Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 15 January 2004, Vol. 103, No. 2, pp. 630-638.
Prepublished online as a Blood First Edition Paper on August 28, 2003; DOI 10.1182/blood-2003-03-0824.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-03-0824v1
103/2/630    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kondo, E.
Right arrow Articles by Takahashi, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kondo, E.
Right arrow Articles by Takahashi, T.
Related Collections
Right arrow Immunobiology
Right arrow Transplantation
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

IMMUNOBIOLOGY

Identification of novel CTL epitopes of CMV-pp65 presented by a variety of HLA alleles

Eisei Kondo, Yoshiki Akatsuka, Kiyotaka Kuzushima, Kunio Tsujimura, Shoji Asakura, Kohei Tajima, Yoshitoyo Kagami, Yoshihisa Kodera, Mitsune Tanimoto, Yasuo Morishima, and Toshitada Takahashi

From the Division of Immunology, Aichi Cancer Center Research Institute, Nagoya, Japan; Department of Hematology and Chemotherapy, Aichi Cancer Center Hospital, Nagoya, Japan; Department of Hematology, Japanese Red Cross Nagoya First Hospital, Nagoya, Japan; and Department of Internal Medicine II, Okayama University Graduate School of Medicine and Dentistry, Okayama, Japan.


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Cytomegalovirus (CMV)–specific T-cell immunity plays an important role in protection from CMV disease in immunocompromised patients. Identification of cytotoxic T-lymphocyte (CTL) epitopes is essential for monitoring T-cell immunity and also for immunotherapy. In this and previous studies, CMV-pp65–specific CTL lines were successfully generated from all of 11 CMV-seropositive healthy donors, using pp65-transduced CD40-activated B (CD40-B) cells as antigen-presenting cells. By use of enzyme-linked immunospot (ELISPOT) assays, individual CTL epitopes could be mapped with truncated forms of the pp65 gene. For human leukocyte antigen (HLA) alleles with a known binding motif, CTL epitopes within the defined regions were predicted by computer algorithm. For HLA alleles without a known binding motif (HLA-Cw*0801, -Cw*1202, and -Cw*1502), the epitopes were alternatively identified by step-by-step truncations of the pp65 gene. Through this study, a total of 14 novel CTL epitopes of CMV-pp65 were identified. Interestingly, 3 peptides were found to be presented by 2 different HLA class I alleles or subtypes. Moreover, use of CD40-B cells pulsed with a mixture of synthetic peptides led to generation of pp65-specific CTL lines from some of seronegative donors. The study thus demonstrated an efficient strategy for identifying CTL epitopes presented by a variety of HLA alleles.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Late-onset cytomegalovirus (CMV) disease in hematopoietic stem cell transplant recipients (later than day 100 after transplantation) remains a major cause of morbidity and mortality, despite the introduction of new antiviral agents; indeed, recent reports have rather indicated an increase in disease.1-5 Absence of reconstitution of CMV-specific T-cell response at 3 to 4 months after transplantation or the use of immunosuppressive drugs is strongly associated with reactivation of CMV and the subsequent CMV disease.2-9 Immunologic treatments, such as adoptive transfer of CMV-specific cytotoxic T-lymphocyte (CTL) clones6,10 or CMV-specific T-cell lines,11 have successfully protected patients at risk from CMV disease, indicating that T-cell immunity plays an important role in controlling CMV infection. Thus, immunologic monitoring of T-cell immunity against CMV is crucial to evaluate the status of immunocompromised patients.

Identification of the CTL epitopes derived from CMV is very valuable not only for monitoring antiviral immunity but also for ex vivo generation of antiviral CTLs for possible application in adoptive immunotherapy. Immunodominance of pp65 protein among CMV antigens has been reported,12-14 but previously identified CTL epitopes derived from the pp65 protein were limited to frequent human leukocyte antigen (HLA) class I alleles. Moreover, the pp65 CTL epitope presented by HLA-A*2402, which is the most frequent allele in Japanese individuals, may not be immunodominant because the percentage of CD8+ T cells detectable with the HLA-A*2402/pp65 tetramer in healthy seropositive individuals is relatively low (A*2402, 0.1%15; versus A*0201, 0.75%; and B*0702, 1.85%16), whereas A*0201- or B*0702-restricted pp65 epitopes are considered immunodominant in white individuals. Therefore, additional pp65 epitopes of clinical significance need to be identified.

We previously reported an efficient strategy for in vitro CTL generation starting with as little as 10 mL of blood.17 By use of retroviral transduced CD40-activated B (CD40-B) cells as antigen-presenting cells (APCs), pp65-specific CTL lines could be generated from all of 4 CMV-seropositive healthy donors and found to be restricted by multiple HLA class I alleles, suggesting utility for epitope identification. In the present study, using a total of 11 pp65-specific CTL lines, including 7 newly generated ones, we attempted to identify novel CTL epitopes by enzyme-linked immunospot (ELISPOT) assay using stimulator cells transfected with truncated forms of the pp65 gene or linear expression fragments encoding various regions of the gene, with or without the help of computer algorithm–based epitope prediction. This approach was sufficiently sensitive to identify even the subdominant epitopes recognized by the CTL lines. Through this study, a total of 14 novel CTL epitopes were identified. Immunogenicity of a part of the newly identified epitopes was validated by successful generation of pp65-specific CTL lines from CMV-seropositive and also from some CMV-seronegative donors.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Donors and cells

Peripheral blood samples were obtained from 11 CMV-seropositive and 8 CMV-seronegative healthy donors after we obtained informed consent. The study was approved by the institutional review board of the Aichi Cancer Center. Informed consent was provided according to the Declaration of Helsinki. CMV seropositivity was analyzed with regard to the presence of CMV-specific immunoglobulin G (IgG) using an enzyme-linked immunosorbent assay, and HLA typing was carried out at The HLA Laboratory (Kyoto, Japan; Table 1). Peripheral blood mononuclear cells (PBMCs) were isolated from peripheral blood by centrifugation on a Ficoll (Amersham Biosciences, Uppsala, Sweden) density gradient, and CD8+ and CD8 fractions were separated using CD8 MicroBeads (Miltenyi Biotec, Bergisch Gladbach, Germany) and cryopreserved until use.


View this table:
[in this window]
[in a new window]
 
Table 1.. Characteristics of HLA class I and CMV serostatus of donors

 

Plasmids and synthetic peptides

Plasmids, pcDNA3-pp65, pcDNA3–enhanced green fluorescent protein (EGFP), and pcDNA3.1 (Invitrogen, Tokyo, Japan) encoding HLA class I cDNA were constructed as previously described.17,18 To generate pEAK10-pp65, a portion of pp65 DNA was transferred from pcDNA3-pp65 into the pEAK10 vector (Edge Biosystems, Gaithersburg, MD). A plasmid containing a mutant pp65 gene defective for the immunodominant HLA-A*0201–restricted epitope (NLVPMVATV to NLVPMVAAATV) was constructed by polymerase chain reaction (PCR)–based mutagenesis using the following primers: sense, ATGGTGGCTGCAGCTACGGTTCAGGGTCAG; antisense, AACCGTAGCTGCAGCCACCATGGGCACCAG (the inserted nucleotides are underlined). This plasmid was termed pcDNA3-pp65{Delta}NLV. All peptides were purchased from Toray Research Center (Tokyo, Japan).

