects of depsipeptide. HUT78, a T-cell lymphoma cell line derived from a patient with cutaneous T-cell lymphoma, responds to depsipeptide treatment with increased histone acetylation, induced p21 expression, and marked apoptosis without significant cell cycle arrest. These changes were found to be a general response of HUT78 cells to structurally distinct histone deacetylase inhibitors. Gene expression studies revealed increased expression of IL-2 receptor subunits and MDR-1, and we were able to exploit the induction of IL-2 receptor subunits to sensitize cells to denileukin diftitox.

While the precise regulators of growth arrest or apoptosis observed in cancer lines exposed to HDIs remain unclear, it has been demonstrated that growth arrest is the predominant effect in cell lines where HDIs induce the expression of p21.33 The HDIs have a direct effect, increasing p21 expression through its promoter region.34 Cell lines in which p21 expression is inhibited due to knock out or antisense expression do not undergo growth arrest; instead these p21-deficient cells preferentially undergo apoptosis.5,33,35-37 While the precise apoptotic pathway remains to be elucidated, the HUT78 T-cell lymphoma line appears to be different, since depsipeptide causes early apoptosis without significant cell cycle arrest despite p21 induction, indicating that the apoptotic effects of depsipeptide predominate. Of note, when apoptosis is inhibited with z-VAD-fmk, the cell cycle arrest effects of depsipeptide are observed. This has been described previously in other experimental models.38,39 The increase in the surviving population by 2- to 3-fold implicates one or more of the caspases in the apoptosis induced by depsipeptide. The residual 50% mortality in the depsipeptide-treated cells pretreated with z-VAD-fmk indicates that apoptosis was not completely blocked. We hypothesize that this occurs as a result of either the activation of caspases not inhibited by z-VAD-fmk or through the activation of non-caspase-mediated apoptotic pathways. Further studies will need to be performed to dissect the precise steps in the apoptotic pathway that are activated by depsipeptide. Induction of p21 by HDIs without concomitant cell cycle arrest was also previously observed in the A549 lung cancer cell line.40 Although induction of p21 was noted after treatment with trapoxin, no cell cycle arrest was observed, and marked apoptosis was noted.40 The results presented here are consistent with a previous study reporting that depsipeptide induced apoptosis in IL-2-dependent malignant T-cell lines.41

Two aspects of the development of depsipeptide for clinical use were evaluated in the laboratory studies presented here. First, seeking strategies for combination therapy, we evaluated the effect of depsipeptide on the expression of the IL-2 receptor. Denileukin diftitox has recently been shown to be effective in both cutaneous and peripheral T-cell lymphomas.15,42 Even though the HUT78 cells readily underwent apoptosis, at low concentrations of depsipeptide we found that there was some increase in expression of the IL-2 receptor subunits and increased sensitivity to denileukin diftitox. This may occur through increased activation of the same or of an alternate apoptotic pathway. Previously, a 6-fold-increased expression of IL-2R{alpha} and a 50%-increased expression of IL-2R{beta} were reported in HUT78 cells treated with retinoids.16

Beyond agents that target the IL-2 receptor, a rationale also exists for other combinations. Retinoids have demonstrated efficacy in T-cell lymphoma and the selective retinoid bexarotene is in clinical use for this indication.43-45 Furthermore, retinoids have demonstrated synergy with HDIs in neuroblastoma and colorectal carcinoma cell lines, suggesting that the combination of an HDI with a retinoid could be further evaluated for patients with T-cell lymphomas.46,47

