SEARCH:   Advanced

Blood, 1 May 2004, Vol. 103, No. 9, pp. 3544-3546. Prepublished online as a Blood First Edition Paper on December 11, 2003; DOI 10.1182/blood-2003-07-2441. This Article Abstract Full Text (PDF) All Versions of this Article: 2003-07-2441v1 103/9/3544    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Armstrong, S. A. Articles by Korsmeyer, S. J. Search for Related Content PubMed PubMed Citation Articles by Armstrong, S. A. Articles by Korsmeyer, S. J. Related Collections Neoplasia Oncogenes and Tumor Suppressors Signal Transduction Gene Expression Brief Reports Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  NEOPLASIA Brief report FLT3 mutations in childhood acute lymphoblastic leukemia Scott A. Armstrong, Meghann E. Mabon, Lewis B. Silverman, Aihong Li, John G. Gribben, Edward A. Fox, Stephen E. Sallan, and Stanley J. Korsmeyer From the Departments of Pediatric Oncology, Adult Oncology and Cancer Immunology and AIDS, Dana Farber Cancer Institute, Harvard Medical School, Boston, MA; Division of Hematology/Oncology, Children's Hospital, Boston, MA; and the Howard Hughes Medical Institute, Boston, MA.    Abstract Top Abstract Introduction Study design Results and discussion References   Activating mutations of the FLT3 receptor tyrosine kinase are common in acute myelogenous leukemia (AML) but are rare in adult acute lymphoblastic leukemia (ALL). We have recently shown that FLT3 is highly expressed and often mutated in ALLs with rearrangement of the mixed lineage leukemia (MLL) gene on chromosome 11q23. Because hyperdiploid ALL samples also show high-level expression of FLT3, we searched for the presence of FLT3 mutations in leukemic blasts from 71 patients with ALL. The data show that approximately 25% (6 of 25) of hyperdiploid ALL samples possess FLT3 mutations, whereas only 1 of 29 TEL/AML1-rearranged samples harbored mutations (P = .04, Fisher exact test). Three mutations are novel in-frame deletions within a 7-amino acid region of the receptor juxtamembrane domain. Finally, 3 samples from patients whose disease would relapse harbored FLT3 mutations. These data suggest that patients with hyperdiploid or relapsed ALL might be considered candidates for therapy with newly described small-molecule FLT3 inhibitors. (Blood. 2004;103: 3544-3546)    Introduction Top Abstract Introduction Study design Results and discussion References   The FMS-related tyrosine kinase-3 (FLT3) is a receptor tyrosine kinase expressed in early hematopoietic progenitors that plays an important role in hematopoietic development.1,2 Multiple studies have shown that activating mutations of FLT3 are common in blasts from patients diagnosed with acute myelogenous leukemia (AML) but are rarely found in adult patients with acute lymphoblastic leukemia (ALL).2-4 We have recently shown that FLT3 is consistently highly expressed in MLL rearranged acute lymphoblastic leukemias (MLLs).5 This prompted analysis for FLT3 mutations in MLL, where we found approximately 15% contain activating mutations in the receptor activation loop.6 A large gene expression analysis of childhood ALL samples has shown that high-level FLT3 expression is also found in ALL samples containing more than 50 chromosomes (hyperdiploid ALL).7 Here we show that activating FLT3 mutations are found in diagnostic specimens from 6 of 25 patients with hyperdiploidALL, but only 1 of 29 patients with TEL/AML1-rearranged ALL. Also, 3 of 16 patients with leukemia who would ultimately have a relapse harbored FLT3 mutations. Most of the mutations are previously described activation loop mutations, but 4 are new mutations consisting of either small deletions or insertions in the juxtamembrane region of the receptor. These data suggest that patients with hyperdiploid or relapsed ALL should be considered possible candidates for therapy with recently described small-molecule FLT3 inhibitors.8-11    Study design Top Abstract