Generation of CD40-activated B cells and EBV-transformed lymphoblastic cell lines (LCLs)

CD40-B cells were generated as previously described.17,19 In brief, a thawed CD8 fraction of PBMCs was cultured on a {gamma}-irradiated (96 Gy) human CD40L-transfected NIH3T3 cell line20 (t-CD40L; kindly provided by Dr Gordon Freeman, Dana-Farber Cancer Institute, Boston, MA) in the presence of interleukin 4 (IL-4; 4 ng/mL, Ono Pharmaceutical, Osaka, Japan) and cyclosporin A (CsA; 0.7 µg/mL, Sandoz, Basel, Switzerland) in 2 mL of Iscove modified Dulbecco medium (Invitrogen) supplemented with 10% pooled human serum. The expanding cells were transferred onto freshly prepared t-CD40L cells and fed with cytokine-replenished medium without CsA every 3 to 4 days. LCLs were established from the CD40-B cells with supernatant of an Epstein-Barr virus (EBV)–producing cell line (B95-8; American Type Culture Collection, Manassas, VA) in RPMI 1640 (Invitrogen) supplemented with 10% fetal calf serum (FCS; IBL, Takasaki, Japan), referred to as "complete medium."

Retroviral transduction of CD40-B cells and LCLs

Retroviral transduction was conducted as previously described.17 In brief, the retroviral construct, LZRSpBMN/pp65 (the backbone plasmid, LZRSpBMN-Z was kindly provided by Dr G. Nolan, Stanford University, Stanford, CA), pLBPC/pp65, or pLBPC/EGFP, was packaged in the Phoenix gibbon ape leukemia virus (GALV) cell line21 (a gift from H.-P. Kiem, Fred Hutchinson Cancer Research Center; and from G. Nolan, Stanford University, Stanford, CA) using FuGENE 6 (Roche Diagnostics, Mannheim, Germany). CD40-B cells and LCLs were infected with the retroviral supernatant in the presence of 10 µg/mL polybrene (Sigma, Chicago, IL), spun at 1000g for 1 hour at 32°C, and incubated. Two days after, LCLs transduced with pp65 (LCL/pp65) or EGFP (LCL/EGFP) were selected in the presence of puromycin (0.7 µg/mL; Edge Biosystems). Transduction efficiency were assessed as previously described.17

Generation of pp65-specific CTL lines using retrovirally transduced CD40-B cells

Thawed CD8+ cells (1 x 106) were cocultured with {gamma}-irradiated (33 Gy) autologous pp65-transduced CD40-B (CD40-B/pp65) cells (1 x 106) in 2 mL RPMI 1640 supplemented with 10% pooled human serum and recombinant human IL-7 (50 U/mL; Genzyme, Cambridge, MA) at 37°Cin 5% CO2. On days 7 and 14, CD8+ cells were restimulated and one day after each stimulation recombinant human IL-2 (Chiron, Emeryville, CA) was added to the cultures at the final concentration of 20 U/mL. If necessary, rapidly growing cells were split into 2 to 3 wells and fed with fresh media containing 20 U/mL IL-2. Peptide-pulsed CD40-B cells were also prepared by incubation with 10 µM peptides derived from pp65 and used as APCs. For generation of CTL lines from seronegative donors, IL-12 (5 ng/mL; R&D systems, Minneapolis, MN) was added on day 0.

Construction of deletion mutants

To construct deletion mutants of the pp65 gene, the plasmid, pcDNA3-pp65, was opened with ApaI and BamHI, and progressive 3' deletions were produced by exonuclease III treatment using the Erase-a-Base System (Promega, Madison, WI). After ligation each clone was sequenced. A total of 22 clones were selected and termed "{Delta}pp65(1-XXX)"; XXX indicates the amino acid position of the C-terminus of each clone.

Epitope selection and construction of linear expression fragments

The epitopes within the defined regions of the pp65 protein from human CMV strain AD169 were predicted by "HLA Peptide Binding Predictions" on the BioInformatics & Molecular Analysis Section (BIMAS) website22,23 and also by "HLA Epitope binding prediction" (beta testing version) in the HLA Ligand/Motif Database.24

Linear expression fragments encoding various regions of the pp65 gene were constructed by 2-step overlapping PCR. Targeted region-specific 5' and 3' primers incorporating additional sequences (single- and double-underlined, see below) were designed (eg, 5'primer, TCGGATCCACCATGCAGTACGATCCCGTGG [30 bp] and 3' primer, GACTCGAGCGCTAGAAGAGCGCAGCCACGG [30 bp] for QYDPVAALF [amino acids (aa's) 341-349]) and used for PCR (KOD Plus; Toyobo, Osaka, Japan) with a template plasmid, pEAK10-pp65. CMV promoter (PCMV) and bovine growth hormone (BGH) polyadenylation signal (pA) were independently amplified from pcDNA3.1 by PCR using the following primers: 5' PCMV, CTTAGGGTTAGGCGTTTTGC; 3' PCMV, NNCATGGTGGATCCGAGCTCGGTA; 5' pA, NNTAGCGCTCGAGTCTAGAGGG; 3' pA, GGTTCTTTCCGCCTCAGAAG; "N" means a mixture ofA/C/T/G. The 3' PCMV and 5' pA primers contained overlapping sequences (underlined) with 5' primer and 3' primer, respectively, of the targeted region. The 3 PCR products, PCMV, the targeted region, and pA, were conjugated by second PCR using primers, 5' PCMV and 3' pA, and termed "PCMVXXX-XXX" (each "XXX" indicates the amino acid positions of the N- or C-terminus).

ELISPOT assays

ELISPOT assays were performed as described earlier.17,25 In brief, a MultiScreen-HA plate (MAHA S4510; Millipore, Bedford, MA) was coated with antihuman interferon {gamma} (IFN-{gamma}) monoclonal antibody (M700A; Endogen, Woburn, MA) and used as an ELISPOT plate. The 293T cells were cotransfected with plasmids encoding each of the individual donor's HLA class I alleles and either pcDNA3-pp65, deletion mutants, or PCR products of the linear expression fragment by TransIT-293 (Mirus, Madison, WI) and were used as stimulator cells after 2 days. The transfected 293T, LCL/pp65, or LCL/EGFP cells (with or without peptide pulsing) were mixed with 103 or more effector cells from the CTL lines generated. After cells had been incubated in 200 µL complete medium in a 96-well plate (3790; Costar Corning, Cambridge, MA) for 4 hours, all the aliquots were transferred into an ELISPOT plate and incubated for an additional 16 hours. To visualize spots, a biotin-labeled antihuman IFN-{gamma} antibody (M701B; 1 µg/mL, Endogen), streptavidin-alkaline phosphatase (Biosource International, Camarillo, CA), and substrate were used. Spots were counted after computerized visualization using a scanner (Canon, Tokyo, Japan). For peptide titration assays, autologous LCL/EGFP cells were pulsed with various concentrations of synthetic peptides and then used as stimulator cells to see the differences in avidity of the effector cells from CMV-seronegative and CMV-seropositive donors.

Chromium release assay

LCL/pp65 or LCL/EGFP cells were labeled in 100 µL complete media with 3.7 MBq 51Cr for 1 hour at 37°C. Dermal fibroblasts were infected overnight with CMV (strain AD169) supernatant in the presence of 3.7 MBq 51Cr following 500 U/mL IFN-{gamma} pretreatment for 24 hours. For peptide reconstitution assays, 1 µM of synthetic peptide was added 1 hour before introducing effector cells. After 4 hours incubation with effector cells, supernatants were counted in a gamma counter. The percentage of specific lysis was calculated as follows: [(experimental release – spontaneous release)/(maximum release – spontaneous release)] x 100.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Generation and characterization of pp65-specific CTL lines from CMV-seropositive donors using pp65-transduced CD40-B cells as APCs

We previously reported successful generation of pp65-specific CTL lines from all enrolled CMV-seropositive donors using retrovirally transduced CD40-B cells as APCs. In this study, we extended the findings by including additional 7 seropositive donors (Table 1). All CTL lines, with CD8+ phenotype, lysed pp65-transduced autologous LCLs efficiently, but not untransduced autologous LCLs, and the activities were inhibited by anti–HLA class I antibody (data not shown).