The second aspect was to evaluate potential mechanisms of resistance. Limited evidence suggests that expression of Pgp plays a role in mediating resistance to chemotherapy in lymphomas.48 In addition, Pgp was detected by immunohistochemistry in 18 of 25 patients with advanced CTCL and some form of prior therapy.49 We have previously observed that depsipeptide is transported by Pgp and that cells that overexpress Pgp are resistant to depsipeptide.19 Furthermore, several HDIs have been shown to induce the expression of MDR-1.20,21 This appears to occur through HDI-sensitive elements in the promoter region.50 The studies presented here demonstrate that depsipeptide induces the expression of MDR-1, that cells selected for resistance to depsipeptide overexpress Pgp, and that this resistance is reversed with a Pgp inhibitor. Thus, depsipeptide has the ability to induce its own mechanism of resistance, a finding that could explain the eventual failure of depsipeptide following initial clinical activity. Of note, since the HDIs as a class increase the expression of Pgp, it may be difficult to combine the use of these agents with drugs that are transported by Pgp, such as doxorubicin or etoposide.

In contrast, cells selected for resistance to depsipeptide in the presence of a Pgp inhibitor did not significantly increase Pgp expression and were not sensitized by inhibitors of Pgp. Therefore, these cells appear to have an alternate mechanism of resistance. Molecular mechanisms of resistance to HDIs have not, as yet, been elucidated. Previously, 2 models of resistance to sodium butyrate were described. In one model, K562 erythroleukemic cells were first exposed to mutagens and then selected for resistance to sodium butyrate. Upon treatment with sodium butyrate, the resistant cells had lower levels of histone acetylation, less growth inhibitory effects, and less induction of cellular hemoglobin.51 More recently, HeLa cells selected for resistance to sodium butyrate were found to have an increased basal level of p21 expression. In the resistant cells, sodium butyrate did not down-regulate cyclin D1 levels, as observed in the parent cell line.52 Cells resistant to the hydroxamic acid, TSA, were also selected by first treating mouse mammary tumor cells with mutagens.53 Exposure to higher levels of TSA did not increase histone acetylation. Evaluation of histone deacetylase enzymatic activity in total nuclear extracts found that while the measured Km was the same as the parent cells, the Ki of TSA was 9-fold higher in the resistant cells. Our DpVp-selected cell line had increased histone acetylation following exposure to increased concentrations of depsipeptide, suggesting that the resistance mechanism is downstream of this immediate molecular target.

Depsipeptide has shown single-agent activity in early clinical trials in malignancies of T-lymphocyte origin. In nonmalignant T lymphocytes, sodium butyrate, TSA, and depsipeptide have been shown to inhibit antigen-induced T-cell stimulation.54-56 Apart from its activity in nonmalignant T cells, why would depsipeptide have such potent activity in patients with T-cell lymphoma? One answer may lie in our current understanding that CTCL develops from a clone of T cells in a hyperproliferative state, failing to trigger an impaired apoptotic pathway.57 Recent studies have demonstrated that fas-mediated apoptosis in T cells requires an induction of p21.58 Furthermore, HDIs have been shown to increase the expression of both fas receptor and fas ligand.59,60 Thus, depsipeptide and other HDIs may exert profound effects on T-cell malignancies by directly activating the T-cell apoptotic pathway by increasing expression of the fas receptor or its ligand or by activating a downstream activator of apoptosis, such as the increased expression of p21. Of note, a novel splice variant of the fas receptor, associated with decreased surface membrane expression, has recently been identified in a number of patients with CTCL.61 If depsipeptide exerts its effect by acting directly on the expression of fas receptor and ligand, this mutation may explain why some patients do not respond to therapy. Alternatively, observed responses may be understood if depsipeptide exerts its effect downstream of the fas receptor. This will require further analysis.

In conclusion, these studies demonstrate that response to depsipeptide in the HUT78 human T-cell lymphoma cell line is associated with an induction of histone acetylation, p21 expression, and detection of markers of apoptosis. This cell line is also sensitive to other HDIs, suggesting that several members of this new class of anticancer agents are likely to have clinical efficacy in T-cell lymphoma. In addition, treatment with depsipeptide increased the sensitivity of this cell line to denileukin diftitox. As denileukin diftitox is currently in clinical use for cutaneous T-cell lymphoma, these results suggest a strategy for combination therapy in this disease. Furthermore, depsipeptide increased the expression of the MDR-1 gene, and cells selected for resistance overexpressed Pgp. Of note, this resistance was reversed with a Pgp inhibitor. A non-Pgp mechanism of resistance has developed in the cells selected in the presence of a Pgp inhibitor, although the precise nature of this resistance remains to be determined. Taken together, these results support the therapeutic activity of the histone deacetylase inhibitors, such as depsipeptide in cutaneous T-cell lymphoma, and suggest that the induction of molecular targets by depsipeptide may allow the design of rational combination therapies.


