Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 1 March 2004, Vol. 103, No. 5, pp. 1883-1890.
Prepublished online as a Blood First Edition Paper on October 30, 2003; DOI 10.1182/blood-2003-06-1978.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-06-1978v1
103/5/1883    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zheng, R.
Right arrow Articles by Small, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zheng, R.
Right arrow Articles by Small, D.
Related Collections
Right arrow Neoplasia
Right arrow Apoptosis
Right arrow Gene Expression
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

NEOPLASIA

Internal tandem duplication mutation of FLT3 blocks myeloid differentiation through suppression of C/EBP{alpha} expression

Rui Zheng, Alan D. Friedman, Mark Levis, Li Li, Edward G. Weir, and Donald Small

From the Departments of Oncology, Pediatrics, and Pathology, Johns Hopkins University School of Medicine, Baltimore, MD.


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Constitutively activating mutations of FMS-like tyrosine kinase 3 (FLT3) occur in approximately one third of patients with acute myeloid leukemia (AML) and are associated with poor prognosis. Altered FLT3 signaling leads to antiapoptotic and proliferative signaling pathways. We recently showed that these mutations can also contribute to the differentiation arrest that characterizes leukemia. In this report we investigated the mechanism by which internal tandem duplication (ITD) mutation of FLT3 signaling blocks differentiation. Normally, myeloid differentiation requires the induction of CCAAT/enhancer-binding protein {alpha} (C/EBP{alpha}) and PU.1 expression. Expression of both genes was repressed by FLT3/ITD signaling in 32Dcl3 (32D) cells and this repression was overcome by treatment with a FLT3 inhibitor, allowing differentiation to proceed. We also observed increased expression of C/EBP{alpha} and PU.1 accompanied by signs of differentiation in 2 of 3 primary AML samples from patients with FLT3/ITD mutations receiving a FLT3 inhibitor, CEP-701, as part of a clinical trial. Forced expression of C/EBP{alpha} was also able to overcome FLT3/ITD-mediated differentiation block, further proving the importance of C/EBP{alpha} in this process.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
FMS-like tyrosine kinase 3 (FLT3) is a member of the class III receptor tyrosine kinase family that also includes c-kit receptor tyrosine kinase (KIT) and FMS, 2 other receptors with important roles in hematopoiesis. FLT3 is preferentially expressed on hematopoietic stem/progenitor cells and plays a role in both differentiation and proliferation.1 Somatic mutations of FLT3 involving internal tandem duplications (ITDs) of the juxtamembrane domain or D835 point mutations in the activation loop have been identified in approximately 17% to 34% and 7% of acute myeloid leukemia (AML) patients, respectively.2-6 The ITD mutations appear to activate the tyrosine kinase domain of the FLT3 receptor through constitutive dimerization and result in autophosphorylation of the receptor.7 Constitutively activated FLT3 contributes to leukemic transformation and portends an especially poor prognosis for patients with this mutation.8-10

Uncontrolled proliferation, antiapoptotic advantages, and a block in differentiation characterize acute leukemia. The role of FLT3/ITDs in giving a proliferative and antiapoptotic advantage to cells has been reported.11,12 Recently, we demonstrated that FLT3/ITD expression also contributes to a blockage of granulocyte colony-stimulating factor (G-CSF)–mediated differentiation in 32Dcl3 (32D) cells.13 However, the mechanism by which this block occurs is not known.

The development of mature granulocytes from hematopoietic progenitor cells is regulated by a complex network of transcription factors.14 The family of CCAAT/enhancer-binding proteins (C/EBPs) plays a key role in myeloid differentiation. One member of the C/EBP family, C/EBP{alpha}, is prominently expressed in early myeloid progenitor cells, and its expression decreases as these progenitors further differentiate into mature granulocytes.15 Absence of neutrophil development and G-CSF signaling is observed in C/EBP{alpha}-deficient mice.16 Overexpression of C/EBP{alpha} in the HL-60 and U937 human leukemia cell lines or murine 32D cells leads to the development of neutrophils.17,18 Recently, mutations in the C/EBP{alpha} gene have been identified in AML. The mutant C/EBP{alpha} blocks wild-type C/EBP{alpha} DNA binding and transactivation of granulocyte target genes in a dominant-negative manner, with a resultant failure in granulocytic differentiation.19

PU.1 is a member of the Ezb transformation–specific sequence (Ets) family of transcription factors and is expressed in granulocytic, monocytic, and B-lymphoid cells.20,21 PU.1 expression levels increase during the differentiation of granulocytes.21-23 PU.1-deficient mice exhibit defects in the development of neutrophils, macrophages, and B cells.24,25 Mutant alleles of the PU.1 gene have been described in 9 of 126 AML patients in one study.26 DNA binding and transactivation of the macrophage-CSF (M-CSF) receptor promoter, a direct PU.1 target gene, were deficient in most PU.1 mutants, which affected the DNA-binding domain. Additionally, these mutations impaired the ability of PU.1 to synergize with PU.1-interacting proteins such as AML1 or c-Jun in the activation of PU.1 target genes, suggesting disruption of PU.1 function contributes to the block in differentiation found in AML patients. Both C/EBP{alpha} and PU.1 are needed for the full commitment and differentiation of the granulocytic lineage.14 During terminal granulocytopoiesis, C/EBP{alpha} induces PU.1 gene expression.18,27 A recent report using microarray data showed that FLT3/ITD can suppress C/EBP{alpha} and PU.1 expression in comparison with wild-type FLT3.28 Whether suppression of C/EBP{alpha} plays a role in the blockage of differentiation mediated by FLT3/ITD is unknown.

To investigate the possible mechanism of FLT3/ITD-mediated block in differentiation of 32D cells, the effect of FLT3/ITD expression on C/EBP{alpha} and its downstream target, PU.1, was examined in this study. Induction of C/EBP{alpha} and PU.1 expression in response to G-CSF was suppressed in FLT3/ITD-expressing 32D cells. This suppression could be overcome through inhibition of FLT3 tyrosine kinase activity. Similar results were also observed in primary blast samples from some FLT3/ITD-positive AML patients in response to therapy with a FLT3 kinase inhibitor. Forced expression of C/EBP{alpha} was able to induce PU.1 expression and overcome the FLT3/ITD-mediated block in granulocytic differentiation of 32D cells. This supports the FLT3/ITD-mediated suppression of C/EBP{alpha} expression as the major mechanism by which FLT3/ITD signaling contributes to blocked differentiation.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Reagents

Recombinant murine interleukin 3 (IL-3) was purchased from Pepro Tech (Rocky Hill, NJ). Rabbit antihuman FLT3, rabbit antirat C/EBP{alpha}, rabbit antimouse PU.1 antibody, and mouse antihuman heat shock protein 90 (HSP 90) antibody were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Mouse antihuman CD13, CD33, CD117, CD34, CD38, human leukocyte antigen–DR (HLA-DR), CD15, and CD11b monoclonal antibodies were purchased from Becton Dickinson (San Jose, CA). Monoclonal mouse antiphosphotyrosine antibody (4G10) and recombinant protein A–agarose were purchased from Upstate Biotechnology (Lake Placid, NY). Horseradish peroxidase–conjugated secondary antibody and enhanced chemiluminescence (ECL) detection system were from Amersham (Arlington Heights, IL). CEP-701 was graciously provided by Cephalon (West Chester, PA).

Cells

The 32D cells were cultured in RPMI 1640, supplemented with 1 ng/mL recombinant mouse IL-3, 10% heat-inactivated fetal calf serum (FCS), and antibiotics (penicillin and streptomycin) at 37°C with 5% CO2. For the differentiation assay, 32D cells were washed twice with phosphate-buffered saline (PBS) and then transferred to medium containing 20 ng/mL G-CSF (Amgen, Thousand Oaks, CA).