To determine the HLA restriction of these CTL lines we conducted ELISPOT assays using 293T cells transfected with the pp65 gene plus one of the HLA class I alleles belonging to donors as stimulator cells (Figure 1). For instance, a major population of the CTL line generated from donor P01 was stimulated by 293T cells transfected with HLA-B*1501 and the pp65 gene, while minor populations were restricted by HLA-A*1101 or -Cw*0401. Responses associated with the other HLA class I alleles were not detected when 103 cells of the CTL line were used. The results demonstrated that the P01 CTL lines recognized multiple pp65-derived epitopes presented by at least 3 different HLA class I alleles. Similarly in the cases of P02, P03, P05, P08, and P11, the CTL lines were restricted by multiple HLA class I alleles and the sum of the spots restricted to each allele was comparable to those produced with autologous LCL/pp65. In contrast, in the cases of P04, P09, and P10, the sum of the spots restricted to each HLA class I allele was much smaller than those with pp65-transduced LCLs (Figure 1).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 1.. ELISPOT assay for the determination of HLA restriction of the CTL lines generated from CMV seropositive donors. CTL lines generated after the third stimulation with pp65-transduced CD40-B cells were tested for HLA restriction. ELISPOT assays were performed by incubating the CTL line with one of the following: autologous LCL, pp65-transduced autologous LCL ({square}), 293T cells transfected with both the pp65 gene and the individual HLA cDNA ({blacksquare}), or the pp65 gene alone (). In the case of P06 and P07, CTL lines were found to recognize 293T cells transfected with the pp65 gene alone, due to their endogenous expression of HLA-A*0201. Thus, 293T cells transfected with both mutant pp65 gene (pcDNA3-pp65{Delta}NLV), lacking a dominant A*0201-restricted epitope (NLVPMVATV), and individual HLA cDNA were used in these cases () (see "Materials and methods"). Each bar represents the number of spots per 103 cells.

 

The CTL lines from HLA-A*0201–positive donors (P06, P07) well recognized the transfectant with pp65 alone (Figure 1

) because 293T cells express HLA-A*0201 endogenously (data not shown). The mutant pp65 cDNA expression plasmid (pcDNA3-pp65{Delta}NLV), lacking the HLA-A*0201–restricted immunodominant epitope, enabled us to detect CTL responses associated with HLA alleles other than HLA-A*0201. The results revealed that HLA-A*2402 and -B*4006 were subdominant restricting HLA alleles for P06 and P07 CTL lines, respectively (Figure 1

).

Identification of the regions encoding the pp65 epitopes restricted by individual HLA class I alleles

As an initial step toward defining the epitopes recognized by these pp65-specific CTL lines, C-terminus–truncated pp65 genes were generated using the conventional exonuclease III deletion method to locate the regions encoding the epitopes (Figure 2). Thereafter, 293T cells were transfected with each of the deletion mutants plus restricting HLA class I cDNA and used for stimulation of each CTL line.



View larger version (45K):
[in this window]
[in a new window]
 
Figure 2.. Localization of pp65-derived CTL epitopes estimated by ELISPOT assay using various pp65-deletion mutants. Amino acids (aa's) are numbered from the initial methionine. Each deletion mutant was transfected into 293T cells together with restricting HLA cDNA and was tested for the recognition by corresponding pp65-specific CTL line by ELISPOT assay. The number of spots over that of full-length pp65 or {Delta}pp65(1-482) (only in Cw*1202) is indicated as follows: greater than 70% (large-sized circles), 20% to 70% (semicircles), less than 20% (small-sized circles). "—" indicates the absence of spots.

 

The P11 CTL line could recognize 293T cells transfected with HLA-A*2402 cDNA plus {Delta}pp65(1-355) or longer deletion mutants, but not {Delta}pp65(1-335) or shorter deletion mutants (Figure 2), indicating that the pp65 epitope presented by HLA-A*2402 should fully or partially be contained inside the region spanning between amino acid residues aa336 and aa355. Indeed, an HLA-A*2402–restricted epitope QYDPVAALF (aa's 341-349)15 is found within the region. The results for HLA-B*3501 and -B*5201 were also consistent with the reported epitopes (IPSINVHHY [aa's 123-131]26 and QMWQARLTV [aa's 155-163],27 respectively). These observations indicate that our strategy using deletion mutants worked effectively.

Next, we attempted to locate the regions containing pp65 CTL epitopes presented by other HLA class I alleles. As shown in Figure 2, such regions existed between the following amino acid residues: 514-561 (A*0207), 483-513 (A*1101), 212-234 (B*1501), 272-287(B*4002), 514-561 (B*4006), 356-378 (B*4403), 514-561 (B*5101), 1-40 (Cw*0102), 336-355 (Cw*0401), 187-211 (Cw*0801), 288-310 (Cw*1202), 187-211(Cw*1502). In the case of HLA-B*4001, the P03 CTL line strongly recognized not only {Delta}pp65(1-287) or longer deletion mutants but also {Delta}pp65(1-249), {Delta}pp65(1-260), and {Delta}pp65(1-271) to a lesser extent, suggesting the presence of 2 different HLA-B*4001–restricted epitopes. The existence of an additional subdominant epitope was also suggested in the cases of HLA-A*1101, -B*4403, -B*5101, and -Cw*0801 (Figure 2). As for HLA-Cw*1202, it is of note that the transfectants with the full-length plasmid produced a smaller number of spots than those with the shorter deletion mutants, such as {Delta}pp65(1-482).

Identification of the pp65 epitopes presented by HLA alleles whose binding motif is predictable by computer algorithm

To predict the epitopes within the regions narrowed down by the deletion mutant experiments (Figure 2), amino acid sequences of the determined regions with a 10-aa extension to the N-terminus were analyzed by online computer algorithm software. The prediction results are listed in Table 2. For the HLA-A*0207–restricted epitope, A*0201 was alternatively selected because A*0207 was not available on the computer algorithm we used.23,24 As for HLA-B*1501, the computer algorithm on the BIMAS website22,23 depicted 3 candidate epitopes with similar scores (6, 4.4, and 4), one of which was also depicted by another algorithm24 and subsequently adopted.


View this table:
[in this window]
[in a new window]
 
Table 2.. Candidate epitopes predicted by computer algorithms

 

To test the recognition of the predicted epitopes by each CTL line, linear expression fragments encoding various peptides including the predicted epitopes were generated by overlapping PCR (see "Materials and methods"), transfected into 293T cells together with restricting HLA class I cDNA, and evaluated by ELISPOT assay. As shown in Figure 3, all predicted epitopes except for the HLA-B*5101–restricted one were well recognized by the corresponding pp65-specific CTL, and the specificity was confirmed using irrelevant fragments. For instance, the P01 CTL line could be stimulated by 293T cells cotransfected with a fragment encoding aa's 215 to 223 and HLA-B*1501 comparably to the case with the full-length pp65 gene, but not at all with aa's 227 to 235, indicating that aa's 215 to 223 (KMQVIGDQY; nonamer) is at least one of the HLA-B*1501–restricted epitopes. With HLA-B*4001, both of the 2 fragments encoding the predicted epitopes (aa's 232-240 and aa's 267-275) were well recognized by P03 CTL line (Figure 3), confirming the results of ELISPOT assay using deletion mutants (Figure 2).



View larger version (37K):
[in this window]
[in a new window]
 
Figure 3.. Recognition of the epitopes predicted by computer algorithm by the pp65-specific CTL lines. Linear expression fragments encoding various peptides including the predicted epitopes were generated and transfected into 293T cells together with restricting HLA cDNA. Recognition by the pp65-specific CTL lines was evaluated 48 hours later by ELISPOT assay. Numbers indicate the amino acid position of pp65 encoded by each construct. Linear expression fragments encoding the predicted epitopes are underlined. Each bar represents the number of spots per 104 cells.