Introduction Study design Results and discussion References   Patient samples Leukemia samples were obtained from either bone marrow or peripheral blood at diagnosis from patients with ALL. The peripheral blood samples all had more than 10% blasts at diagnosis. Patients were treated according to Dana Farber Cancer Institute protocols 91-001, 95-001, and 00-001. Informed consent was obtained from all patients after approval of the Institutional Review Board. Standard cytogenetic analysis was performed on all samples. TEL-AML1 translocations were determined by florescence in situ hybridization (FISH) or polymerase chain reaction (PCR) as previously described.12 Mutation detection gDNA was extracted from leukemia samples with Trizol (Invitrogen, Carlsbad, CA). Mutations in the juxtamembrane domain were identified by amplifying a region spanning exons 14 and 15 with primers 14F (TGTAAAACGACGGCCAGTCAATTTAGGTATGAAAGCC) and 15R (GAGGAAACAGCTATGACCCTTTCAGCATTTTGACGGCAACC). The upstream primer in this reaction was fluorescently labeled (6-FAM) to allow sizing of all products when electrophoresed on a sequencing apparatus (Model 377, Applied Biosystems, Foster City, CA). The area under the curve of a variant product was divided by the total area under all curves to approximate the percentage of variant alleles in a sample. When variant products were determined to constitute more than 30% of the signal, the sample was directly sequenced following the initial PCR. Samples with no detectable length mutations were also directly sequenced. For a sample with a less abundant variant (1%-30%), the PCR product was run on a 1.5% agarose gel, and the variant product was cut from the gel and reamplified with the original primers prior to sequencing. Activation loop mutations were determined by PCR amplification with primers 20F (TGTAAAACGACGGCCAGTCCGCCAGGAACGTGCTTG) and 20R (CAGGAAACAGCTATGACCGCAGCCTCACATTGCCCC), followed by EcoRV digestion. EcoRV digests wild-type but not mutant fragments at the recognition site composed by codons 835 and 836 (GATATC). A second round of PCR was performed to amplify the uncut fragments. The products of the second PCR were sequenced. To determine an estimate of the percentage of mutant alleles in a sample containing an FLT3 mutation, PCR was repeated in duplicate as described. In one of the reactions the 20F primer was substituted with a TET-labeled 20F primer, and in the other reaction the 20R primer was replaced with a 6-FAM-labeled 20R primer. PCR amplicons were subsequently digested with EcoRV and the percentage of mutant (undigested) amplicons present was determined by dividing the area under the mutant curve by the total area under the curves from the digested and undigested products. Samples with more than 2% mutant alleles were determined to be positive.    Results and discussion Top Abstract Introduction Study design Results and discussion References   We recently demonstrated that consistent high-level expression of FLT3 in MLL identifies a subtype of ALL that often harbors FLT3 mutations and have validated FLT3 as a potential therapeutic target in this leukemia.5,6 Because FLT3 is also consistently expressed at high levels in hyperdiploid ALL, we searched for FLT3 mutations in 71 childhood ALL samples to determine if FLT3 mutations are more prevalent in hyperdiploid as compared to other ALLs. We found 6 of 25 hyperdiploid ALL samples contain mutations that are predicted to lead to constitutive activation of the receptor, whereas only one of 29 TEL/AML1-rearranged samples harbored a FLT3 mutation (Table 1). Also, none of 8 ALL samples with other cytogenetic characteristics and 3 of 9 samples from which cytogenetics were not available possessed FLT3 mutations. Thus, 10 of 71 samples possessed FLT3 mutations with a significant association between FLT3 mutations and hyperdiploid ALL (P = .04). View this table: [in this window] [in a new window]   Table 1.. FLT3 