The 32D cells expressing the C/EBP{alpha}-estrogen receptor ligand-binding domain fusion gene, 32D/{alpha}-ER, have been previously described.18 The 32D/{alpha}-ER cells were cultured in IL-3 containing Iscove modified Dulbecco medium (IMDM) supplemented with 2 µg/mL puromycin. To induce activation of C/EBP{alpha}-ER, estradiol at a final concentration of 1 µM was added to the medium.

Primary AML blast cells from bone marrow were collected after obtaining patient consent under a Johns Hopkins University Institutional Review Board–approved protocol and purified by Ficoll-Hypaque (Amersham, Piscataway, NJ) density centrifugation.

DNA constructs and retroviral transduction

Constructs of pBabePuro retroviral vectors containing FLT3/ITD or wild-type FLT3 and transduction of 32D cells with these vectors have been described previously.13 Similarly, pBabe-Neo retroviral vectors containing FLT3/ITD or wild-type FLT3 were made and used to transduce 32D/{alpha}-ER cells. Stable transfectants were then selected by limiting dilution in 96-well plates with 1 mg/mL G418.

Northern blot analysis

Total RNA was extracted from 1 x 107 cells (RNeasy Mini Kit; Qiagen, Valencia, CA). The RNA samples were separated on 1% formaldehyde-denaturing agarose gels and transferred to nylon membranes (NEN, Boston, MA). The cDNAs of C/EBP{alpha}, PU.1, myeloperoxidase (MPO), lysozyme, lactoferrin, and actin were used as probes. All probes were labeled with 32P–deoxycytidine triphosphosphate (32P-dCTP) using a random primer labeling kit (Stratagene, Cedar Creek, TX). Probes were hybridized to blots in 6 x SSC (saline sodium citrate), 50% formamide, 0.1% SDS (sodium dodecyl sulfate), 2 x Denhardt reagent, and 0.125 mg/mL salmon sperm DNA at 42°C for 16 hours. The membranes were washed twice with 2 x SSC/0.1% SDS for 30 minutes at 42°C and then exposed to XAR film (Kodak, Rochester, NY) at –80°C for 2 to 24 hours.

Immunoprecipitation and Western blot analysis

Cells were washed twice with ice-cold PBS and lysed for 30 minutes in ice-cold nonidet P-40 (NP-40) lysis buffer (20 mM Tris-HCl, pH 7.4; 150 mM NaCl; 100 mM NaF; 10% glycerol; 1% NP-40; and 10 mM EDTA [ethylenediaminetetraacetic acid]) containing protease and phosphatase inhibitors (2 mM sodium orthovanadate, 50 µg/mL antipain, 5 µg/mL aprotinin, 1 µg/mL leupeptin, and 10 µg/mL phenylmethylsulfony fluoride; Sigma, St Louis, MO). To detect FLT3, clarified lysates (500 µg) were incubated with antibody against human FLT3 and with protein A–agarose at 4°C. The immunoprecipitates were washed 3 times with ice-cold TBS-T (10 mM Tris-HCl, pH 7.4; 100 mM NaCl; 0.1% Tween-20), resuspended in SDS sample buffer, heated, and separated by 8% SDS–polyacrylamide gel electrophoresis (PAGE) gel. Gels were blotted onto polyvinylidene fluoride (PVDF) membrane (Millipore, Bedford, MA) and stained with the indicated antibody. Antibody binding was detected by incubation with a horseradish peroxidase–conjugated secondary antibody, followed by chemiluminescence detection. For detection of PU.1, 50 µg of protein lysate was resuspended in SDS sample buffer, electrophoresed in 10% SDS-PAGE gels, and then transferred to PVDF membrane, and blotted with anti-PU.1 antibody. Protein lysate used for detection of C/EBP{alpha} was prepared from 1 x 106 cells that were lysed in 2 x Sample buffer (100 mM Tris-HCl, pH 6.8; 4% SDS; 20% glycerol; 200 mM dithiothreitol; 4% {beta}-Mercaptoethanol). The lysates were subjected to Western blotting with antibody against C/EBP{alpha}.

Cellular differentiation and proliferation assay

Cellular differentiation was assessed either morphologically or immunophenotypically. Wright-Giemsa stains of cytospun 32D cells were examined by x 40 microscopy. Antigen expression profiles of primary AML blasts were determined by multiparameter flow cytometric analysis using a FACSCalibur automated flow cytometry system (Becton Dickinson). Cellular proliferation was determined by counting the viable cell numbers on the basis of trypan blue exclusion.

Cell cycle analysis

Cells (1 x 106) were washed twice with PBS, fixed with 70% methanol, treated with 20 µg/mL RNase, and stained with 50 µg/mL propidium iodide. Cells were subjected to flow cytometric analysis of DNA content using a flow cytometer (FACSort; Becton Dickinson). The percentages of cell cycle distribution were calculated by Cell Quest software (Becton Dickinson).

Real-time reverse transcription–polymerase chain reaction (RT-PCR)

Total RNA was isolated from patients' blast cells using Rneasy columns (Qiagen). The cDNA was synthesized from 2 µg RNA from each sample using SuperScript First-Strand Synthesis System (Invitrogen, Carlsbad, CA) in a 40-µL reaction system. Two microliters of cDNA was amplified using iQ SYBR Green Supermix (Bio-Rad, Hercules, CA) in the iCycler iQ Real-Time Detection System (Bio-Rad). PCR were performed at 50°C for 2 minutes, at 95°C for 3 minutes, followed by 40 cycles of denaturation at 95°C for 15 seconds, and annealing and extension at 60°C for 1 minute. The primer pairs were as follows: C/EBP{alpha}: 5' TGGACAAGAACAGCAACGAG 3', 5' TTGTCACTGGTCAGCTCCAG 3'; PU.1: 5' GTGCCCTATGACACGGATCT 3', 5' GAAGCTCTCGAACTCGCTGT 3'; actin: 5' TGCGTGACATTAAGGAGAAG 3', 5' GCTCGTAGCTCTTCTCCA 3'.

Relative gene expression levels were calculated using standard curve generated by serial dilution of plasmids containing human C/EBP{alpha}, PU.1, or actin cDNA. The measured amount of C/EBP{alpha} and PU.1 expression in each sample was normalized by actin expression.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Induction of C/EBP{alpha} and PU.1 by G-CSF is inhibited in 32D cells expressing FLT3/ITD