 

In the case of HLA-B*5101, the fragments encoding the predicted epitope (aa's 547-555) or the one with the second highest score (aa's 545-553) were not or only poorly recognized by the P05 CTL line (Figure 3). Thus various other fragments were tested and the one encoding octamer peptide (DALPGPCI; aa's 545-552) was found to be well recognized. This octamer has a binding motif consistent with that for HLA-B*5101.28

In summary, we successfully identified 11 new pp65-derived epitopes presented by 10 distinct HLA alleles (Table 3). Of interest is the fact that QYDPVAALF (aa's 341-349) restricted by HLA-Cw*0401 is identical to that restricted by HLA-A*2402.15


View this table:
[in this window]
[in a new window]
 
Table 3.. Summary of CTL epitopes derived from CMV-pp65

 

Identification of the pp65 epitopes presented by HLA alleles whose binding motif is not predictable by computer algorithm

Since algorithms that predict peptides binding to HLA-Cw*0801, -Cw*1202, and -Cw*1502 are currently not available, we performed step-by-step epitope mapping using the linear expression fragments. Based on the results with deletion mutants and HLA-Cw*1202 (Figure 2), fragments encoding the region from aa 267 to aa 292 or to aa 302 were tested. The P04 CTL line recognized the transfectant with the fragment encoding aa's 267 to 302, but not that with aa's 267 to 292 (Figure 4A left), suggesting that the epitope should be fully or partially contained between aa 293 and aa 302. Next, various fragments encoding the septamer to dodecamer peptides within this region were generated and tested. The fragments whose C-terminus was Phe302 were well recognized, but those with His301 or Gly303 at the C-terminus were not or only poorly recognized (Figure 4C left). The CTL lines were partially activated by the fragments ending at Leu304. Progressive N-terminal deletion revealed that Ala295 was crucial for recognition. The same results were obtained with the P09 CTL line (data not shown). Additional experiments with synthetic peptides revealed that the CTL clone could recognize VAFTSHEHF (aa's 294-302) at 2-log lower concentrations than AFTSHEHF (aa's 295-302) (data not shown), indicating that the nonamer VAFTSHEHF is the minimal epitope presented by HLA-Cw*1202.



View larger version (41K):
[in this window]
[in a new window]
 
Figure 4.. Identification of pp65-derived CTL epitopes for which a computer algorithm was not applicable. To narrow down the region containing the epitope, the linear expression fragments encoding further truncated forms of the deletion mutant, {Delta}pp65(1-310) for HLA-Cw*1202 or {Delta}pp65(1-210) for HLA-Cw*0801 and -Cw*1502, were generated and transfected into 293T cells together with restricting HLA cDNA. (A) Recognition by the pp65-specific CTL lines was evaluated 48 hours later by ELISPOT assay. (B) Amino acid sequence of pp65 around the defined region. (C) Based on the results shown in the upper panels, various linear expression fragments within the region were generated, transfected into 293T cells together with restricting HLA cDNA, and then tested for the recognition by corresponding pp65-specific CTL line using ELISPOT assay. Each bar represents the number of spots per 104 cells.

 

In the case of HLA-Cw*0801, fragments encoding the region up to aa 193, aa 204, or aa 208 were also constructed for further narrowing the regions identified (Figures 2 and 4). Because the fragment encoding aa's 173 to 208, but not aa's 173 to 204, was recognized by the P08 CTL line, the C-terminus of the epitope should be located between aa's 205 and 208 (Figure 4A middle). ELISPOT assay using transfectants with various linear expression fragments revealed that those encoding the peptides ending at Cys206 or Met208 were well recognized (Figure 4C middle). The results also indicated that Val198 was required for recognition. Thus we determined that VVCAHELVC (aa's 198-206) is the minimal epitope presented by HLA-Cw*0801. Interestingly, the same nonamer (VVCAHELVC) was independently identified as a minimal epitope presented by HLA-Cw*1502 (Figure 4C right).

Generation of CTL lines from CMV-seropositive donors with CD40-B cells pulsed with newly identified pp65 epitopes

To confirm the immunogenicity of the newly identified epitopes, we tried to generate pp65-specific CTL using synthetic peptide-pulsed CD40-B cells as APCs. After the third stimulation cytolytic activity of the CTL lines was assessed. A CTL line from donor P03, induced by CEDVPSGKL presented by HLA-B*4001, could lyse HLA-B*4001–positive allogeneic LCLs (from donor N06) expressing pp65 antigen and also the peptide-pulsed LCL/EGFPs (Figure 5A). Similar results were also obtained with the other 5 epitopes.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 5.. Cytolytic activity of the CTL lines generated by stimulation with CD40-B cells pulsed with newly identified epitopes. CD8+ T cells from CMV-seropositive donors were stimulated with peptide-pulsed autologous CD40-B cells. CMVpp65-derived synthetic peptides used were CEDVPSGKL (pp65232-240) to be presented by HLA-B*4001 (A), HERNGFTVL (pp65267-275) by HLA-B*4001 (B), AELEGVWQPA (pp65525-534) by HLA-B*4006 (C), QYDPVAALF (pp65341-349) by HLA-Cw*0401 (D), VVCAHELVC (pp65198-206) by HLA-Cw*0801 (E) or Cw*1502 (F). One week after the third stimulation, cytolysis of CTL lines was assessed by 51Cr release assay against LCL/pp65 ({blacksquare}), LCL/EGFP ({circ}), or 1 µM peptide-pulsed LCL/EGFP ({bullet}) over a range of E/T ratios as indicated. The origin of target cells was autologous (panel F) or allogeneic [panels A-B, N06 (B*4001+); panel D, P01(Cw*0401+); panels C and E, N03(B*4006, Cw*0801+)].

 

Generation of pp65-specific CTL lines from seronegative donors with CD40-B cells pulsed with a mixture of newly or previously identified pp65 epitopes

In the current and previous studies we failed to generate pp65-specific CTL lines from all 8 seronegative donors using pp65-transduced CD40-B cells as APCs. To improve stimulation efficiency, we applied CD40-B cells pulsed with a mixture of newly or previously identified epitopes. One million CD8+ T cells were stimulated 3 times with autologous CD40-B cells pulsed with a mixture of 2 to 4 synthetic peptides, which are presentable by HLA alleles belonging to each donor. The T-cell line from N02 produced IFN-{gamma} spots after stimulation with 2 of the 4 peptides (Figure 6A). Peptide titration assay revealed that half-maximal number of spots for N02 line was obtained with approximately 3.0 nM of peptide IPSINVHHY, while that for P05 CTL line from a seropositive donor sharing HLA-B*3501 was 80 pM (Figure 6B top), indicating that a 38-fold higher peptide concentration was required in the N02 line. Nevertheless, the N02 could lyse autologous LCL/pp65s and also dermal fibroblasts infected with CMV although a lesser extent (9% at the effector-target [E/T] ratio of 25:1) (Figure 6C top). Two of the 4 peptides were recognized by the N03 T-cell line whose half-maximal spots for both peptides were obtained with 2.9 nM (peptide QYDPVAALF) and 14 nM (peptide HERNGFTVL), which were 35- and 77-fold higher than those for P02 CTL line from a seropositive donor sharing HLA-A*2402 and -B*4002, respectively. This N03 line lysed autologous LCL/pp65s and peptide-pulsed fibroblasts, but failed to lyse CMV-infected fibroblasts, suggesting the avidity of the line was not high enough for exerting cytotoxic activity against CMV-infected fibroblasts. On the other hand, in the case of N06 and N08, exogenously pulsed peptides (N06, CEDVPSGKL; N08, IPSINVHHY) on LCL/EGFPs were recognized (Figure 6A), whereas endogenously expressed pp65 in LCLs was not recognized (Figure 6A,C), which might partly be explained by the 10- to 20-fold higher peptide concentrations necessary for the half-maximal spots (65 nM for CEDVPSGKL in N06 and 36 nM for IPSNVHHY in N08; Figure 6B).