    Acknowledgements
 
We would like to thank John Wright and Naoki Sogo for their support of our studies with depsipeptide in T-cell lymphoma.


    Footnotes
 
Submitted September 5, 2003; accepted February 8, 2004.

Prepublished online as Blood First Edition Paper, March 2, 2004; DOI 10.1182/blood-2003-09-3068.

Supported in part by research funding from Fujisawa Pharmaceutical Co, Osaka, Japan.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Richard Piekarz, 10 Center Dr, MSC 1903, Bldg 10, Rm 12C103, Bethesda, MD 20892-1903; e-mail: rpiekarz{at}nih.gov.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Marks PA, Rifkind RA, Richon VM, Breslow R, Miller T, Kelly WK. Histone deacetylases and cancer: causes and therapies. Nat Rev Cancer. 2001;1: 194-202.[CrossRef][Medline] [Order article via Infotrieve]

  2. Marks PA, Richon VM, Rifkind RA. Histone deacetylase inhibitors: inducers of differentiation or apoptosis of transformed cells. J Natl Cancer Inst. 2000;92: 1210-1216.[Abstract/Free Full Text]

  3. Ueda H, Manda T, Matsumoto S, et al. FR901228, a novel antitumor bicyclic depsipeptide produced by chromobacterium violaceum no. 968, III: antitumor activities on experimental tumors in mice. J Antibiot (Tokyo). 1994;47: 315-323.[Medline] [Order article via Infotrieve]

  4. Nakajima H, Kim YB, Terano H, Yoshida M, Horinouchi S. FR901228, a potent antitumor antibiotic, is a novel histone deacetylase inhibitor. Exp Cell Res. 1998;241: 126-133.[CrossRef][Medline] [Order article via Infotrieve]

  5. Sandor V, Robbins AR, Robey R, et al. FR901228 causes mitotic arrest but does not alter microtubule polymerization. Anticancer Drugs. 2000;11: 445-454.[CrossRef][Medline] [Order article via Infotrieve]

  6. Sandor V, Senderowicz A, Mertins S, et al. P21-dependent G(1) arrest with downregulation of cyclin D1 and upregulation of cyclin E by the histone deacetylase inhibitor FR901228. Br J Cancer. 2000;83: 817-825.[CrossRef][Medline] [Order article via Infotrieve]

  7. Sandor V, Bakke S, Robey RW, et al. Phase I trial of the histone deacetylase inhibitor, depsipeptide (FR901228, NSC 630176), in patients with refractory neoplasms. Clin Cancer Res. 2002;8: 718-728.[Abstract/Free Full Text]

  8. Piekarz RL, Robey R, Sandor V, et al. Inhibitor of histone deacetylation, depsipeptide (FR901228), in the treatment of peripheral and cutaneous T-cell lymphoma: a case report. Blood. 2001;98: 2865-2868.[Abstract/Free Full Text]

  9. Waldmann TA. The structure, function, and expression of interleukin-2 receptors on normal and malignant lymphocytes. Science. 1986;232: 727-732.[Abstract/Free Full Text]

  10. Rosolen A, Nakanishi M, Poplack DG, et al. Expression of interleukin-2 receptor beta-subunit in hematopoietic malignancies. Blood. 1989;73: 1968-1972.[Abstract/Free Full Text]