mutations in 71 childhood ALL samples   Five of the mutations identified are previously described activating mutations present in the receptor activation loop.4,6 Three of the mutations are novel and result in small in-frame deletions in the juxtamembrane region of the receptor (Figure 1A-B). One of these patients (no. 24) had a single amino acid deletion of Asp593 that was present in leukemia blasts at diagnosis and relapse but was not found in bone marrow cells taken during remission. Thus, this mutation was not an uncommon polymorphism but was acquired in the leukemia blasts. Although this type of FLT3 mutation is novel in human disease, small deletions of the 10-amino acid region of FLT3 from Tyr589 to Tyr599 have been previously shown to lead to constitutive activation.13 When we compared these mutations to those found in tyrosine kinases in other diseases, we found that similar small deletion mutations are found in the receptor tyrosine kinase c-KIT in gastrointestinal stromal tumors (GISTs; Figure 1A).14-16 Similar deletion mutations are also found in c-kit in the murine mastocytoma cell line FMA3.17 In both cases this type of mutation leads to receptor activation. Another unique mutation is a novel 15-bp insertion in the juxtamembrane region of the receptor that maintains an open reading frame. This is reminiscent of the FLT3 internal tandem duplications (FLT3-ITDs) found in AML (Figure 1B). Finally, one TEL/AML1-rearranged sample harbored a 30-bp FLT3-ITD. View larger version (40K): [in this window] [in a new window]   Figure 1.. FLT3 mutations found in the juxtamembrane region and activation loop in ALL and AML. (A) An alignment of the juxtamembrane regions encompassing amino acids 563-610 of FLT3 and 544-589 of c-KIT is shown. The region of mutation of c-KIT in GIST is in bold as are the 4 FLT3 mutations found in ALL samples 12, 24, 21, and 25. (B) The different FLT3 mutations found in AML and ALL are shown. Internal tandem duplications (FLT3-ITDs) in the juxtamembrane region have been described in AML.2,3 Two FLT3-ITDs are shown as examples. Deletions in the juxtamembrane region are found in ALL. Activation loop mutations are found in ALL, AML, and MLL.4,6   It is of interest to note that 2 of the samples contained mutant FLT3 alleles at a frequency of less than 2% even though the blast percentage was high. Although this could possibly represent contamination, we feel that this is unlikely because we have performed more than 100 negative controls in the laboratory with no false-positive results. We feel that it is more likely to represent clonal evolution within the leukemias as has been demonstrated for FLT3 mutations in AML.18,19 Future study will determine the importance of FLT3 mutations in such cases. These data show that FLT3 mutations are common in hyperdiploid ALL in contrast to published reports that have assessed adult ALL where FLT3 mutation is uncommon.2,4 We propose that this reflects an association between FLT3 mutations and hyperdiploid ALL or MLL, both of which are quite rare in adults. It is of interest to note that although we found multiple mutations of FLT3 in hyperdiploid ALL, we found no cases that possessed an FLT3-ITD, the most common mutation found in AML (Figure 1B). Further study will determine if this is due to different mechanisms of mutagenesis in developing myeloid as compared to lymphoid cells or if the distinct FLT3 mutants have unique signaling properties. An important question is whether or not the presence of FLT3 mutations in ALL has prognostic significance. A definitive answer to this question will require larger studies of MLL and hyperdiploid ALL samples, but it is important to note that 3 of the 16 patients with ALL that relapsed harbored FLT3 mutations at diagnosis. The presence of FLT3 mutations in these cases suggests that FLT3 inhibition may represent a therapeutic opportunity in at least a subset of patients with