View larger version (42K):
[in this window]
[in a new window]
 
Figure 6.. Effector cell activity of the T-cell lines generated from seronegative donors after stimulation with CD40-B cells pulsed with a mixture of antigenic peptides. CD8+ T cells from CMV-seronegative donors were stimulated 3 times with autologous CD40-B cells pulsed with a mixture of 2 to 4 peptides and tested for effector activity. CMVpp65-derived synthetic peptides used are listed in Table 3. The antigenicity of these peptides was proven in the experiments whose results are shown in Figure 5. (A) ELISPOT assay was conducted using LCL/pp65, LCL/EGFP ({square}), or LCL/EGFP pulsed with 1 µM of each peptide indicated ({blacksquare}). Each bar represents the number of spots per 103 cells. (B) Peptide titration was conducted using LCL/EGFP pulsed with various concentrations of the peptides indicated by ELISPOT assay. Percent spot was calculated for individual T-cell lines by dividing the number of spots at indicated peptide concentrations by the maximal number of spots x 100%. (C) Cytolysis of CTL lines was assessed against autologous LCL/pp65 ({bullet}), LCL/EGFP ({circ}), HLA-matched dermal fibroblasts infected with CMV supernatant ({blacksquare}), with mock supernatant ({square}), or with 1 µM peptide mixture showing spots in the ELISPOT assay ({blacktriangleup}) over a range of E/T ratios by 51Cr release assay.

 


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The present study focused on the systematic identification of novel CTL epitopes derived from CMV-pp65. We combined biotechnology with 22 C-terminal truncations of the pp65 gene at an average 22–amino acid interval (range, 11-48 aa's) and computer technology with algorithm-based prediction of peptide binding to certain HLA alleles. We were able to identify CTL epitopes using linear expression fragments constructed by overlapping PCR, even if a computer algorithm was not available for HLA alleles of interest. In general, to identify CTL epitopes, establishment of CTL clones and verification using 51Cr release assay have frequently been used. In this study, for efficient detection of CTL responses, we adopted the ELISPOT assay15 so that even responses to subdominant epitopes could be detected, such as the HLA-Cw*0102–restricted one in donor P03.

In the cases of P04, P09, and P10, the sum of the spots against 293T cells transfected with pp65 gene plus each HLA class I allele was unexpectedly smaller than that against pp65-transduced LCLs (Figure 1). This could be due to differential processing and/or presentation of pp65 proteins in LCLs and 293T cells. In this sense, HLA-A*2402 and -Cw*1202 are the focus as presenting molecules because both are present in the cases. Since the CTL lines were poorly stained with HLA-A*2402 tetramers incorporating peptide, QYDPVAALF (data not shown), it is unlikely that HLA-A*2402–restricted epitopes are concerned in this issue. Indeed, defective processing and/or presentation of the HLA-Cw*1202–restricted epitope from full-length pp65 in 293T cells was demonstrated (Figure 2). Probably, in LCLs, the pp65 is more efficiently processed and presented to yield the HLA-Cw*1202–restricted epitope. The better processing might attribute to so-called immunoproteasomes equipped by LCLs. So far, simultaneous transfection with immunoproteasome components, such as large multifunctional protease 2 (LMP2), LMP7, and LMP10, or IFN-{gamma} treatment did not improve the recognition of 293T transfectants (data not shown), suggesting that additional factors are involved. The reason why truncated pp65 were processed more efficiently is unclear but this could be due to relatively unstable pp65 protein prone to degradation and entry into the processing pathway. Additional studies are now in progress to address the question.

One of the interesting findings of this study is that linear expression fragments encoding the right epitopes with only a single amino acid extension at the C-terminus were not recognized by each CTL line efficiently, whereas N-terminal extension rarely affected the recognition (Figure 4). Aminopeptidases, such as endoplasmic reticulum aminopeptidase 1 (ERAP1)36-38 or leucine aminopeptidase,39 may be able to trim N-terminal extensions and create peptides with optimal length for binding to major histocompatibility complex (MHC). However, mammalian cells lack carboxypeptidases,39-41 thus proteasome is solely responsible for creating the correct C-terminus of the epitopes. Although a very limited number of amino acids adjacent to both sides of a proteasomal cleavage site contribute to cleavage site selection,42 only a single amino acid extension at the C-terminus may be too short to be removed efficiently by proteasomes. In addition, constitutive proteasomes might be dominant in 293T cells43 rather than immunoproteasomes, which have greater efficacy and are expressed in LCLs or mature dendritic cells. This may partially explain why C-terminal–extended epitopes were poorly recognized in our experiments.

We identified 2 new epitopes presented by HLA-A molecules. One is RIFAELEGV, dominantly presented by HLA-A*0207 but not by HLA-A*0201. This result underscores differential peptide repertories that bind to HLA-A*0207 and -A*0201, probably influenced by a single amino acid substitution at the floor of the binding groove.44 The other is presented by HLA-A*1101 (ATVQGQNLK; aa's 501-509): this seems to be the dominant epitope presented by the allele, although a subdominant one may be located between aa 211 and aa 234. Both the dominant and undefined subdominant epitopes are, however, different from those reported previously, GPISGHVLK; aa 16-24.9,30 For HLA-B alleles we identified 7 new epitopes, 4 of which are restricted by the HLA-B40 group. Among them, HERNGFTVI (aa's 267-275) is presented by both HLA-B*4001 and -B*4002. HLA-B*4001 presents an additional epitope, CEDVPSGKL (aa's 232-240). An HLA-B*4403–restricted epitope found in this study (SEHPTFTSQY; aa364-373) differs from the HLA-B44–restricted one reported earlier (EFFWDANDIY; aa's 512-521).14,34 HLA-B*4402 and -B*4403 are 2 major HLA-B44 subtypes in white individuals,45,46 and HLA-B*4403 is most frequent HLA-B44 subtype in Japanese individuals.47-49 Because the reported epitope, EFFWDANDIY, was listed as the HLA-B*4402–restricted one,35 these 2 epitopes might be restricted by a different subtype of HLA-B44. All the data imply that subtle differences in amino acid residues facing the groove of HLAs have an impact on the peptide binding and subsequent CMV-pp65–specific T-cell responses.

This paper describes, for the first time to our knowledge, pp65-specific epitopes presented by HLA-C alleles. A unique epitope, VVCAHELVC (aa's 198-206), was presented by both HLA-Cw*0801 and -Cw*1502. Since there seems to be no information on the peptide binding motif for these HLA alleles, the epitope was determined by gene engineering of pp65, followed by probing with CTL restricted to each HLA-C allele. The results should shed light on the structural basis of understanding the HLA-C molecules. Interestingly, an HLA-Cw*0401–restricted epitope, QYDPVAALF (aa's 341-349),15 is also dominantly presented by HLA-A*2402 allele. The binding motifs of those 2 alleles are similar to each other (ie, Tyr, Pro, or Phe at the second position and Leu or Phe at the C-terminus in HLA-Cw*0401; and Tyr at the second position, and Ile, Leu, or Phe at the C-terminus in HLA-A*2402). From the point of immunotherapy, this single peptide has great advantages among populations where HLA-A*2402 and -Cw*0401 are common.