  11. Nakamura Y, Russell SM, Mess SA, et al. Heterodimerization of the IL-2 receptor beta-chain and gamma-chain cytoplasmic domains is required for signaling. Nature. 1994;369: 330-333.[CrossRef][Medline] [Order article via Infotrieve]

  12. Nelson BH, Lord JD, Greenberg PD. Cytoplasmic domains of the interleukin-2 receptor beta-chain and gamma-chain mediate the signal for T-cell proliferation. Nature. 1994;369: 333-336.[CrossRef][Medline] [Order article via Infotrieve]

  13. Wang HM, Smith KA. The interleukin-2 receptor: functional consequences of its bimolecular structure. J Exp Med. 1987;166: 1055-1069.[Abstract/Free Full Text]

  14. Bernstein ZP, Miller K, Barcos MP. Complete clinical resolution of peripheral T-cell lymphoma (lennert's variant) with denileukin diftitox (ontak (r)). Blood. 2001;98: 238b. Abstract 4678.

  15. Olsen E, Duvic M, Frankel A, et al. Pivotal phase III trial of two dose levels of denileukin diftitox for the treatment of cutaneous T-cell lymphoma. J Clin Oncol. 2001;19: 376-388.[Abstract/Free Full Text]

  16. Sidell N, Kummer U, Aframian D, Thierfelder S. Retinoid regulation of interleukin-2 receptors on human T-cells. Cell Immunol. 1997;179: 116-125.[CrossRef][Medline] [Order article via Infotrieve]

  17. Shao RH, Tian XJ, Gorgon G, Urbano AG, Foss FM. Arginine butyrate increases the cytotoxicity of dab(389)IL-2 in leukemia and lymphoma cells by upregulation of IL-2R beta gene. Leuk Res. 2002;26: 1077-1083.[CrossRef][Medline] [Order article via Infotrieve]

  18. Gorgun G, Foss F. Immunomodulatory effects of rxr rexinoids: modulation of high-affinity IL-2r expression enhances susceptibility to denileukin diftitox. Blood. 2002;100: 1399-1403.[Abstract/Free Full Text]

  19. Lee JS, Paull K, Alvarez M, et al. Rhodamine efflux patterns predict P-glycoprotein substrates in the National Cancer Institute drug screen. Mol Pharmacol. 1994;46: 627-638.[Abstract]

  20. Mickley LA, Bates SE, Richert ND, et al. Modulation of the expression of a multidrug resistance gene (MDR-1/P-glycoprotein) by differentiating agents. J Biol Chem. 1989;264: 18031-18040.[Abstract/Free Full Text]

  21. Bates SE, Mickley LA, Chen YN, et al. Expression of a drug resistance gene in human neuroblastoma cell lines: modulation by retinoic acid-induced differentiation. Mol Cell Biol. 1989;9: 4337-4344.[Abstract/Free Full Text]

  22. Jin SK, Scotto KW. Transcriptional regulation of the MDR1 gene by histone acetyltransferase and deacetylase is mediated by NF-Y. Mol Cell Biol. 1998;18: 4377-4384.[Abstract/Free Full Text]

  23. Chen YN, Mickley LA, Schwartz AM, Acton EM, Hwang J, Fojo AT. Characterization of adriamycin-resistant human breast-cancer cells which display overexpression of a novel resistance-related membrane-protein. J Biol Chem. 1990;265: 10073-10080.[Abstract/Free Full Text]

  24. Jaffrezou JP, Dumontet C, Derry WB, et al. Novel mechanism of resistance to paclitaxel (taxol(r)) in human K562 leukemia cells by combined selection with PSC 833. Oncol Res. 1995;7: 517-527.[Medline] [Order article via Infotrieve]

  25. Beketicoreskovic L, Duran GE, Chen G, Dumontet C, Sikic BI. Decreased mutation-rate for cellular-resistance to doxorubicin and suppression of MDR1 gene activation by the cyclosporine psc-833. J Natl Cancer Inst. 1995;87: 1593-1602.[Abstract/Free Full Text]