Normally, induction of C/EBP{alpha} and PU.1 expression is observed during G-CSF–mediated differentiation of 32D cells. In order to investigate whether FLT3/ITD interferes with induction of C/EBP{alpha} and PU.1 expression, stable transfectants of 32D cells expressing FLT3/ITD (32D/FLT3/ITD), wild-type FLT3 (32D/FLT3), or empty vector (32D/pBabePuro) were established. Clones expressing comparable levels of FLT3/ITD or FLT3 were selected to allow a direct comparison of the effects of the different constructs as previously described.13 The 32D/FLT3/ITD are unable to differentiate to granulocytes in response to G-CSF, both morphologically and functionally, in contrast to 32D/FLT3 and 32D/pBabePuro cells.13 In this study, transfected 32D cells were exposed to G-CSF (20 ng/mL) for 9 days and the expression of C/EBP{alpha} and PU.1 was analyzed in 3 independent clones (representative data are shown). G-CSF was unable to induce C/EBP{alpha} and PU.1 expression in 32D/FLT3/ITD cells (Figure 1A-B). The basal level of PU.1 expression was also suppressed (Figure 1B lane 11 vs 1 and 6). In contrast, induction of C/EBP{alpha} and PU.1 was observed by day 1 in 32D/FLT3 and 32D/pbabePuro cells in response to G-CSF (Figure 1A-B). FLT3 ligand (FL) stimulation of 32D/FLT3 cells did not suppress induction of C/EBP{alpha} or PU.1 (data not shown). Thus, induction of C/EBP{alpha} and PU.1 expression is inhibited in 32D cells due to the expression of FLT3/ITD.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 1.. Induction of C/EBP{alpha} and PU.1 by G-CSF is inhibited in 32D cells expressing FLT3/ITD. The 32D/pBabePuro, 32D/FLT3, and 32D/FLT3/ITD cells were washed and transferred from medium containing IL-3 (1 ng/mL) to medium containing G-CSF (20 ng/mL) for 9 days. Every other day, fresh G-CSF–containing medium was added to cells to replace the old medium. (A) Total cellular RNA from 32D/pBabe (lanes 1-6), 32D/FLT3 (lanes 7-12), and 32D/FLT3/ITD (lanes 13-18) cells was prepared from 1 x 107 cells after 0, 1, 3, 5, 7, and 9 days in G-CSF. RNA (10 µg) from each time point was then subjected to Northern blotting with a 1.1-kb NcoI-NcoI fragment of rat C/EBP{alpha} (top). The same membrane was stripped and then reprobed with actin cDNA probe (bottom). (B) Total protein lysates from 32D/pBabe (lanes 1-5), 32D/FLT3 (lanes 6-10), and 32D/FLT3/ITD (lanes 11-15) cells were prepared from 1 x 107 cells after 0, 1, 2, 3, and 4 days in G-CSF. Protein lysates (50 µg) from each time point were then subjected to Western blotting with antibody against PU.1 (top). The same membrane was stripped and then incubated with antibody against HSP 90 (bottom).

 

Inhibition of FLT3 tyrosine kinase activity restores G-CSF–mediated C/EBP{alpha} and PU.1 induction in 32D/FLT3/ITD cells

To further confirm that FLT3/ITD-mediated constitutive activation of FLT3 receptor leads to the suppression of C/EBP{alpha} and PU.1 expression in 32D/FLT3/ITD cells, CEP-701 was used to inhibit FLT3 tyrosine kinase activity. CEP-701 is an indolocarbazole derivative that is very potent (50% inhibitory concentration [IC50]: 2 nM) for inhibiting FLT3 in BaF3/FLT3/ITD and 32D/FLT3/ITD cell lines, as well as primary AML samples expressing FLT3/ITDs.13,29 In the presence of 5 nM CEP-701 and 20 ng/mL G-CSF, induction of C/EBP{alpha} and PU.1 in 32D/FLT3/ITD cells was detected by day 3 (Figure 2A lanes 10-14; Figure 2B lanes 8-10; Figure 2C lanes 10-12). This restoration of C/EBP{alpha} and PU.1 induction was also observed in 2 additional clones (data not shown) and was accompanied by morphologic differentiation and up-regulation of myeloid-specific differentiation markers including MPO and lysozyme.13 Thus, the tyrosine kinase activity of FLT3/ITD is required for the observed inhibition of C/EBP{alpha} and PU.1 expression.



View larger version (63K):
[in this window]
[in a new window]
 
Figure 2.. CEP-701 restores G-CSF–mediated induction of C/EBP{alpha} and PU.1 expression in 32D/FLT3/ITD cells. (A) 32D/FLT3/ITD cells were treated without (lanes 1-7) or with (lanes 8-14) CEP-701 (5 nM) in the presence of G-CSF (20 ng/mL) with replacement of the medium every other day. Total cellular RNA was prepared from 1 x 107 32D/FLT3/ITD cells on days 0, 1, 3, 5, 7, 9, and 11. RNA (10 µg from each sample) was then subjected to Northern blotting with C/EBP{alpha} and actin cDNA probes. (B) Total protein lysates were prepared from 1 x 106 32D/FLT3/ITD cells on days 0, 1, 3, 7, and 9 treated without (lanes 1-5) or with (lanes 6-10) 5 nM CEP-701 in the presence of G-CSF. The whole protein lysates from each time point were then subjected to Western blotting with antibody against C/EBP{alpha} and HSP 90. Protein lysates from parental 32D cells (lane 11) were used as a positive control. (C) Total protein lysates were prepared from 1 x 107 32D/FLT3/ITD cells on days 0, 1, 2, 3, 4, and 5 treated without (lanes 1-6) or with (lane 7-12) 5 nM CEP-701 in the presence of G-CSF. Protein lysates (50 µg) from each time point were then subjected to Western blotting with antibody against PU.1 and HSP 90.

 

Inhibition of FLT3 signaling up-regulates C/EBP{alpha} and PU.1 expression and leads to increased expression of differentiation markers in blasts of 2 of 3 FLT3/ITD-positive patients receiving an oral FLT3 inhibitor

Expression of C/EBP{alpha} is required for the differentiation of myeloid lineage cells. If C/EBP{alpha} expression is inhibited due to FLT3/ITD signaling, an up-regulation of C/EBP{alpha} expression might follow the inhibition of FLT3 tyrosine kinase activity. Several FLT3/ITD-positive AML patients have participated in a clinical trial of oral CEP-701 at our institute. Sufficient bone marrow blasts for analysis of C/EBP{alpha} expression by Northern blotting were available from one patient and were examined prior to and after 4 weeks of therapy with CEP-701. This bone marrow sample consisted of more than 90% blasts by visual inspection before and after 4 weeks of therapy. After treatment with CEP-701 for 4 weeks, an increase of C/EBP{alpha} expression was observed (Figure 3A lane 2 vs 1). Real-time RT-PCR was also used to examine expression of C/EBP{alpha} and PU.1 in the blasts of 3 patients before and after treatment with a FLT3 tyrosine kinase inhibitor. More than a 2-fold increase of C/EBP{alpha} and PU.1 expression was observed in patient no. 2 and no. 3, while little change was observed in patient no. 1 (Figure 3B). Patient no. 2 is the same patient whose Northern blots appear in Figure 3A. To study whether or not any signs of differentiation occurred due to the increased level of C/EBP{alpha} and PU.1 expression, these blast samples were analyzed by flow cytometric analysis. In patient no. 2, the blasts prior to therapy were positive for CD38 and HLA-DR, as well as the myeloid-associated markers CD13, CD33, and CD117. The blast population showed little expression of CD15 and CD11b, markers associated with myeloid differentiation.30,31 After 4 weeks of FLT3 inhibitor therapy, the bone marrow still consisted of more than 90% blasts by morphologic examination. When analyzed by flow cytometric analysis, the blasts now showed signs of differentiation with an increase of CD15 expression from 4.0% to 51.5% (Figure 3C). The population of leukemic cells from patient no. 3 showed an immunophenotypic profile similar to that noted in patient no. 2 prior to CEP-701 therapy. After therapy, the blasts showed evidence of differentiation, with complete loss of CD34, HLA-DR, and CD117 expression, and increased CD11b expression from 11.8% to 70.0% (Figure 3D). In contrast, the posttherapy marrow specimen from patient no. 1 showed little in the way of immunophenotypic changes in the blast population. These data suggest that inhibition of FLT3 tyrosine kinase activity may reverse the suppression of C/EBP{alpha} and PU.1 expression and induce some signs of differentiation in at least some cases of AML.