There are only a few reports of successful generation of pp65-specific CTL from CMV-seronegative donors. Kleihauer et al50 showed that cytotoxic T-cell lines were generated from 2 of 11 seronegative donors starting with 3 x 106 PBMCs on stimulation with pp65 peptide–pulsed monocyte-derived dendritic cells. In our previous study, we failed to generate pp65-specific CTL lines from seronegative donors using pp65-transduced CD40-B cells as APCs, but in this study CTL lines that could lyse LCLs expressing endogenously processed peptides from the transduced pp65 gene were generated in 2 of 4 cases (N02 and N03) by using CD40-B cells pulsed with a mixture of the peptides as APCs. However CMV-infected fibroblasts were recognized weakly only by the CTL line from N02. Again, the better antigen processing by LCLs than fibroblasts might contribute to the better recognition by the CTL lines. Such CTLs may be able to only lyse CMV-infected hematopoietic cells in vivo. It is noted in this regard that CMV is reported to infect not only stroma and epithelial cells but also hematopoietic cells including CD34+ stem cells, monocytes, and dendritic cells.51-55 In the other 2 cases, the CTL lines could recognize only peptide-pulsed LCLs. This observation seems to reflect the results of peptide titration experiments by ELISPOT assay; the peptide concentration to yield half-maximal spots was found to be 10- to 20-fold lower in N02 and N03 lines compared with N06 and N08 lines, suggesting the lower avidity of the lines generated from N06 and N08. To overcome this problem, initial stimulation with peptides at a lower concentration may induce higher avidity CTLs.56 Alternatively, more T-cell input at the time of initial stimulation may be needed to induce CTL lines from rare precursor T cells with higher affinity T-cell receptor since estimated precursor frequency of naive T cells against a single epitope is very low (for example, one in 5 x 106 of CD8+ cells for lymphocytic choriomeningitis virus in mice57). Further efforts are now underway to establish better CTL induction conditions from seronegative donors.

In summary, we here identified 14 novel CTL epitopes derived from CMV-pp65 antigen restricted by HLA-A, -B, and -C alleles. These should be useful for immunologic monitoring of individuals expressing these HLA class I alleles and also for generation of pp65-specific CTLs from not only seropositive but also seronegative donors. In addition, our present approach of epitope identification applying deletion mutants and linear expression fragments, together with the efficient generation of CTL lines, may be applicable for other tumor-specific or viral antigens.


    Acknowledgements
 
NIH-3T3-hCD40 ligand cells were kindly provided by Dr Gordon Freeman. Valuable discussions and suggestions by Drs T. Kiyono, A. Uenaka, Y. Nagata, M. Yazaki, T. Tsurumi, and E. Nakayama are highly appreciated. We are very grateful to Y. Matsudaira, K. Nishida, Y. Nakao, and H. Tamaki for their expert technical assistance.


    Footnotes
 
Submitted March 19, 2003; accepted August 26, 2003.

Prepublished online as Blood First Edition Paper, August 28, 2003; DOI 10.1182/blood-2003-03-0824.

Supported by a grant-in-aid for General Scientific Research (Y.A., Y.M.) and a grant-in-aid for Scientific Research on Priority Areas (T.T.) from the Ministry of Education, Culture, Science, Sports, and Technology, Japan; Research on Human Genome, Tissue Engineering Food Biotechnology (Y. Kodera, Y.M., T.T.), and Second Team Comprehensive 10-year Strategy for Cancer Control (T.T.) from the Ministry of Health, Labour, and Welfare, Japan; a special project grant from Aichi Cancer Center; a Bristol-Myers Squibb Research Grant (Y.A.); and a Nagono Medical Research Grant (K.K.).

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Yoshiki Akatsuka, Division of Immunology, Aichi Cancer Center Research Institute, 1-1 Kanokoden, Chikusa-ku, Nagoya 464-8681, Japan; e-mail: yakatsuk{at}aichi-cc.jp.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Einsele H, Hebart H, Kauffmann-Schneider C, et al. Risk factors for treatment failures in patients receiving PCR-based preemptive therapy for CMV infection. Bone Marrow Transplant. 2000; 25: 757-763.[CrossRef][Medline] [Order article via Infotrieve]

  2. Boeckh M, Leisenring W, Riddell SR, et al. Late cytomegalovirus disease and mortality in recipients of allogeneic hematopoietic stem cell transplants: importance of viral load and T-cell immunity. Blood. 2003;101: 407-414.[Abstract/Free Full Text]

  3. Reusser P, Riddell SR, Meyers JD, Greenberg PD. Cytotoxic T-lymphocyte response to cytomegalovirus after human allogeneic bone marrow transplantation: pattern of recovery and correlation with cytomegalovirus infection and disease. Blood. 1991;78: 1373-1380.[Abstract/Free Full Text]

  4. Li CR, Greenberg PD, Gilbert MJ, Goodrich JM, Riddell SR. Recovery of HLA-restricted cytomegalovirus (CMV)-specific T-cell responses after allogeneic bone marrow transplant: correlation with CMV disease and effect of ganciclovir prophylaxis. Blood. 1994;83: 1971-1979.[Abstract/Free Full Text]

  5. Krause H, Hebart H, Jahn G, Muller CA, Einsele H. Screening for CMV-specific T cell proliferation to identify patients at risk of developing late onset CMV disease. Bone Marrow Transplant. 1997;19: 1111-1116.[CrossRef][Medline] [Order article via Infotrieve]

  6. Walter EA, Greenberg PD, Gilbert MJ, et al. Reconstitution of cellular immunity against cytomegalovirus in recipients of allogeneic bone marrow by transfer of T-cell clones from the donor. N Engl J Med. 1995;333: 1038-1044.[Abstract/Free Full Text]

  7. Reusser P, Attenhofer R, Hebart H, Helg C, Chapuis B, Einsele H. Cytomegalovirus-specific T-cell immunity in recipients of autologous peripheral blood stem cell or bone marrow transplants. Blood. 1997;89: 3873-3879.[Abstract/Free Full Text]

  8. Cwynarski K, Ainsworth J, Cobbold M, et al. Direct visualization of cytomegalovirus-specificT-cell reconstitution after allogeneic stem cell transplantation. Blood. 2001;97: 1232-1240.[Abstract/Free Full Text]

  9. Hebart H, Daginik S, Stevanovic S, et al. Sensitive detection of human cytomegalovirus peptide-specific cytotoxic T-lymphocyte responses by interferon-gamma-enzyme-linked immunospot assay and flow cytometry in healthy individuals and in patients after allogeneic stem cell transplantation. Blood. 2002;99: 3830-3837.[Abstract/Free Full Text]

  10. Riddell SR, Watanabe KS, Goodrich JM, Li CR, Agha ME, Greenberg PD. Restoration of viral immunity in immunodeficient humans by the adoptive transfer of T cell clones. Science. 1992;257: 238-241.[Abstract/Free Full Text]

  11. Einsele H, Roosnek E, Rufer N, et al. Infusion of cytomegalovirus (CMV)-specific T cells for the treatment of CMV infection not responding to antiviral chemotherapy. Blood. 2002;99: 3916-3922.[Abstract/Free Full Text]

  12. Gilbert MJ, Riddell SR, Li CR, Greenberg PD. Selective interference with class I major histocompatibility complex presentation of the major immediate-early protein following infection with human cytomegalovirus. J Virol. 1993;67: 3461-3469.[Abstract/Free Full Text]

  13. McLaughlin-Taylor E, Pande H, Forman SJ, et al. Identification of the major late human cytomegalovirus matrix protein pp65 as a target antigen for CD8+ virus-specific cytotoxic T lymphocytes. J Med Virol. 1994;43: 103-110.[Medline] [Order article via Infotrieve]

  14. Wills MR, Carmichael AJ, Mynard K, et al. The human cytotoxic T-lymphocyte (CTL) response to cytomegalovirus is dominated by structural protein pp65: frequency, specificity, and T-cell receptor usage of pp65-specific CTL. J Virol. 1996;70: 7569-7579.[Abstract]

  15. Kuzushima K, Hayashi N, Kimura H, Tsurumi T. Efficient identification of HLA-A*2402-restricted cytomegalovirus-specific CD8(+) T-cell epitopes by a computer algorithm and an enzyme-linked immunospot assay. Blood. 2001;98: 1872-1881.[Abstract/Free Full Text]

  16. Gillespie GM, Wills MR, Appay V, et al. Functional heterogeneity and high frequencies of cytomegalovirus-specific CD8(+) T lymphocytes in healthy seropositive donors. J Virol. 2000;74: 8140-8150.[Abstract/Free Full Text]