  26. Futscher BW, Foley NE, GleasonGuzman MC, Meltzer PS, Sullivan DM, Dalton WS. Verapamil suppresses the emergence of P-glycoprotein-mediated multi-drug resistance. Int J Cancer. 1996;66: 520-525.[CrossRef][Medline] [Order article via Infotrieve]

  27. Robey R, Bakke S, Stein W, et al. Efflux of rhodamine from CD56+ cells as a surrogate marker for reversal of P-glycoprotein-mediated drug efflux by PSC 833. Blood. 1999;93: 306-314.[Abstract/Free Full Text]

  28. Murphy LD, Herzog CE, Rudick JB, Fojo AT, Bates SE. Use of the polymerase chain reaction in the quantitation of MDR-1 gene expression. Biochemistry. 1990;29: 10351-10356.[CrossRef][Medline] [Order article via Infotrieve]

  29. Lee BN, Lu JG, Shen DY, Li S, Shearer WT, Reuben JM. Quantification of IL-2 and IL-2 receptor mRNA in peripheral blood mononuclear cells by the RT-PCR based sharp signal system. Cytokines Cell Mol Ther. 1997;3: 33-40.[Medline] [Order article via Infotrieve]

  30. Naito E, Dewa K, Ymanouchi H, Kominami R. Ribosomal ribonucleic-acid (ribosomal-RNA) gene typing for species identification. J Forensic Sci. 1992;37: 396-403.[Medline] [Order article via Infotrieve]

  31. Bunn PA Jr, Foss FM. T-cell lymphoma cell lines (hut102 and hut78) established at the National Cancer Institute: history and importance to understanding the biology, clinical features, and therapy of cutaneous T-cell lymphomas (ctcl) and adult T-cell leukemia-lymphomas (ATLL). J Cell Biochem Suppl. 1996;24: 12-23.[Medline] [Order article via Infotrieve]

  32. VanLint C, Emiliani S, Verdin E. The expression of a small fraction of cellular genes is changed in response to histone hyperacetylation. Gene Expr. 1996;5: 245-253.[Medline] [Order article via Infotrieve]

  33. Archer SY, Meng SF, Shei A, Hodin RA. P21(waf1) is required for butyrate-mediated growth inhibition of human colon cancer cells. Proc Natl Acad Sci U S A. 1998;95: 6791-6796.[Abstract/Free Full Text]

  34. Sowa Y, Orita T, Hiranabe-Minamikawa S, et al. Histone deacetylase inhibitor activates the p21/waf1/cip1 gene promoter through the sp1 sites. Ann N Y Acad Sci. 1999;886: 195-199.[CrossRef][Medline] [Order article via Infotrieve]

  35. Burgess AJ, Pavey S, Warrener R, et al. Up-regulation of p21(waf1)/(cip1) by histone deacetylase inhibitors reduces their cytotoxicity. Mol Pharmacol. 2001;60: 828-837.[Abstract/Free Full Text]

  36. Qiu L, Burgess A, Fairlie DP, Leonard H, Parsons PG, Gabrielli BG. Histone deacetylase inhibitors trigger a G2 checkpoint in normal cells that is defective in tumor cells. Mol Biol Cell. 2000;11: 2069-2083.[Abstract/Free Full Text]

  37. Vrana JA, Decker RH, Johnson CR, et al. Induction of apoptosis in U937 human leukemia cells by suberoylanilide hydroxamic acid (SAHA) proceeds through pathways that are regulated by bcl-2/bcl-x-l, c-jun, and p21(cip1), but independent of p53. Oncogene. 1999;18: 7016-7025.[CrossRef][Medline] [Order article via Infotrieve]

  38. Amin HM, Saeed S, Alkan S. Histone deacetylase inhibitors induce caspase-dependent apoptosis and downregulation of daxx in acute promyelocytic leukaemia with t(15;17). Br J Haematol. 2001;115: 287-297.[CrossRef][Medline] [Order article via Infotrieve]