View larger version (48K):
[in this window]
[in a new window]
 
Figure 3.. Inhibition of FLT3 kinase activity leads to an up-regulation of C/EBP{alpha} and PU.1 and an increase in the expression of differentiation markers in blasts of 2 of 3 FLT3/ITD-positive AML patients. (A) AML bone marrow blasts were collected before and after 4 weeks of treatment with CEP-701 from a FLT3/ITD-positive AML patient who was enrolled in the CEP-701 clinical trial and whose bone marrow blasts did not decrease with therapy. Total cellular RNA was prepared and 7 µg from each sample was subjected to sequential Northern blotting with a 0.7-kb EcoRI-HindIII fragment of human C/EBP{alpha} cDNA17 and actin cDNA probe. (B) Bone marrow blasts were obtained before and after 2 or 4 weeks of treatment with CEP-701 from 3 FLT3/ITD-positive AML patients whose bone marrow did not show a decrease of blasts in response to therapy. C/EBP{alpha} and PU.1 mRNA expression were analyzed using real-time RT-PCR analysis. Levels of C/EBP{alpha} and PU.1 were expressed relative to actin. Error bars indicate SD. (C-D) Bone marrow blasts were collected prior to and after 2 or 4 weeks of treatment with CEP-701 from 2 FLT3/ITD-positive AML patients. Antigen expression profiles of these blasts were determined by multiparameter flow cytometric analysis. AML blasts, characterized by low side-scattering value and expression of CD45, CD117, and CD33 (data not shown), were specifically gated (left). Expression of CD15 or CD11b by these blasts was then analyzed (right).

 

FLT3/ITD is constitutively autophosphorylated in 32D cells expressing C/EBP{alpha}-ER and transforms these cells to IL-3–independent growth

If the FLT3/ITD-mediated block of differentiation in 32D cells is caused by its suppression of C/EBP{alpha} expression, forced expression of C/EBP{alpha} might be expected to overcome the blockage of differentiation. To test this hypothesis, FLT3/ITD, wild-type FLT3, and pBabeNeo vector were introduced into 32D/{alpha}-ER cells via retroviral transduction. The 32D/{alpha}-ER cells are 32D cells expressing a fusion protein (C/EBP{alpha}-ER) containing the entire C/EBP{alpha} polypeptide and the ligand-binding domain of the estrogen receptor under control of the long terminal repeat (LTR) promoter. C/EBP{alpha}-ER is inactive but becomes active in the presence of estradiol and activates transcription from C/EBP{alpha}-binding sites.32 Stable expression of FLT3/ITD and FLT3 by subclones was confirmed by Western blotting of cell lines cloned by limiting dilution. Clones expressing comparable levels of FLT3/ITD (32D/{alpha}-ER/FLT3/ITD) or FLT3 (32D/{alpha}-ER/FLT3) were selected (Figure 4). Wild-type FLT3-transfected 32D/{alpha}-ER cells showed little endogenous phosphorylation (Figure 4 lane 2). In contrast, FLT3 was tyrosine phosphorylated in 32D/{alpha}-ER/FLT3/ITD cells even in the absence of added FL (Figure 4 lane 3). The 32D/{alpha}-ER/FLT3/ITD cells proliferated without the addition of IL-3, whereas wild-type FLT3– and pBabeNeo vector–transfected 32D/{alpha}-ER cells required IL-3 for their growth (data not shown). Subsequent experiments with 32D/{alpha}-ER/FLT3/ITD cells were performed in the absence of IL-3 and G-CSF.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 4.. FLT3/ITD is constitutively autophosphorylated in 32D cells expressing C/EBP{alpha}-ER. Total cellular protein extracts derived from 1 x 107 32D/{alpha}-ER cells transduced with the pBabeNeo vector, pBabeNeo-FLT3, or pBabeNeo-FLT3/ITD were immunoprecipitated with anti-FLT3 antibody. The immunoprecipitates were resolved by 8% SDS-PAGE and subjected to immunoblot analysis with antiphosphotyrosine antibody 4G10 (top). The same membrane was stripped and reprobed with anti-FLT3 antibody (bottom).

 

Activation of C/EBP{alpha} induces PU.1 expression, cell cycle arrest, and differentiation in 32D cells expressing FLT3/ITD

To determine whether PU.1 expression is directly suppressed by FLT3/ITD signaling or is instead a result of C/EBP{alpha} suppression, we examined its expression in 32D/{alpha}-ER/FLT3/ITD cells. When C/EBP{alpha} is activated by estradiol, PU.1 expression was readily detected by Northern blotting at the earliest time point examined (Figure 5 lanes 2-4). Induction of PU.1 was also observed in 32D/{alpha}-ER/FLT3 and 32D/{alpha}-ER/pBabeNeo cells activated by estradiol (data not shown). This data confirms that PU.1 is a downstream target of activated C/EBP{alpha} and is suppressed in FLT3/ITD-expressing cells as a result of C/EBP{alpha} suppression.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 5.. Forced expression of C/EBP{alpha} induces PU.1 expression in 32D cells expressing FLT3/ITD. The 32D/{alpha}-ER/FLT3/ITD cells were cultured in medium containing 1 µM estradiol for 48 hours. Total cellular RNA from 1 x 107 cells was extracted 0, 8, 24, and 48 hours after incubation with estradiol. Ten micrograms of RNA from each sample was subjected to sequential Northern blotting with PU.1 and actin cDNA probe.

 

To examine the effect of C/EBP{alpha} expression on the proliferation of 32D cells expressing FLT3/ITD, viable cells were counted daily based on trypan blue exclusion. Activation of C/EBP{alpha} by estradiol induced a rapid growth arrest compared with the growth curve of these cells without estradiol treatment (Figure 6A). To rule out the possibility that estradiol itself affected the proliferation of these cells, 32D/FLT3/ITD cells were also incubated with estradiol for 3 days. Proliferation of these cells was unaffected (Figure 6A). Similar results were also observed from other clones (data not shown). It was also noted that 32D/{alpha}-ER/FLT3/ITD cells grew more slowly when compared with 32D/FLT3/ITD cells. This may be due to the leakiness of C/EBP{alpha}-ER activity in the absence of estrogen or activation of C/EBP{alpha}-ER by the small amounts of estrogen in the growth medium.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 6.. Forced expression of C/EBP{alpha} leads to growth arrest and cell cycle arrest in 32D cells expressing FLT3/ITD. (A) A quantity of 1 x 106 32D/{alpha}-ER/FLT3/ITD and 32D/FLT3/ITD cells were cultured in the absence or presence of estradiol (1 µM) for 3 days. Viable cells were counted daily on the basis of trypan blue exclusion. Results shown are the means from triplicate assays. Error bars indicate SD. (B) The 32D/{alpha}-ER/FLT3/ITD and 32D/FLT3/ITD cells were incubated with estradiol for 24 hours. Cells (1 x 106) were collected before and after exposure to estradiol, treated with 20 µg/mL RNase, and stained with 50 µg/mL propidium iodide. Cells were subjected to flow cytometric analysis of DNA content. Data represented were from 1 of 3 different experiments.

 

To investigate whether or not activation of C/EBP{alpha} blocks the proliferation of 32D/{alpha}-ER/FLT3/ITD cells by inducing cell cycle arrest, cell cycle status was analyzed in 3 independent clones (representative data are shown). After 24 hours of estradiol treatment, the proportion of 32D/{alpha}-ER/FLT3/ITD cells in G0/G1 phase increased from 57.7% to 72.3% and the percentage of cells in S phase decreased from 32.8% to 14.9% (Figure 6B; Table 1). This indicates a blockage of the G1 to S phase transition in these cells. Estradiol itself did not affect the cell cycle status of 32D/FLT3/ITD cells (Figure 6B; Table 1).