  17. Kondo E, Topp MS, Kiem HP, et al. Efficient generation of antigen-specific cytotoxic T cells using retrovirally transduced CD40-activated B cells. J Immunol. 2002;169: 2164-2171.[Abstract/Free Full Text]

  18. Akatsuka Y, Goldberg TA, Kondo E, et al. Efficient cloning and expression of HLA class I cDNA in human B-lymphoblastoid cell lines. Tissue Antigens. 2002;59: 502-511.[CrossRef][Medline] [Order article via Infotrieve]

  19. Schultze JL, Michalak S, Seamon MJ, et al. CD40-activated human B cells: an alternative source of highly efficient antigen presenting cells to generate autologous antigen-specific T cells for adoptive immunotherapy. J Clin Invest. 1997;100: 2757-2765.[Medline] [Order article via Infotrieve]

  20. Schultze JL, Cardoso AA, Freeman GJ, et al. Follicular lymphomas can be induced to present alloantigen efficiently: a conceptual model to improve their tumor immunogenicity. Proc Natl Acad Sci U S A. 1995;92: 8200-8204.[Abstract/Free Full Text]

  21. Horn PA, Topp MS, Morris JC, Riddell SR, Kiem HP. Highly efficient gene transfer into baboon marrow repopulating cells using GALV-pseudotype oncoretroviral vectors produced by human packaging cells. Blood. 2002;100: 3960-3967.[Abstract/Free Full Text]

  22. Parker KC, Bednarek MA, Coligan JE. Scheme for ranking potential HLA-A2 binding peptides based on independent binding of individual peptide side-chains. J Immunol. 1994;152: 163-175.[Abstract]

  23. Taylor R. BioInformatics and Molecular Analysis Section (BIMAS) HLA peptide binding predictions. Available at: http://bimas.dcrt.nih.gov/molbio/hla_bind/index.html. Accessed October 10, 2002.

  24. Hildebrand WH, Muthuraman S. HLA Epitope binding prediction in HLA Ligand/Motif Database. Available at: http://hlaligand.ouhsc.edu/prediction.htm. Accessed December 15, 2002.

  25. Geginat G, Schenk S, Skoberne M, Goebel W, Hof H. A novel approach of direct ex vivo epitope mapping identifies dominant and subdominant CD4 and CD8 T cell epitopes from Listeria monocytogenes. J Immunol. 2001;166: 1877-1884.[Abstract/Free Full Text]

  26. Gavin MA, Gilbert MJ, Riddell SR, Greenberg PD, Bevan MJ. Alkali hydrolysis of recombinant proteins allows for the rapid identification of class I MHC-restricted CTL epitopes. J Immunol. 1993; 151: 3971-3980.[Abstract]

  27. Kern F, Bunde T, Faulhaber N, et al. Cytomegalovirus (CMV) phosphoprotein 65 makes a large contribution to shaping the T cell repertoire in CMV-exposed individuals. J Infect Dis. 2002;185: 1709-1716.[CrossRef][Medline] [Order article via Infotrieve]

  28. Kikuchi A, Sakaguchi T, Miwa K, et al. Binding of nonamer peptides to three HLA-B51 molecules which differ by a single amino acid substitution in the A-pocket. Immunogenetics. 1996;43: 268-276.[Medline] [Order article via Infotrieve]

  29. Retiere C, Prod'homme V, Imbert-Marcille BM, Bonneville M, Vie H, Hallet MM. Generation of cytomegalovirus-specific human T-lymphocyte clones by using autologous B-lymphoblastoid cells with stable expression of pp65 or IE1 proteins: a tool to study the fine specificity of the antiviral response. J Virol. 2000;74: 3948-3952.[Abstract/Free Full Text]

  30. Longmate J, York J, La Rosa C, et al. Population coverage by HLA class-I restricted cytotoxic T-lymphocyte epitopes. Immunogenetics. 2001;52: 165-173.[CrossRef][Medline] [Order article via Infotrieve]

  31. Solache A, Morgan CL, Dodi AI, et al. Identification of three HLA-A*0201-restricted cytotoxic T cell epitopes in the cytomegalovirus protein pp65 that are conserved between eight strains of the virus. J Immunol. 1999;163: 5512-5518.[Abstract/Free Full Text]

  32. Diamond DJ, York J, Sun JY, Wright CL, Forman SJ. Development of a candidate HLA A*0201 restricted peptide-based vaccine against human cytomegalovirus infection. Blood. 1997;90: 1751-1767.[Abstract/Free Full Text]

  33. Masuoka M, Yoshimuta T, Hamada M, et al. Identification of the HLA-A24 peptide epitope within cytomegalovirus protein pp65 recognized by CMV-specific cytotoxic T lymphocytes. Viral Immunol. 2001;14: 369-377.[CrossRef][Medline] [Order article via Infotrieve]

  34. Weekes MP, Wills MR, Mynard K, Carmichael AJ, Sissons JG. The memory cytotoxic T-lymphocyte (CTL) response to human cytomegalovirus infection contains individual peptide-specific CTL clones that have undergone extensive expansion in vivo. J Virol. 1999;73: 2099-2108.[Abstract/Free Full Text]

  35. Wills MR, Okecha G, Weekes MP, Gandhi MK, Sissons PJ, Carmichael AJ. Identification of naive or antigen-experienced human CD8(+) T cells by expression of costimulation and chemokine receptors: analysis of the human cytomegalovirus-specific CD8(+) T cell response. J Immunol. 2002;168: 5455-5464.[Abstract/Free Full Text]

  36. York IA, Chang SC, Saric T, et al. The ER aminopeptidase ERAP1 enhances or limits antigen presentation by trimming epitopes to 8-9 residues. Nat Immunol. 2002;3: 1177-1184.[CrossRef][Medline] [Order article via Infotrieve]

  37. Saric T, Chang SC, Hattori A, et al. An IFN-gamma-induced aminopeptidase in the ER, ERAP1, trims precursors to MHC class I-presented peptides. Nat Immunol. 2002;3: 1169-1176.[CrossRef][Medline] [Order article via Infotrieve]

  38. Serwold T, Gonzalez F, Kim J, Jacob R, Shastri N. ERAAP customizes peptides for MHC class I molecules in the endoplasmic reticulum. Nature. 2002;419: 480-483.[CrossRef][Medline] [Order article via Infotrieve]

  39. Beninga J, Rock KL, Goldberg AL. Interferon-gamma can stimulate post-proteasomal trimming of the N terminus of an antigenic peptide by inducing leucine aminopeptidase. J Biol Chem. 1998;273: 18734-18742.[Abstract/Free Full Text]

  40. Craiu A, Akopian T, Goldberg A, Rock KL. Two distinct proteolytic processes in the generation of a major histocompatibility complex class I-presented peptide. Proc Natl Acad Sci U S A. 1997; 94: 10850-10855.[Abstract/Free Full Text]

  41. Saric T, Beninga J, Graef CI, Akopian TN, Rock KL, Goldberg AL. Major histocompatibility complex class I-presented antigenic peptides are degraded in cytosolic extracts primarily by thimet oligopeptidase. J Biol Chem. 2001;276: 36474-36481.[Abstract/Free Full Text]

  42. Nussbaum AK, Dick TP, Keilholz W, et al. Cleavage motifs of the yeast 20S proteasome beta subunits deduced from digests of enolase 1. Proc Natl Acad Sci U S A. 1998;95: 12504-12509.[Abstract/Free Full Text]

  43. Schultz ES, Chapiro J, Lurquin C, et al. The production of a new MAGE-3 peptide presented to cytolytic T lymphocytes by HLA-B40 requires the immunoproteasome. J Exp Med. 2002;195: 391-399.[Abstract/Free Full Text]

  44. Sudo T, Kamikawaji N, Kimura A, et al. Differences in MHC class I self peptide repertoires among HLA-A2 subtypes. J Immunol. 1995;155: 4749-4756.[Abstract]