  39. Bernhard D, Ausserlechner MJ, Tonko M, et al. Apoptosis induced by the histone deacetylase inhibitor sodium butyrate in human leukemic lymphoblasts. FASEB J. 1999;13: 1991-2001.[Abstract/Free Full Text]

  40. Sambucetti LC, Fischer DD, Zabludoff S, et al. Histone deacetylase inhibition selectively alters the activity and expression of cell cycle proteins leading to specific chromatin acetylation and anti-proliferative effects. J Biol Chem. 1999;274: 34940-34947.[Abstract/Free Full Text]

  41. Koyama Y, Adachi M, Sekiya M, Takekawa M, Imai K. Histone deacetylase inhibitors suppress IL-2-mediated gene expression prior to induction of apoptosis. Blood. 2000;96: 1490-1495.[Abstract/Free Full Text]

  42. Talpur R, Apisarnthanarax N, Ward S, Duvic M. Treatment of refractory peripheral T-cell lymphoma with denileukin diftitox (ontak (r)). Leuk Lymphoma. 2002;43: 121-126.[CrossRef][Medline] [Order article via Infotrieve]

  43. Claudy AL, Delomier Y, Hermier C. Treatment of cutaneous T-cell lymphoma with a new aromatic retinoid (ro 10-9359). Arch Dermatol Res. 1982;273: 37-42.[CrossRef][Medline] [Order article via Infotrieve]

  44. Kessler JF, Levine N, Meyskens FL, Lynch PJ, Jones SE. Treatment of cutaneous T-cell lymphoma (mycosis-fungoides) with 13-cis-retinoic acid. Lancet. 1983;1: 1345-1347.[Medline] [Order article via Infotrieve]

  45. Duvic M, Martin AG, Kim Y, et al. Phase 2 and 3 clinical trial of oral bexarotene (targretin capsules) for the treatment of refractory or persistent early-stage cutaneous T-cell lymphoma. Arch Dermatol. 2001;137: 581-593.[Abstract/Free Full Text]

  46. Cameron EE, Bachman KE, Myohanen S, Herman JG, Baylin SB. Synergy of demethylation and histone deacetylase inhibition in the re-expression of genes silenced in cancer. Nat Genet. 1999;21: 103-107.[CrossRef][Medline] [Order article via Infotrieve]

  47. Coffey DC, Kutko MC, Glick RD, et al. The histone deacetylase inhibitor, cbha, inhibits growth of human neuroblastoma xenografts in vivo, alone and synergistically with all-trans retinoic acid. Cancer Res. 2001;61: 3591-3594.[Abstract/Free Full Text]

  48. Sandor V, Wilson W, Fojo T, Bates SE. The role of MDR-1 in refractory lymphoma. Leuk Lymphoma. 1997;28: 23-31.[Medline] [Order article via Infotrieve]

  49. Jillella AP, Murren JR, Hamid KK, Longley BJ, Edelson RL, Cooper DL. P-glycoprotein expression and multidrug resistance in cutaneous T-cell lymphoma. Cancer Invest. 2000;18: 609-613.[Medline] [Order article via Infotrieve]

  50. Scotto KW, Egan DA. Transcriptional regulation of MDR genes. Cytotechnology. 1998;27: 257-269.[CrossRef]

  51. Ohlssonwilhelm BM, Farley BA, Kosciolek B, Labella S, Rowley PT. K562 human erythroleukemia cell variants resistant to growth-inhibition by butyrate have deficient histone acetylation. Am J Hum Genet. 1984;36: 1225-1238.[Medline] [Order article via Infotrieve]

  52. Derjuga A, Richard C, Crosato M, et al. Expression of p21(waf1/cip1) and cyclin d1 is increased in butyrate-resistant hela cells. J Biol Chem. 2001;276: 37815-37820.[Abstract/Free Full Text]