View this table:
[in this window]
[in a new window]
 
Table 1.. Cell cycle analysis of 32D/{alpha}-ER/FLT3/ITD cells exposed to estradiol

 

We next assessed whether forced expression and activation of C/EBP{alpha} would result in the differentiation of 32D/{alpha}-ER/FLT3/ITD cells. Activation of C/EBP{alpha} by estradiol for 2 days promoted rapid morphologic differentiation to granulocytes (Figure 7A; Table 2). To confirm the findings of morphologic maturation, several markers of functional maturation were also examined by Northern blotting. Induction of MPO, lysozyme, and lactoferrin were all seen in 32D/{alpha}-ER/FLT3/ITD cells upon exposure to 1 µM estradiol (Figure 7B). Similar results were also obtained from 2 additional clones of 32D/{alpha}-ER/FLT3/ITD cells (data not shown). Neither morphologic (Table 2) nor markers of differentiation (data not shown) were observed in 32D/FLT3/ITD cells treated with estradiol alone. These results, taken together, indicate that induced expression of C/EBP{alpha} was able to overcome the blockage of differentiation caused by the expression of FLT3/ITD.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 7.. Forced expression of C/EBP{alpha} induces differentiation of 32D cells expressing FLT3/ITD. The 32D/{alpha}-ER/FLT3/ITD cells were incubated with 1 µM estradiol for 2 days. (A) Cytospins were prepared on days 0 and 2. The morphologic features of the cells were visualized by means of Wright-Giemsa staining followed by light microscopy. Original magnification x 40. (B) Total cellular RNA was prepared from 1 x 107 cells 0, 8, 24, and 48 hours after incubation with estradiol. RNA (10 µg from each sample) was then subjected to sequential Northern blotting with MPO, lysozyme, lactoferrin, and actin cDNA probes.

 

View this table:
[in this window]
[in a new window]
 
Table 2.. Forced expression of C/EBP{alpha} induces differentiation of 32D cells expressing FLT3/ITD

 


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
AML is characterized by the uncontrolled proliferation of myeloid cells that accumulate at various stages of development, where their further differentiation is blocked. FLT3-activating mutations are the most common genetic alteration that occurs in AML.2 The presence of FLT3/ITD mutations results in increased leukocytosis and a poor prognosis in patients expressing them.10,33,34 We previously showed that expression of FLT3/ITD mutations in a myeloid precursor cell line causes a block in G-CSF–mediated granulocytic differentiation.13 Thus, FLT3/ITD-transformed hematopoietic cells, such as 32D cells, have a phenotype resembling AML; that is, they show growth factor–independent proliferation and survival, and an altered response to differentiative stimuli.8 Both a murine bone marrow transplant model and transgenic mice expressing constitutively activated FLT3 demonstrate that FLT3 is capable of inducing myeloproliferative disease but is not sufficient by itself to cause AML.35,36 One explanation for the difference of FLT3/ITD-mediated effects on differentiation of primary hematopoietic cells versus 32D cells is that 32D cells are immortalized and thus are already partially transformed. These differences have also been observed in studies on the effects of promyelocytic leukemia/retinoic acid receptor {alpha} (PML/RAR{alpha}), the fusion protein resulting from t(15;17) in M3 AML, on myeloid differentiation. Expression of PML/RAR{alpha} in the U937 myeloid cell line inhibits the ability of U937 cells to differentiate in response to several stimuli.37 In contrast, expression of PML/RAR{alpha} in transgenic mice is not sufficient to cause leukemia in any mouse during the first year, implying the necessity of accumulating additional "hits" to fully block differentiation.38 Retroviral transduction of FLT3/ITD into bone marrow cells obtained from PML/RAR{alpha} transgenic mice results in a short latency acute promyelocytic leukemia–like disease with complete penetrance, suggesting that FLT3 signaling can cooperate with PML/RAR{alpha} to give the complete differentiation block that characterizes leukemia.39

Granulopoiesis is a complex process governed by a number of transcription factors.14 Among them, C/EBPs are key regulators of granulopoiesis. We observed inhibition of C/EBP{epsilon} induction as a consequence of FLT3/ITD expression in our previous report. However, C/EBP{epsilon} is normally induced relatively late in the process of myeloid differentiation and thus, this block is likely a consequence, rather than a cause, of inhibited differentiation. Since C/EBP{alpha} is known to play an important role during early granulopoiesis, it is a major focus of this study. The critical role of C/EBP{alpha} in myeloid development was proved when C/EBP{alpha} knockout mice were generated and these mice completely lack myeloid development. Induction of C/EBP{alpha} function in primary human CD34+ cells leads to granulocytic differentiation.40 Normally, induction of C/EBP{alpha} expression is seen as an early event after G-CSF stimulation of 32D cells. We observed C/EBP{alpha} induction in parental and wild-type FLT3-expressing 32D cells in response to G-CSF, and this induction was accompanied by granulocytic differentiation. In contrast, G-CSF was unable to induce C/EBP{alpha} expression in 32D cells expressing FLT3/ITD, and this was accompanied by a block in differentiation. Thus, suppression of C/EBP{alpha} expression might represent the crucial molecular event underlying the blockage of differentiation of 32D cells caused by the expression of FLT3/ITD.

Little information is known about the regulation of C/EBP{alpha} expression. It has been shown that the C/EBP{alpha} promoter can be autoactivated.41,42 Recently, it has been reported that BCR-ABL regulates C/EBP{alpha} expression through induction of heterogeneous ribonucleoprotein E2 (hnRNP E2), which inhibits the translation of C/EBP{alpha} mRNA.43 There are no previous reports regarding the regulation of C/EBP{alpha} RNA or protein stability, which could also affect the expression level of C/EBP{alpha}. Based on the findings in this study, that C/EBP{alpha} RNA levels are suppressed in FLT3/ITD cells, it is likely that the mechanism involves C/EBP{alpha} transcription or RNA stability. Future investigations will be required to differentiate between these mechanisms.

The ability of the FLT3 tyrosine kinase inhibitor CEP-701 to restore induction of C/EBP{alpha} expression in 32D/FLT3/ITD cells in response to G-CSF indicates that the suppression of C/EBP{alpha} depends on the tyrosine kinase activity of FLT3/ITD. In 2 of 3 patients with primary AML receiving the FLT3 inhibitor CEP-701, inhibition of FLT3 signaling also resulted in the up-regulation of C/EBP{alpha} and expression of several markers of differentiation by the leukemic cells. This implies that FLT3/ITD activates signaling pathways that can lead to suppression of C/EBP{alpha} expression in primary AML cells as well as in 32D cells. Forced expression of C/EBP{alpha} restores the differentiation of 32D cells expressing FLT3/ITD, reinforcing the hypothesis that suppression of C/EBP{alpha} expression may be one of the essential molecular events required for the blockage of differentiation in these cells.

Forced expression of C/EBP{alpha} not only promotes a rapid differentiation in 32D cells expressing FLT3/ITD but also leads to growth arrest. This observation is consistent with the findings that C/EBP{alpha} is expressed at high levels in terminally differentiated cells, down-regulated during proliferation, and a strong inhibitor of cellular proliferation when overexpressed in cultured cells.32,44-46 In addition, hepatocytes from newborn C/EBP{alpha}-deficient mice display increased proliferative activity, and hyperproliferation of alveolar type II cells is also seen in the lungs of these mice.47 More recently, mutations that inactivate C/EBP{alpha} have been described in patients with AML.19 Considering this data, suppression of C/EBP{alpha} expression may contribute not only to a block in differentiation but also to increased proliferation of transformed cells with the resultant higher blast counts observed in patients with FLT3/ITD-positive AML.

FLT3/ITD signaling contributes to the block in differentiation in the clinical AML cases, but other mutations may also contribute to this effect. Inhibition of the FLT3 signaling, therefore, induces differentiation (as reflected in increased CD11b and CD15 expression in patient no. 2 and no. 3 after CEP-701 treatment) but only to a partial degree. Thus it may explain why no obvious morphologic differentiation was observed in patients no. 2 and 3 after therapy with CEP-701. It is possible that a combination of a FLT3 inhibitor with a differentiating agent would act synergistically to induce clinically significant (ie, morphologic) differentiation. Likewise, C/EBP{alpha} is certainly not the only transcription factor regulating differentiation. The other "hits" that occur in acute leukemias often affect other transcription factors that likely also contribute to the observed block in differentiation. In addition, in one patient C/EBP{alpha} was expressed at a significant level. This implies that other pathways are also capable of affecting C/EBP{alpha} expression and that in this patient's blasts, pathways other than C/EBP{alpha} are the dominant mechanism blocking differentiation.