relapsed ALL. The data presented here provide further evidence that genomic analysis of cancer cells will uncover important biologic subsets. Even though FLT3 mutations were considered rare in lymphoblastic leukemias, microarray analysis revealed high-level FLT3 expression prompting DNA sequencing, which uncovered 2 subtypes of ALL that frequently contain FLT3 mutations. Thus there appears to be an association between high-level expression of FLT3 and the presence of activation loop mutations. This has also been demonstrated recently for AML where all samples with activation loop mutations have high-level expression.20 Further study will determine the molecular underpinnings of this association. These data in conjunction with our previous finding in MLL provide strong support for the development of clinical trials that will test the efficacy of FLT3 inhibitors in childhood ALL. Furthermore, the presence of FLT3 mutations will prompt a more systematic analysis of tyrosine kinase mutations in childhood ALL.    Acknowledgements   We wish to thank Susanna Hamilton, Mark Hansen, and Sigitas Verselis of the Shannon McCormack Advanced Molecular Diagnostics Laboratory at the Dana Farber Cancer Institute for carrying out the FLT3 mutation analysis. We also thank Virginia Dalton and Angelo Cardoso for help with sample acquisition.    Footnotes   Submitted July 18, 2003; accepted November 19, 2003. Prepublished online as Blood First Edition Paper, December 11, 2003; DOI 10.1182/blood-2003-07-2441. Supported by National Cancer Institute Grants CA92551 and CA68484, the Howard Hughes Medical Institute, and the William Lawrence and Blanche Hughes Fund of the California Community Foundation. S.A.A. is a recipient of a Damon Runyon-Lilly Clinical Investigator Award. The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734. Reprints: Stanley J. Korsmeyer, Dana Farber Cancer Institute, One Jimmy Fund Way SM756, Boston, MA 02115; e-mail: stanley_korsmeyer{at}dfci.harvard.edu.    References Top Abstract Introduction Study design Results and discussion References   Mackarehtschian K, Hardin JD, Moore KA, Boast S, Goff SP, Lemischka IR. Targeted disruption of the flk2/flt3 gene leads to deficiencies in primitive hematopoietic progenitors. Immunity. 1995;3: 147-161.[CrossRef][Medline] [Order article via Infotrieve] Gilliland DG, Griffin JD. The roles of FLT3 in hematopoiesis and leukemia. Blood. 2002;100: 1532-1542.[Abstract/Free Full Text] Nakao M, Yokota S, Iwai T, et al. Internal tandem duplication of the flt3 gene found in acute myeloid leukemia. Leukemia. 1996;10: 1911-1918.[Medline] [Order article via Infotrieve] Yamamoto Y, Kiyoi H, Nakano Y, et al. Activating mutation of D835 within the activation loop of FLT3 in human hematologic malignancies. Blood. 2001;97: 2434-2439.[Abstract/Free Full Text] Armstrong SA, Staunton JE, Silverman LB, et al. MLL translocations specify a distinct gene expression profile that distinguishes a unique leukemia. Nat Genet. 2002;30: 41-47.[CrossRef][Medline] [Order article via Infotrieve] Armstrong SA, Kung AL, Mabon ME, et al. Inhibition of FLT3 in MLL. Validation of a therapeutic target identified by gene expression based classification. Cancer Cell. 2003;3: 173-183.[CrossRef][Medline] [Order article via Infotrieve] Yeoh EJ, Ross ME, Shurtleff SA, et al. Classification, subtype discovery, and prediction of outcome in pediatric acute lymphoblastic leukemia by gene expression profiling. Cancer Cell. 2002;1: 133-143.[CrossRef][Medline] [Order article via Infotrieve] Kelly LM, Yu JC, Boulton CL, et al. CT53518, a novel selective FLT3 antagonist for the treatment of acute myelogenous leukemia (AML). Cancer Cell. 2002;1: 421-432.[CrossRef][Medline] [Order article via Infotrieve] Levis M, Allebach J, Tse KF, et al. A FLT3-targeted tyrosine kinase inhibitor is cytotoxic to leukemia cells in vitro and in vivo. Blood. 2002;99: 3885-3891.