Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 15 November 2004, Vol. 104, No. 10, pp. 3021-3027.
Prepublished online as a Blood First Edition Paper on July 29, 2004; DOI 10.1182/blood-2004-02-0701.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-02-0701v1
104/10/3021    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carlsen, H. S.
Right arrow Articles by Brandtzaeg, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carlsen, H. S.
Right arrow Articles by Brandtzaeg, P.
Related Collections
Right arrow Immunobiology
Right arrow Phagocytes
Right arrow Chemokines, Cytokines, and Interleukins
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

CHEMOKINES

Monocyte-like and mature macrophages produce CXCL13 (B cell–attracting chemokine 1) in inflammatory lesions with lymphoid neogenesis

Hege S. Carlsen, Espen S. Baekkevold, H. Craig Morton, Guttorm Haraldsen, and Per Brandtzaeg

From the Laboratory for Immunohistochemistry and Immunopathology (LIIPAT), Institute of Pathology, and the Department of Surgery, Rikshospitalet University Hospital, Oslo, Norway.


    Abstract
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results
 Discussion
 References
 
The homeostatic chemokine CXCL13 (also called B cell-attracting chemokine 1 [BCA-1] or B-lymphocyte chemoattractant [BLC]) is constitutively expressed in secondary lymphoid tissue and initiates lymphoid neogenesis when expressed aberrantly in mice. CXCL13 has also been detected in chronic inflammation associated with human lymphoid neogenesis, suggesting a pathogenic role. Follicular dendritic cells (FDCs) are generally considered to be the major source of CXCL13 both in normal and aberrant lymphoid tissue. We show here, instead, that most CXCL13-expressing cells in rheumatoid arthritis and ulcerative colitis are of monocyte/macrophage lineage. They are located in irregular lymphoid aggregates within an FDC network, but also within and near smaller collections of B cells in diseased tissue where no FDCs are detected. Some of these CXCL13-expressing cells are CD14+, suggesting derivation from recently extravasated monocytes. Interestingly, monocytes from healthy donors stimulated in vitro with lipopolysaccharide secrete CXCL13. This induced production is enhanced after in vitro maturation of the monocytes toward macrophages but markedly decreased after maturation toward dendritic cells. Together, our findings strongly suggest that newly recruited monocytes/macrophages play a role for lymphoid neogenesis in human inflammatory diseases. Circulating monocytes are therefore potential candidates for future targeted therapy of chronic inflammation.


    Introduction
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results
 Discussion
 References
 
Rheumatoid arthritis (RA) and ulcerative colitis (UC) are chronic inflammatory diseases associated with de novo formation of irregular T- and B-cell aggregates in the synovium1 and large bowel mucosa,2 respectively. Such local development of lymphoid tissue is thought to contribute to the pathology of chronic inflammation.3,4

Lymphoid tissue organization is orchestrated by a subset of the chemokine family, termed homeostatic or lymphoid chemokines because of their constitutive expression in secondary lymphoid tissues.5 One of these lymphoid chemokines, CXCL13, also called B cell–attracting chemokine 1 (BCA-1)6 or B-lymphocyte chemoattractant (BLC),7 and its receptor CXCR5, also called Burkitt lymphoma receptor-1 (BLR1), are required for normal development of secondary lymphoid organs in mice.8,9 CXCL13 and CXCR5 have, in addition, been detected in various chronic human inflammatory diseases where lymphoid neogenesis occurs, such as Helicobacter pylori gastritis,10 RA,1,11 Sjögren syndrome,12-14 and UC15 as well as in gastric10 and primary central nervous system lymphoma.16

Follicular dendritic cells (FDCs) are generally believed to be the main source of CXCL13 in normal6,7,17 as well as inflamed lymphoid tissue.1,10,11 In addition, vascular expression of the CXCL13 protein has been reported,1,15,16,18,19 and CXCL13 and CXCR5 have been shown to play an important role in B-cell homing to murine Peyer patches.20 However, no expression analysis of CXCL13 mRNA in human lymphoid tissue10,15,16,18 has directly shown that CXCL13 is actually produced by FDCs or endothelial cells. Importantly, available data do not exclude the possibility that murine FDCs in fact bind CXCL13 rather than produce it.7,17 Also of note, CXCL13 protein is undetectable in human FDC-like cells stimulated in vitro.21 We have shown earlier that another lymphoid chemokine, CCL19, is present and functions in endothelial cells that are not its source.22

In our recent human study of normal and aberrant gut-associated lymphoid tissue, we found that CXCL13 was mainly associated with extracellular fibrils and only minimally with cells displaying the traditional FDC phenotype.15 This prompted us to explore more extensively the source of this chemokine in human lymphoid neogenesis represented by RA synovium and UC large bowel mucosa. Furthermore, we investigated the potential mechanistic role monocyte-derived cells could play in CXCL13 secretion. Our data documented for the first time that human monocytes/macrophages are a potent inducible source of CXCL13 and, in fact, appear to be the main producers of this chemokine in inflammatory lesions where lymphoid neogenesis occurs. This suggested a role of recently extravasated macrophages in the formation of such ectopic follicles.