PU.1 is another critical transcription factor during early granulopoiesis. It has been previously reported that C/EBP{alpha}-ER induced endogenous PU.1 RNA expression within 8 hours in both 32D and Ba/F3 cells, even in the presence of cycloheximide, indicating that C/EBP{alpha} directly activates the PU.1 gene.18,27 Therefore, PU.1 may act downstream of C/EBP{alpha} to induce myeloblasts to undergo granulocytic differentiation. However, PU.1 mRNA is also present in fetal liver cells derived from C/EBP{alpha} null mice.48 Thus, PU.1 transcription is not wholly dependent on C/EBP{alpha}. In this study, PU.1 induction, which normally occurs during G-CSF–mediated differentiation of wild-type FLT3-expressing and parental 32D cells, was not detected in FLT3/ITD-expressing 32D cells. Activation of C/EBP{alpha}-ER was able to restore the induction of PU.1 expression in FLT3/ITD-expressing 32D cells. In addition, in both FLT3/ITD-positive AML patients in which FLT3 tyrosine kinase inhibitor therapy increased C/EBP{alpha} expression, an increase of PU.1 expression was also observed. Thus, these results strongly suggest that suppression of PU.1 expression due to the expression of FLT3/ITD is a consequence of inhibition of C/EBP{alpha} expression.

In summary, the data presented in this report indicates that constitutively activated FLT3/ITD mutants can lead to the suppression of C/EBP{alpha} expression. Inhibition of C/EBP{alpha} expression is likely the critical molecular event required for the differentiation arrest that was observed in 32D cells expressing FLT3/ITD and may also contribute to the block in differentiation that usually characterizes leukemic cells. Modulation of C/EBP{alpha} activity may provide a new approach to the therapy of AML.


    Acknowledgements
 
We thank Dr Kyu-tae Kim for providing actin primers for real-time RT-PCR, Dr Douglas Smith for providing primary AML blast cells from the Leukemia Bank at Johns Hopkins, Dr Daniel G. Tenen and Dr Hanna Radomska for providing the C/EBP{alpha} cDNA probe of human origin and for the C/EBP{alpha} Western blotting protocol, Shirley Fuller for technical assistance with flow cytometric analysis, and Bruce Ruggeri and Susan Jones-Bolin of Cephalon, Inc for providing CEP-701.


    Footnotes
 
Submitted June 18, 2003; accepted October 24, 2003.

Prepublished online as Blood First Edition Paper, October 30, 2003; DOI 10.1182/blood-2003-06-1978.

Supported by grants from National Cancer Institute (NCI; CA90668, CA70970, CA91177), Leukemia and Lymphoma Society, and Children's Cancer Foundation. D.S. is the Douglas Kroll Research Foundation Translational Researcher of the Leukemia and Lymphoma Society. A.D.F. is a Scholar of the Leukemia and Lymphoma Society.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Donald Small, Johns Hopkins University School of Medicine, Bunting Blaustein Cancer Research Bldg, Rm 251, 1650 Orleans St, Baltimore, MD 21231-1000; e-mail: donsmall{at}jhmi.edu.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Lyman SD, Jacobsen SE. c-kit ligand and Flt3 ligand: stem/progenitor cell factors with overlapping yet distinct activities. Blood. 1998;91: 1101-1134.[Free Full Text]

  2. Gilliland DG, Griffin JD. The roles of FLT3 in hematopoiesis and leukemia. Blood. 2002;100: 1532-1542.[Abstract/Free Full Text]

  3. Nakao M, Yokota S, Iwai T, et al. Internal tandem duplication of the flt3 gene found in acute myeloid leukemia. Leukemia. 1996;10: 1911-1918.[Medline] [Order article via Infotrieve]

  4. Yokota S, Kiyoi H, Nakao M, et al. Internal tandem duplication of the FLT3 gene is preferentially seen in acute myeloid leukemia and myelodysplastic syndrome among various hematological malignancies: a study on a large series of patients and cell lines. Leukemia. 1997;11: 1605-1609.[CrossRef][Medline] [Order article via Infotrieve]

  5. Yamamoto Y, Kiyoi H, Nakano Y, et al. Activating mutation of D835 within the activation loop of FLT3 in human hematologic malignancies. Blood. 2001;97: 2434-2439.[Abstract/Free Full Text]

  6. Abu-Duhier FM, Goodeve AC, Wilson GA, Care RS, Peake IR, Reilly JT. Identification of novel FLT-3 Asp835 mutations in adult acute myeloid leukaemia. Br J Haematol. 2001;113: 983-988.[CrossRef][Medline] [Order article via Infotrieve]

  7. Kiyoi H, Towatari M, Yokota S, et al. Internal tandem duplication of the FLT3 gene is a novel modality of elongation mutation which causes constitutive activation of the product. Leukemia. 1998; 12: 1333-1337.[CrossRef][Medline] [Order article via Infotrieve]

  8. Fenski R, Flesch K, Serve S, et al. Constitutive activation of FLT3 in acute myeloid leukaemia and its consequences for growth of 32D cells. Br J Haematol. 2000;108: 322-330.[CrossRef][Medline] [Order article via Infotrieve]

  9. Iwai T, Yokota S, Nakao M, et al. Internal tandem duplication of the FLT3 gene and clinical evaluation in childhood acute myeloid leukemia: The Children's Cancer and Leukemia Study Group, Japan. Leukemia. 1999;13: 38-43.[CrossRef][Medline] [Order article via Infotrieve]

  10. Kiyoi H NT, Nakano Y, Yokota S, et al. Prognostic implication of FLT3 and N-RAS gene mutations in acute myeloid leukemia. Blood. 1999;93: 3074-3080.[Abstract/Free Full Text]

  11. Hayakawa F, Towatari M, Kiyoi H, et al. Tandem-duplicated Flt3 constitutively activates STAT5 and MAP kinase and introduces autonomous cell growth in IL-3-dependent cell lines. Oncogene. 2000;19: 624-631.[CrossRef][Medline] [Order article via Infotrieve]

  12. Mizuki M, Fenski R, Halfter H, et al. Flt3 mutations from patients with acute myeloid leukemia induce transformation of 32D cells mediated by the Ras and STAT5 pathways. Blood. 2000;96: 3907-3914.[Abstract/Free Full Text]

  13. Zheng R, Friedman AD, Small D. Targeted inhibition of FLT3 overcomes the block to myeloid differentiation in 32Dcl3 cells caused by expression of FLT3/ITD mutations. Blood. 2002;100: 4154-4161.[Abstract/Free Full Text]

  14. Friedman AD. Transcriptional regulation of granulocyte and monocyte development. Oncogene. 2002;21: 3377-3390.[CrossRef][Medline] [Order article via Infotrieve]

  15. Scott LM, Civin CI, Rorth P, Friedman AD. A novel temporal expression pattern of three C/EBP family members in differentiating myelomonocytic cells. Blood. 1992;80: 1725-1735.[Abstract/Free Full Text]

  16. Zhang D-E, Zhang P, Wang N-D, Hetherington CJ, Darlington GJ, Tenen DG. Absence of granulocyte colony-stimulating factor signaling and neutrophil development in CCAAT enhancer binding protein {alpha}-deficient mice. Proc Natl Acad Sci U S A. 1997;94: 569-574.[Abstract/Free Full Text]

  17. Radomska HS, Huettner CS, Zhang P, Cheng T, Scadden DT, Tenen DG. CCAAT/enhancer binding protein alpha is a regulatory switch sufficient for induction of granulocytic development from bipotential myeloid progenitors. Mol Cell Biol. 1998;18: 4301-4314.[Abstract/Free Full Text]