[Abstract/Free Full Text] Yee KW, O'Farrell AM, Smolich BD, et al. SU5416 and SU5614 inhibit kinase activity of wild-type and mutant FLT3 receptor tyrosine kinase. Blood. 2002;100: 2941-2949.[Abstract/Free Full Text] Weisberg E, Boulton C, Kelly LM, et al. Inhibition of mutant FLT3 receptors in leukemia cells by the small molecule tyrosine kinase inhibitor PKC412. Cancer Cell. 2002;1: 433-443.[CrossRef][Medline] [Order article via Infotrieve] Loh ML, Samson Y, Motte E, et al. Translocation (2;8)(p12;q24) associated with a cryptic t(12; 21)(p13;q22) TEL/AML1 gene rearrangement in a child with acute lymphoblastic leukemia. Cancer Genet Cytogenet. 2000;122: 79-82.[CrossRef][Medline] [Order article via Infotrieve] Kiyoi H, Ohno R, Ueda R, Saito H, Naoe T. Mechanism of constitutive activation of FLT3 with internal tandem duplication in the juxtamembrane domain. Oncogene. 2002;21: 2555-2563.[CrossRef][Medline] [Order article via Infotrieve] Hirota S, Isozaki K, Moriyama Y, et al. Gain-of-function mutations of c-kit in human gastrointestinal stromal tumors. Science. 1998;279: 577-580.[Abstract/Free Full Text] Nishida T, Hirota S, Taniguchi M, et al. Familial gastrointestinal stromal tumours with germline mutation of the KIT gene. Nat Genet. 1998;19: 323-324.[CrossRef][Medline] [Order article via Infotrieve] Rubin BP, Singer S, Tsao C, et al. KIT activation is a ubiquitous feature of gastrointestinal stromal tumors. Cancer Res. 2001;61: 8118-8121.[Abstract/Free Full Text] Tsujimura T, Morimoto M, Hashimoto K, et al. Constitutive activation of c-kit in FMA3 murine mastocytoma cells caused by deletion of seven amino acids at the juxtamembrane domain. Blood. 1996;87: 273-283.[Abstract/Free Full Text] Kottaridis PD, Gale RE, Langabeer SE, Frew ME, Bowen DT, Linch DC. Studies of FLT3 mutations in paired presentation and relapse samples from patients with acute myeloid leukemia: implications for the role of FLT3 mutations in leukemogenesis, minimal residual disease detection, and possible therapy with FLT3 inhibitors. Blood. 2002;100: 2393-2398.l[Abstract/Free Full Text] Shih LY, Huang CF, Wu JH, et al. Internal tandem duplication of FLT3 in relapsed acute myeloid leukemia: a comparative analysis of bone marrow samples from 108 adult patients at diagnosis and relapse. Blood. 2002;100: 2387-2392.[Abstract/Free Full Text] Libura M, Asnafi V, Tu A, et al. FLT3 and MLL intragenic abnormalities in AML reflect a common category of genotoxic stress. Blood. 2003;102: 2198-2204.[Abstract/Free Full Text] CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This article has been cited by other articles: J. W. Tyner, M. W. Deininger, M. M. Loriaux, B. H. Chang, J. R. Gotlib, S. G. Willis, H. Erickson, T. Kovacsovics, T. O'Hare, M. C. Heinrich, et al. RNAi screen for rapid therapeutic target identification in leukemia patients PNAS, May 26, 2009; 106(21): 8695 - 8700. [Abstract] [Full Text] [PDF] L. Kearney, D. Gonzalez De Castro, J. Yeung, J. Procter, S. W. Horsley, M. Eguchi-Ishimae, C. M. Bateman, K. Anderson, T. Chaplin, B. D. Young, et al. Specific JAK2 mutation (JAK2R683) and multiple gene deletions in Down syndrome acute lymphoblastic leukemia Blood, January 15, 2009; 113(3): 646 - 648. [Abstract] [Full Text] [PDF] M. Case, E. Matheson, L. Minto, R. Hassan, C. J. Harrison, N. Bown, S. Bailey, J. Vormoor, A. G. Hall, and J. A.E. Irving Mutation of Genes Affecting the RAS Pathway Is Common in Childhood Acute Lymphoblastic Leukemia Cancer Res., August 15, 2008; 68(16): 6803 - 6809. [Abstract] [Full Text] [PDF] J. Wiemels Chromosomal Translocations in Childhood Leukemia: Natural History, Mechanisms, and Epidemiology J Natl Cancer Inst Monographs, July 1, 2008; 2008(39): 87 - 90. [Abstract] [Full Text] [PDF] X.-F. Huang, S.-K. Luo, J. Xu, J. Li, D.-R. Xu, L.-H. Wang, M. Yan, X.-R. Wang, X.-B. Wan, F.