  53. Yoshida M, Kijima M, Akita M, Beppu T. Potent and specific inhibition of mammalian histone deacetylase both in vivo and in vitro by trichostatin A. J Biol Chem. 1990;265: 17174-17179.[Abstract/Free Full Text]

  54. Gilbert KM, Weigle WO. Th1 cell anergy and blockade in G(1a) phase of the cell-cycle. J Immunol. 1993;151: 1245-1254.[Abstract]

  55. Bohmig GA, Krieger PM, Saemann MD, Wenhardt C, Pohanka E, Zlabinger GJ. N-butyrate downregulates the stimulatory function of peripheral blood-derived antigen-presenting cells: a potential mechanism for modulating T-cell responses by short-chain fatty acids. Immunology. 1997;92: 234-243.[CrossRef][Medline] [Order article via Infotrieve]

  56. Skov S, Rieneck K, Bovin LF, et al. Histone deacetylase inhibitors: a new class of immunosuppressors targeting a novel signal pathway essential for CD154 expression. Blood. 2003;101: 1430-1438.[Abstract/Free Full Text]

  57. Meech SJ, Edelson R, Walsh P, Norris DA, Duke RC. Reversible resistance to apoptosis in cutaneous T cell lymphoma. Ann N Y Acad Sci. 2001;941: 46-58.[Medline] [Order article via Infotrieve]

  58. Hingorani R, Bi BY, Dao T, Bae Y, Matsuzawa A, Crispe IN. CD95/fas signaling in T lymphocytes induces the cell cycle control protein p21(cip-1/waf-1), which promotes apoptosis. J Immunol. 2000;164: 4032-4036.[Abstract/Free Full Text]

  59. Glick RD, Medary I, Aronson DC, Scotto KW, Swendeman SL, La Quaglia MP. The effects of serum depletion and dexamethasone on growth and differentiation of human neuroblastoma cell lines. J Pediatr Surg. 2000;35: 465-472.[CrossRef][Medline] [Order article via Infotrieve]

  60. Klisovic DD, Katz SE, Effron D, et al. Depsipeptide (FR901228) inhibits proliferation and induces apoptosis in primary and metastatic human uveal melanoma cell lines. Invest Ophthalmol Vis Sci. 2003;44: 2390-2398.[Abstract/Free Full Text]