  18. Wang X, Scott E, Sawyers CL, Friedman AD. C/EBPalpha bypasses granulocyte colony-stimulating factor signals to rapidly induce PU.1 gene expression, stimulate granulocytic differentiation, and limit proliferation in 32D cl3 myeloblasts. Blood. 1999;94: 560-571.[Abstract/Free Full Text]

  19. Pabst T, Mueller BU, Zhang P, et al. Dominant-negative mutations of CEBPA, encoding CCAAT/enhancer binding protein-alpha (C/EBPalpha), in acute myeloid leukemia. Nat Genet. 2001;27: 263-270.[CrossRef][Medline] [Order article via Infotrieve]

  20. Klemsz MJ, McKercher SR, Celada A, Van Beveren C, Maki RA. The macrophage and B cell-specific transcription factor PU.1 is related to the ets oncogene. Cell. 1990;61: 113-124.[CrossRef][Medline] [Order article via Infotrieve]

  21. Chen HM, Zhang P, Voso MT, et al. Neutrophils and monocytes express high levels of PU.1 (Spi-1) but not Spi-B. Blood. 1995;85: 2918-2928.[Abstract/Free Full Text]

  22. Oelgeschläger M, Nuchprayoon I, Lüscher B, Friedman AD. C/EBP, c-Myb, and PU.1 cooperate to regulate the neutrophil elastase promoter. Mol Cell Biol. 1996;16: 4717-4725.[Abstract]

  23. Cheng T, Shen H, Giokas D, Gere J, Tenen DG, Scadden DT. Temporal mapping of gene expression levels during the differentiation of individual primary hematopoietic cells. Proc Natl Acad Sci U S A. 1996;93: 13158-13163.[Abstract/Free Full Text]

  24. Scott EW, Simon MC, Anastasi J, Singh H. Requirement of transcription factor PU.1 in the development of multiple hematopoietic lineages. Science. 1994;265: 1573-1577.[Abstract/Free Full Text]

  25. McKercher SR, Torbett BE, Anderson KL, et al. Targeted disruption of the PU.1 gene results in multiple hematopoietic abnormalities. EMBO J. 1996;15: 5647-5658.[Medline] [Order article via Infotrieve]

  26. Mueller BU, Pabst T, Osato M, et al. Heterozygous PU.1 mutations are associated with acute myeloid leukemia. Blood. 2002;100: 998-1007.[Abstract/Free Full Text]

  27. Kummalue T, Friedman AD. Cross-talk between regulators of myeloid development: C/EBPalpha binds and activates the promoter of the PU.1 gene. J Leukoc Biol. 2003;74: 464-470.[Abstract/Free Full Text]

  28. Mizuki M, Schwable J, Steur C, et al. Suppression of myeloid transcription factors and induction of STAT response genes by AML-specific Flt3 mutations. Blood. 2003;101: 3164-3173.[Abstract/Free Full Text]

  29. Levis M, Allebach J, Tse KF, et al. A FLT3-targeted tyrosine kinase inhibitor is cytotoxic to leukemia cells in vitro and in vivo. Blood. 2002;99: 3885-3891.[Abstract/Free Full Text]

  30. Kannagi R. CD15 workshop panel report in Leukocytes Typing VI. Kishimoto T, Kikutani H, von dem Borne, et al. New York, NY: Garland Publishing; 1997.

  31. Griffin JD, Spertini O, Ernst TJ, et al. Granulocyte-macrophage colony-stimulating factor and other cytokines regulate surface expression of the leukocyte adhesion molecule-1 on human neutrophils, monocytes, and their precursors. J Immunol. 1990;145: 576-584.[Abstract]

  32. Umek RM, Friedman AD, McKnight SL. CCAAT-enhancer binding protein: a component of a differentiation switch. Science. 1991;251: 288-292.[Abstract/Free Full Text]

  33. Kiyoi H, Naoe T, Yokota S, et al. Internal tandem duplication of FLT3 associated with leukocytosis in acute promyelocytic leukemia. Leukemia. 1997;11: 1447-1452.[CrossRef][Medline] [Order article via Infotrieve]

  34. Nakano Y, Kiyoi H, Miyawaki S, et al. Molecular evolution of acute myeloid leukaemia in relapse: unstable N-ras and FLT3 genes compared with p53 gene. Br J Haematol. 1999;104: 659-664.[CrossRef][Medline] [Order article via Infotrieve]

  35. Kelly LM, Liu Q, Kutok JL, Williams IR, Boulton CL, Gilliland DG. FLT3 internal tandem duplication mutations associated with human acute myeloid leukemias induce myeloproliferative disease in a murine bone marrow transplant model. Blood. 2002;99: 310-318.[Abstract/Free Full Text]

  36. Baldwin BR, Tse K-F, Small D. Transgenic mice expressing a constitutively activated FLT3 receptor display a myeloproliferative disease phenotype [abstract]. Blood. 2001;98: 801a.

  37. Fagioli M, Grignani F, Ferrucci PF, et al. Effect of the acute promyelocytic leukemia PML/RAR alpha protein on differentiation and survival of myeloid precursors. Leukemia. 1994;8(suppl 1): S7-S11.[Medline] [Order article via Infotrieve]

  38. He LZ, Tribioli C, Rivi R, et al. Acute leukemia with promyelocytic features in PML/RARalpha transgenic mice. Proc Natl Acad Sci U S A. 1997; 94: 5302-5307.[Abstract/Free Full Text]

  39. Kelly LM, Kutok JL, Williams IR, et al. PML/RARalpha and FLT3-ITD induce an APL-like disease in a mouse model. Proc Natl Acad Sci U S A. 2002;99: 8283-8288.[Abstract/Free Full Text]

  40. Cammenga J, Mulloy JC, Berguido FJ, MacGrogan D, Viale A, Nimer SD. Induction of C/EBPalpha activity alters gene expression and differentiation of human CD34+ cells. Blood. 2003;101: 2206-2214.[Abstract/Free Full Text]

  41. Christy RJ, Kaestner KH, Geiman DE, Lane MD. CCAAT/enhancer binding protein gene promoter: binding of nuclear factors during differentiation of 3T3-L1 preadipocytes. Proc Natl Acad Sci U S A. 1991;88: 2593-2597.[Abstract/Free Full Text]

  42. Legraverend C, Antonson P, Flodby P, Xanthopoulos KG. High level activity of the mouse CCAAT/enhancer binding protein (C/EBP alpha) gene promoter involves autoregulation and several ubiquitous transcription factors. Nucleic Acids Res. 1993;21: 1735-1742.[Abstract/Free Full Text]

  43. Perrotti D, Cesi V, Trotta R, et al. BCR-ABL suppresses C/EBPalpha expression through inhibitory action of hnRNP E2. Nat Genet. 2002;30: 48-58.[CrossRef][Medline] [Order article via Infotrieve]

  44. Friedman AD, Landschulz WH, McKnight SL. CCAAT/enhancer binding protein activates the promoter of the serum albumin gene in cultured hepatoma cells. Genes Dev. 1989;3: 1314-1322.[Abstract/Free Full Text]

  45. Hendricks-Taylor LR, Darlington GJ. Inhibition of cell proliferation by C/EBP alpha occurs in many cell types, does not require the presence of p53 or Rb, and is not affected by large T-antigen. Nucleic Acids Res. 1995;23: 4726-4733.[Abstract/Free Full Text]

  46. Truong BT, Lee YJ, Lodie TA, et al. CCAAT/Enhancer binding proteins repress the leukemic phenotype of acute myeloid leukemia. Blood. 2003;101: 1141-1148.[Abstract/Free Full Text]

  47. Flodby P, Barlow C, Kylefjord H, Ahrlund-Richter L, Xanthopoulos KG. Increased hepatic cell proliferation and lung abnormalities in mice deficient in CCAAT/enhancer binding protein alpha. J Biol Chem. 1996;271: 24753-24760.[Abstract/Free Full Text]