-M. Zheng, et al. Aurora kinase inhibitory VX-680 increases Bax/Bcl-2 ratio and induces apoptosis in Aurora-A-high acute myeloid leukemia Blood, March 1, 2008; 111(5): 2854 - 2865. [Abstract] [Full Text] [PDF] R. W. Stam, M. L. den Boer, P. Schneider, M. Meier, H. B. Beverloo, and R. Pieters D-HPLC analysis of the entire FLT3 gene in MLL rearranged and hyperdiploid acute lymphoblastic leukemia Haematologica, November 1, 2007; 92(11): 1565 - 1568. [Abstract] [Full Text] [PDF] H. Kiyoi, Y. Shiotsu, K. Ozeki, S. Yamaji, H. Kosugi, H. Umehara, M. Shimizu, H. Arai, K. Ishii, S. Akinaga, et al. A Novel FLT3 Inhibitor FI-700 Selectively Suppresses the Growth of Leukemia Cells with FLT3 Mutations Clin. Cancer Res., August 1, 2007; 13(15): 4575 - 4582. [Abstract] [Full Text] [PDF] T. Akasaka, T. Balasas, L. J. Russell, K.-j. Sugimoto, A. Majid, R. Walewska, E. L. Karran, D. G. Brown, K. Cain, L. Harder, et al. Five members of the CEBP transcription factor family are targeted by recurrent IGH translocations in B-cell precursor acute lymphoblastic leukemia (BCP-ALL) Blood, April 15, 2007; 109(8): 3451 - 3461. [Abstract] [Full Text] [PDF] O. Piloto, B. Nguyen, D. Huso, K.-T. Kim, Y. Li, L. Witte, D. J. Hicklin, P. Brown, and D. Small IMC-EB10, an Anti-FLT3 Monoclonal Antibody, Prolongs Survival and Reduces Nonobese Diabetic/Severe Combined Immunodeficient Engraftment of Some Acute Lymphoblastic Leukemia Cell Lines and Primary Leukemic Samples. Cancer Res., May 1, 2006; 66(9): 4843 - 4851. [Abstract] [Full Text] [PDF] D. Small FLT3 Mutations: Biology and Treatment Hematology, January 1, 2006; 2006(1): 178 - 184. [Abstract] [Full Text] [PDF] S. Chiaretti, X. Li, R. Gentleman, A. Vitale, K. S. Wang, F. Mandelli, R. Foa, and J. Ritz Gene Expression Profiles of B-lineage Adult Acute Lymphocytic Leukemia Reveal Genetic Patterns that Identify Lineage Derivation and Distinct Mechanisms of Transformation Clin. Cancer Res., October 15, 2005; 11(20): 7209 - 7219. [Abstract] [Full Text] [PDF] R. W. Stam, M. L. den Boer, P. Schneider, P. Nollau, M. Horstmann, H. B. Beverloo, E. van der Voort, M. G. Valsecchi, P. de Lorenzo, S. E. Sallan, et al. Targeting FLT3 in primary MLL-gene-rearranged infant acute lymphoblastic leukemia Blood, October 1, 2005; 106(7): 2484 - 2490. [Abstract] [Full Text] [PDF] S. A. Armstrong and A. T. Look Molecular Genetics of Acute Lymphoblastic Leukemia J. Clin. Oncol., September 10, 2005; 23(26): 6306 - 6315. [Abstract] [Full Text] [PDF] R. Grundler, C. Miething, C. Thiede, C. Peschel, and J. Duyster FLT3-ITD and tyrosine kinase domain mutants induce 2 distinct phenotypes in a murine bone marrow transplantation model Blood, June 15, 2005; 105(12): 4792 - 4799. [Abstract] [Full Text] [PDF] P. Brown, M. Levis, S. Shurtleff, D. Campana, J. Downing, and D. Small FLT3 inhibition selectively kills childhood acute lymphoblastic leukemia cells with high levels of FLT3 expression Blood, January 15, 2005; 105(2): 812 - 820. [Abstract] [Full Text] [PDF] R. M. Stone, D. J. DeAngelo, V. Klimek, I. Galinsky, E. Estey, S. D. Nimer, W. Grandin, D. Lebwohl, Y. Wang, P. Cohen, et al. Patients with acute myeloid leukemia and an activating mutation in FLT3 respond to a small-molecule FLT3 tyrosine kinase inhibitor, PKC412 Blood, January 1, 2005; 105(1): 54 - 60. [Abstract] [Full Text] [PDF] C.-H. Pui, M. Schrappe, R. C. Ribeiro, and C. M. Niemeyer Childhood and Adolescent Lymphoid and Myeloid Leukemia Hematology, January 1, 2004; 2004(1): 118 - 145. [Abstract] [Full Text] [PDF] This Article Abstract Full Text (PDF) All Versions of this Article: 2003-07-2441v1 103/9/3544    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Armstrong, S. A. Articles by Korsmeyer, S. J. Search for Related Content PubMed PubMed Citation Articles by Armstrong, S. A. Articles by Korsmeyer, S. J. Related Collections Neoplasia Oncogenes and Tumor Suppressors Signal Transduction Gene Expression Brief Reports Social Bookmarking                   What's this?

	Copyright © 2004 by American Society of Hematology         Online ISSN: 1528-0020