  61. van Doorn R, Dijkman R, Vermeer MH, Starink TM, Willemze R, Tensen CP. A novel splice variant of the fas gene in patients with cutaneous T-cell lymphoma. Cancer Res. 2002;62: 5389-5392.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Pharmacol. Exp. Ther.Home page
H. Matsubara, M. Watanabe, T. Imai, Y. Yui, Y. Mizushima, Y. Hiraumi, Y. Kamitsuji, K.-i. Watanabe, K. Nishijo, J. Toguchida, et al.
Involvement of Extracellular Signal-Regulated Kinase Activation in Human Osteosarcoma Cell Resistance to the Histone Deacetylase Inhibitor FK228 [(1S,4S,7Z,10S,16E,21R)-7-Ethylidene-4,21-bis(propan-2-yl)-2-oxa-12,13-dithia-5,8,20,23-tetraazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone]
J. Pharmacol. Exp. Ther., March 1, 2009; 328(3): 839 - 848.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Chen, M. Zhang, W. Ju, and T. A. Waldmann
Effective treatment of a murine model of adult T-cell leukemia using depsipeptide and its combination with unmodified daclizumab directed toward CD25
Blood, February 5, 2009; 113(6): 1287 - 1293.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
K. K.W. To, O. Polgar, L. M. Huff, K. Morisaki, and S. E. Bates
Histone Modifications at the ABCG2 Promoter following Treatment with Histone Deacetylase Inhibitor Mirror Those in Multidrug-Resistant Cells
Mol. Cancer Res., January 1, 2008; 6(1): 151 - 164.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. Brest, M. Gustafsson, A.-K. Mossberg, L. Gustafsson, C. Duringer, A. Hamiche, and C. Svanborg
Histone Deacetylase Inhibitors Promote the Tumoricidal Effect of HAMLET
Cancer Res., December 1, 2007; 67(23): 11327 - 11334.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
B. S. Mann, J. R. Johnson, M. H. Cohen, R. Justice, and R. Pazdur
FDA Approval Summary: Vorinostat for Treatment of Advanced Primary Cutaneous T-Cell Lymphoma
Oncologist, October 1, 2007; 12(10): 1247 - 1252.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
J Rodriguez, E Conde, A Gutierrez, R Arranz, A Leon, J Marin, M Bendandi, C Albo, M. Caballero, and On behalf of the Grupo Espanol de Linfomas/Traspla
The results of consolidation with autologous stem-cell transplantation in patients with peripheral T-cell lymphoma (PTCL) in first complete remission: the Spanish Lymphoma and Autologous Transplantation Group experience
Ann. Onc., April 1, 2007; 18(4): 652 - 657.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. P. Perrine, O. Hermine, T. Small, F. Suarez, R. O'Reilly, F. Boulad, J. Fingeroth, M. Askin, A. Levy, S. J. Mentzer, et al.
A phase 1/2 trial of arginine butyrate and ganciclovir in patients with Epstein-Barr virus-associated lymphoid malignancies
Blood, March 15, 2007; 109(6): 2571 - 2578.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. Sanchez-Gonzalez, H. Yang, C. Bueso-Ramos, K. Hoshino, A. Quintas-Cardama, V. M. Richon, and G. Garcia-Manero
Antileukemia activity of the combination of an anthracycline with a histone deacetylase inhibitor
Blood, August 15, 2006; 108(4): 1174 - 1182.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. L. Piekarz, A. R. Frye, J. J. Wright, S. M. Steinberg, D. J. Liewehr, D. R. Rosing, V. Sachdev, T. Fojo, and S. E. Bates
Cardiac Studies in Patients Treated with Depsipeptide, FK228, in a Phase II Trial for T-Cell Lymphoma.
Clin. Cancer Res., June 15, 2006; 12(12): 3762 - 3773.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. W. Robey, Z. Zhan, R. L. Piekarz, G. L. Kayastha, T. Fojo, and S. E. Bates
Increased MDR1 Expression in Normal and Malignant Peripheral Blood Mononuclear Cells Obtained from Patients Receiving Depsipeptide (FR901228, FK228, NSC630176)
Clin. Cancer Res., March 1, 2006; 12(5): 1547 - 1555.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. Graham, C. Tucker, J. Creech, E. Favours, C. A. Billups, T. Liu, M. Fouladi, B. B. Freeman III, C. F. Stewart, and P. J. Houghton
Evaluation of the Antitumor Efficacy, Pharmacokinetics, and Pharmacodynamics of the Histone Deacetylase Inhibitor Depsipeptide in Childhood Cancer Models In vivo
Clin. Cancer Res., January 1, 2006; 12(1): 223 - 234.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
J. P. Greer
Therapy of Peripheral T/NK Neoplasms
Hematology, January 1, 2006; 2006(1): 331 - 337.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. C. Byrd, G. Marcucci, M. R. Parthun, J. J. Xiao, R. B. Klisovic, M. Moran, T. S. Lin, S. Liu, A. R. Sklenar, M. E. Davis, et al.
A phase 1 and pharmacodynamic study of depsipeptide (FK228) in chronic lymphocytic leukemia and acute myeloid leukemia
Blood, February 1, 2005; 105(3): 959 - 967.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-09-3068v1
103/12/4636    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Piekarz, R. L.
Right arrow Articles by Bates, S. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Piekarz, R. L.
Right arrow Articles by Bates, S. E.
Related Collections
Right arrow Neoplasia
Right arrow Apoptosis
Right arrow Cell Cycle
Right arrow Gene Expression
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2004 by American Society of Hematology         Online ISSN: 1528-0020