  48. Iwama A, Zhang P, Darlington GJ, McKercher SR, Maki R, Tenen DG. Use of RDA analysis of knockout mice to identify myeloid genes regulated in vivo by PU.1 and C/EBPalpha. Nucleic Acids Res. 1998;26: 3034-3043.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
S. Fukuda, P. Singh, A. Moh, M. Abe, E. M. Conway, H. S. Boswell, S. Yamaguchi, X.-Y. Fu, and L. M. Pelus
Survivin mediates aberrant hematopoietic progenitor cell proliferation and acute leukemia in mice induced by internal tandem duplication of Flt3
Blood, July 9, 2009; 114(2): 394 - 403.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
Y. Fukuchi, M. Ito, F. Shibata, T. Kitamura, and H. Nakajima
Activation of CCAAT/Enhancer-Binding Protein {alpha} or PU.1 in Hematopoietic Stem Cells Leads to Their Reduced Self-Renewal and Proliferation
Stem Cells, December 1, 2008; 26(12): 3172 - 3181.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H.-G. Kim, K. Kojima, C. S. Swindle, C. V. Cotta, Y. Huo, V. Reddy, and C. A. Klug
FLT3-ITD cooperates with inv(16) to promote progression to acute myeloid leukemia
Blood, February 1, 2008; 111(3): 1567 - 1574.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. J. Wouters, M. A. Jorda, K. Keeshan, I. Louwers, C. A. J. Erpelinck-Verschueren, D. Tielemans, A. W. Langerak, Y. He, Y. Yashiro-Ohtani, P. Zhang, et al.
Distinct gene expression profiles of acute myeloid/T-lymphoid leukemia with silenced CEBPA and mutations in NOTCH1
Blood, November 15, 2007; 110(10): 3706 - 3714.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Schepers, A. T. J. Wierenga, D. van Gosliga, B. J. L. Eggen, E. Vellenga, and J. J. Schuringa
Reintroduction of C/EBP{alpha} in leukemic CD34+ stem/progenitor cells impairs self-renewal and partially restores myelopoiesis
Blood, August 15, 2007; 110(4): 1317 - 1325.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. Marzac, I. Teyssandier, O. Calendini, J.-Y. Perrot, A.-M. Faussat, R. Tang, N. Casadevall, J.-P. Marie, and O. Legrand
Flt3 Internal Tandem Duplication and P-Glycoprotein Functionality in 171 Patients with Acute Myeloid Leukemia
Clin. Cancer Res., December 1, 2006; 12(23): 7018 - 7024.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. Ferrari-Amorotti, K. Keeshan, M. Zattoni, C. Guerzoni, G. Iotti, S. Cattelani, N. J. Donato, and B. Calabretta
Leukemogenesis induced by wild-type and STI571-resistant BCR/ABL is potently suppressed by C/EBP{alpha}
Blood, August 15, 2006; 108(4): 1353 - 1362.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. T. J. Wierenga, H. Schepers, M. A. S. Moore, E. Vellenga, and J. J. Schuringa
STAT5-induced self-renewal and impaired myelopoiesis of human hematopoietic stem/progenitor cells involves down-modulation of C/EBP{alpha}
Blood, June 1, 2006; 107(11): 4326 - 4333.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
B. W. Parcells, A. K. Ikeda, T. Simms-Waldrip, T. B. Moore, and K. M. Sakamoto
FMS-Like Tyrosine Kinase 3 in Normal Hematopoiesis and Acute Myeloid Leukemia
Stem Cells, May 1, 2006; 24(5): 1174 - 1184.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
H. S. Radomska, D. S. Basseres, R. Zheng, P. Zhang, T. Dayaram, Y. Yamamoto, D. W. Sternberg, N. Lokker, N. A. Giese, S. K. Bohlander, et al.
Block of C/EBP{alpha} function by phosphorylation in acute myeloid leukemia with FLT3 activating mutations
J. Exp. Med., February 21, 2006; 203(2): 371 - 381.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. S. Basseres, E. Levantini, H. Ji, S. Monti, S. Elf, T. Dayaram, M. Fenyus, O. Kocher, T. Golub, K.-k. Wong, et al.
Respiratory Failure Due to Differentiation Arrest and Expansion of Alveolar Cells following Lung-Specific Loss of the Transcription Factor C/EBP{alpha} in Mice
Mol. Cell. Biol., February 1, 2006; 26(3): 1109 - 1123.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. E. Gale, R. Hills, A. R. Pizzey, P. D. Kottaridis, D. Swirsky, A. F. Gilkes, E. Nugent, K. I. Mills, K. Wheatley, E. Solomon, et al.
Relationship between FLT3 mutation status, biologic characteristics, and response to targeted therapy in acute promyelocytic leukemia
Blood, December 1, 2005; 106(12): 3768 - 3776.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. A. Whartenby, P. A. Calabresi, E. McCadden, B. Nguyen, D. Kardian, T. Wang, C. Mosse, D. M. Pardoll, and D. Small
Inhibition of FLT3 signaling targets DCs to ameliorate autoimmune disease
PNAS, November 15, 2005; 102(46): 16741 - 16746.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
I. Paz-Priel, D. H. Cai, D. Wang, J. Kowalski, A. Blackford, H. Liu, C. A. Heckman, A. F. Gombart, H. P. Koeffler, L. M. Boxer, et al.
CCAAT/Enhancer Binding Protein {alpha} (C/EBP{alpha}) and C/EBP{alpha} Myeloid Oncoproteins Induce Bcl-2 via Interaction of Their Basic Regions with Nuclear Factor-{kappa}B p50
Mol. Cancer Res., October 1, 2005; 3(10): 585 - 596.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
S. Frohling, C. Scholl, D. G. Gilliland, and R. L. Levine
Genetics of Myeloid Malignancies: Pathogenetic and Clinical Implications
J. Clin. Oncol., September 10, 2005; 23(26): 6285 - 6295.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Rosenbauer, S. Koschmieder, U. Steidl, and D. G. Tenen
Effect of transcription-factor concentrations on leukemic stem cells
Blood, September 1, 2005; 106(5): 1519 - 1524.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. Helbling, B. U. Mueller, N. A. Timchenko, J. Schardt, M. Eyer, D. R. Betts, M. Jotterand, S. Meyer-Monard, M. F. Fey, and T. Pabst
CBFB-SMMHC is correlated with increased calreticulin expression and suppresses the granulocytic differentiation factor CEBPA in AML with inv(16)
Blood, August 15, 2005; 106(4): 1369 - 1375.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Zhong, A. Takeda, R. Nazari, H. Shio, G. Blobel, and N. R. Yaseen
Carrier-independent Nuclear Import of the Transcription Factor PU.1 via RanGTP-stimulated Binding to Nup153
J. Biol. Chem., March 18, 2005; 280(11): 10675 - 10682.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Chen, M. Levis, P. Brown, K.-T. Kim, J. Allebach, and D. Small
FLT3/ITD Mutation Signaling Includes Suppression of SHP-1
J. Biol. Chem., February 18, 2005; 280(7): 5361 - 5369.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Helbling, B. U. Mueller, N. A. Timchenko, A. Hagemeijer, M. Jotterand, S. Meyer-Monard, A. Lister, J. D. Rowley, B. Huegli, M. F. Fey, et al.
The leukemic fusion gene AML1-MDS1-EVI1 suppresses CEBPA in acute myeloid leukemia by activation of Calreticulin
PNAS, September 7, 2004; 101(36): 13312 - 13317.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-06-1978v1
103/5/1883    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zheng, R.
Right arrow Articles by Small, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zheng, R.
Right arrow Articles by Small, D.
Related Collections
Right arrow Neoplasia
Right arrow Apoptosis
Right arrow Gene Expression
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2004 by American Society of Hematology         Online ISSN: 1528-0020