  45. Yao Z, Keller E, Scholz S, McNicholas A, Volgger A, Albert ED. Identification of two major HLA-B44 subtypes and a novel B44 sequence (B*4404): oligotyping and solid phase sequencing of polymerase chain reaction products. Hum Immunol. 1995;42: 54-60.[CrossRef][Medline] [Order article via Infotrieve]

  46. Petersdorf EW, Setoda T, Smith AG, Hansen JA. Analysis of HLA-B*44 alleles encoded on extended HLA haplotypes by direct automated sequencing. Tissue Antigens. 1994;44: 211-216.[Medline] [Order article via Infotrieve]

  47. Tanaka H, Akaza T, Juji T. Report of the Japanese Central Bone Marrow Data Center. Clin Transpl. 1996: 139-144.

  48. Tokunaga K, Ishikawa Y, Ogawa A, et al. Sequence-based association analysis of HLA class I and II alleles in Japanese supports conservation of common haplotypes. Immunogenetics. 1997; 46: 199-205.[CrossRef][Medline] [Order article via Infotrieve]

  49. Saito S, Ota S, Yamada E, Inoko H, Ota M. Allele frequencies and haplotypic associations defined by allelic DNA typing at HLA class I and class II loci in the Japanese population. Tissue Antigens. 2000;56: 522-529.[CrossRef][Medline] [Order article via Infotrieve]

  50. Kleihauer A, Grigoleit U, Hebart H, et al. Ex vivo generation of human cytomegalovirus-specific cytotoxic T cells by peptide-pulsed dendritic cells. Br J Haematol. 2001;113: 231-239.[CrossRef][Medline] [Order article via Infotrieve]

  51. Stanier P, Taylor DL, Kitchen AD, Wales N, Tryhorn Y, Tyms AS. Persistence of cytomegalovirus in mononuclear cells in peripheral blood from blood donors. BMJ. 1989;299: 897-898.[Free Full Text]

  52. Taylor-Wiedeman J, Sissons JG, Borysiewicz LK, Sinclair JH. Monocytes are a major site of persistence of human cytomegalovirus in peripheral blood mononuclear cells. J Gen Virol. 1991;72: 2059-2064.[Abstract/Free Full Text]

  53. Bevan IS, Walker MR, Daw RA. Detection of human cytomegalovirus DNA in peripheral blood leukocytes by the polymerase chain reaction. Transfusion. 1993;33: 783-784.[CrossRef][Medline] [Order article via Infotrieve]

  54. Mendelson M, Monard S, Sissons P, Sinclair J. Detection of endogenous human cytomegalovirus in CD34+ bone marrow progenitors. J Gen Virol. 1996;77: 3099-3102.[Abstract/Free Full Text]

  55. Taylor-Wiedeman J, Sissons P, Sinclair J. Induction of endogenous human cytomegalovirus gene expression after differentiation of monocytes from healthy carriers. J Virol. 1994;68: 1597-1604.[Abstract/Free Full Text]

  56. Alexander-Miller MA, Leggatt GR, Berzofsky JA. Selective expansion of high- or low-avidity cytotoxic T lymphocytes and efficacy for adoptive immunotherapy. Proc Natl Acad Sci U S A. 1996;93: 4102-4107.[Abstract/Free Full Text]

  57. Blattman JN, Antia R, Sourdive DJ, et al. Estimating the precursor frequency of naïve antigen-specific CD8 T cells. J Exp Med. 2002;195: 657-664.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Virol.Home page
P. Jagannathan, C. M. Osborne, C. Royce, M. M. Manion, J. C. Tilton, L. Li, S. Fischer, C. W. Hallahan, J. A. Metcalf, M. McLaughlin, et al.
Comparisons of CD8+ T Cells Specific for Human Immunodeficiency Virus, Hepatitis C Virus, and Cytomegalovirus Reveal Differences in Frequency, Immunodominance, Phenotype, and Interleukin-2 Responsiveness
J. Virol., March 15, 2009; 83(6): 2728 - 2742.
[Abstract] [Full Text] [PDF]


Home page
Clin. Microbiol. Rev.Home page
T. Crough and R. Khanna
Immunobiology of Human Cytomegalovirus: from Bench to Bedside
Clin. Microbiol. Rev., January 1, 2009; 22(1): 76 - 98.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. Harari, P.-A. Bart, W. Stohr, G. Tapia, M. Garcia, E. Medjitna-Rais, S. Burnet, C. Cellerai, O. Erlwein, T. Barber, et al.
An HIV-1 clade C DNA prime, NYVAC boost vaccine regimen induces reliable, polyfunctional, and long-lasting T cell responses
J. Exp. Med., January 21, 2008; 205(1): 63 - 77.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Harari, C. Cellerai, F. B. Enders, J. Kostler, L. Codarri, G. Tapia, O. Boyman, E. Castro, S. Gaudieri, I. James, et al.
Skewed association of polyfunctional antigen-specific CD8 T cell populations with HLA-B genotype
PNAS, October 9, 2007; 104(41): 16233 - 16238.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. von Bergwelt-Baildon, A. Shimabukuro-Vornhagen, A. Popov, N. Klein-Gonzalez, F. Fiore, S. Debey, A. Draube, B. Maecker, I. Menezes, L. M. Nadler, et al.
CD40-activated B cells express full lymph node homing triad and induce T-cell chemotaxis: potential as cellular adjuvants
Blood, April 1, 2006; 107(7): 2786 - 2789.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
Y. Ito, E. Kondo, A. Demachi-Okamura, Y. Akatsuka, K. Tsujimura, M. Tanimoto, Y. Morishima, T. Takahashi, and K. Kuzushima
Three Immunoproteasome-Associated Subunits Cooperatively Generate a Cytotoxic T-Lymphocyte Epitope of Epstein-Barr Virus LMP2A by Overcoming Specific Structures Resistant to Epitope Liberation
J. Virol., January 15, 2006; 80(2): 883 - 890.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
K. Sacre, G. Carcelain, N. Cassoux, A.-M. Fillet, D. Costagliola, D. Vittecoq, D. Salmon, Z. Amoura, C. Katlama, and B. Autran
Repertoire, diversity, and differentiation of specific CD8 T cells are associated with immune protection against human cytomegalovirus disease
J. Exp. Med., June 20, 2005; 201(12): 1999 - 2010.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. Trivedi, R. Y. Williams, R. J. O'Reilly, and G. Koehne
Generation of CMV-specific T lymphocytes using protein-spanning pools of pp65-derived overlapping pentadecapeptides for adoptive immunotherapy
Blood, April 1, 2005; 105(7): 2793 - 2801.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. von Bergwelt-Baildon, J. L. Schultze, B. Maecker, I. Menezes, L. M. Nadler, R. Lapointe, J. Thibodeau, and P. Hwu
Correspondence re R. Lapointe et al., CD40-stimulated B Lymphocytes Pulsed with Tumor Antigens Are Effective Antigen-presenting Cells That Can Generate Specific T Cells. Cancer Res 2003;63:2836-43.
Cancer Res., June 1, 2004; 64(11): 4055 - 4057.
[Full Text] [PDF]


Home page
Int ImmunolHome page
G. Li Pira, L. Bottone, F. Ivaldi, R. Pelizzoli, F. Del Galdo, L. Lozzi, L. Bracci, A. Loregian, G. Palu, R. De Palma, et al.
Identification of new Th peptides from the cytomegalovirus protein pp65 to design a peptide library for generation of CD4 T cell lines for cellular immunoreconstitution
Int. Immunol., May 1, 2004; 16(5): 635 - 642.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-03-0824v1
103/2/630    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kondo, E.
Right arrow Articles by Takahashi, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kondo, E.
Right arrow Articles by Takahashi, T.
Related Collections
Right arrow Immunobiology
Right arrow Transplantation
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2004 by American Society of Hematology         Online ISSN: 1528-0020