    Patients, materials, and methods
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results
 Discussion
 References
 
Patients

Clinicopathologic data and patient treatment schedules are provided in Table 1. Cryosections (8 µm) were cut serially from various human tissue samples, including inflammatory lesions from patients with RA (n = 4) and UC (n = 5). RA synovium specimens were obtained from patients who underwent orthopedic surgery at Diakonhjemmet Hospital (Oslo, Norway) or Rikshospitalet University Hospital. UC bowel specimens came from patients who underwent colectomy at Rikshospitalet. Surgery was performed because of therapy-resistant inflammatory bowel disease. UC specimens were selected histologically on the basis of a large number of irregular lymphoid aggregates.15 Duodenal biopsies from adult patients with celiac disease (n = 6) were obtained before enrollment in a diet study. Control material consisted of palatine tonsils (n = 3), normal colon (n = 3), and normal Peyer patches (n = 3) obtained from individuals undergoing tonsillectomy or colectomy (due to long-lasting chronic obstipation), respectively. All procedures involving patient material were approved by the Regional Committee for Medical Research Ethics (Health Region South, Oslo, Norway).


View this table:
[in this window]
[in a new window]
 
Table 1.. Characteristics of patients

 

Primary antibodies

Primary mouse monoclonal antibodies (mAbs) with the following human specificities were used for immunofluorescence staining: CXCL13 (53610.11, IgG1; R&D Systems, Oxon, United Kingdom), CD2 (IgG2a; kindly provided by Dr G. Gaudernack, Oslo, Norway), CD4 (72-5A4, IgG2a; Diatec, Oslo, Norway), CD11c (IgG1; kindly provided by Dr K. Pulford, Oxford, United Kingdom and SHCL-3, IgG2b; Becton Dickinson, San Jose, CA), CD14 (anti–human Leu-M3, IgG2b; Becton Dickinson), CD20 (L26, IgG2a; Dako, Glostrup, Denmark), CD33 (My9, IgG2b; Coulter Immunology, Hialeah, FL), and CD68 (EBM11, IgG1; and PG-M1, IgG3; Dako). In addition, we used the following rabbit immune reagents: anti-CD3 (IgG; Dako), anti–von Willebrand factor (IgG; Dako), and antifibronectin (IgG; Dako).

Two- and 3-color immunofluorescence staining

Cryosections were subjected to 3-color immunostaining with mAbs or rabbit immune reagents followed by appropriate second- and third-step reagents as previously described.15 Briefly, acetone-fixed sections were incubated with a mixture of primary immunoreagents for 1 hour at room temperature. The mAb to CXCL13 was used at a concentration of 10 µg IgG/mL in combination with different reagents detecting leukocyte markers, vessel structures, or extracellular matrix proteins (see "Primary antibodies"). This combination was followed by incubation with the appropriate mixture of reagents and conjugates. When a secondary biotinylated antibody was used, a final incubation step with fluorescent streptavidin was included. All secondary reagents were diluted in 10% normal human serum to block Fc receptor binding and possible cross-reacting antibodies to IgG present in the tissue sections. Reaction sites of anti-CXCL13 were visualized with a subclass-specific secondary reagent (goat anti–mouse IgG1; 1/2000; Southern Biotechnology, Birmingham, AL). Incubation with irrelevant isotypeand concentration-matched mAbs or preimmune rabbit serum followed by the appropriate secondary reagents served as negative controls to assess nonspecific staining. To exclude that costaining was due to macrophage autofluorescence or cross-reactivity of the mAb to CXCL13 with other chemokines, specificity was also confirmed by blocking of the anti-CXCL13 mAb with recombinant CXCL13 (R&D Systems) at an antibody-chemokine molar ratio of 1:2.5. Stained sections were mounted in poly(vinylalcohol) (P8136; Sigma Aldrich, Steinheim, Germany), pH 8.7. Fluorescence microscopy was performed with a Nikon microscope (EcLipse E800, Nikon, Tokyo, Japan) equipped with a Ploem-type beam-splitting device. Images were captured with an F-view digital camera controlled by Analysis 3.2 software (Analysis Soft Imaging System; GmbH, Münster, Germany) and transferred to Adobe Photoshop (Adobe, San Jose, CA).

In situ hybridization for CXCL13 mRNA

A 436–base pair (bp) digoxigenin (DIG)–labeled riboprobe was generated from the coding region of cDNA for human CXCL13 with the DIG RNA labeling kit according to the manufacturer's directions (Boehringer Mannheim, Mannheim, Germany). Hybridization and detection of the hybridized probe were performed as previously described.15 Briefly, after 10 minutes fixation with 4% paraformaldehyde (in phosphate-buffered saline [PBS]) and subsequent washing, the sections were hybridized overnight at 59°C with 250 ng/mL riboprobe in hybridization solution followed by high-stringency washes. The hybridized probe was detected with horseradish peroxidase (HRP)–conjugated rabbit anti-DIG (Dako), followed by 2 steps of biotin-tyramide deposition (Gen Point kit; Dako). Finally, signals were detected with alkaline phosphatase (AP)–conjugated rabbit antibiotin (Dako), followed by the AP substrate Fast Red (Ventana Medical Systems, Tucson, AZ), and the sections were counterstained with hematoxylin.

Cell cultures

Human monocytes were isolated from healthy blood donors by IsopachFicoll (Lymphoprep; Nycomed, Oslo, Norway) gradient centrifugation, followed by negative isolation with the Monocyte Negative Isolation Kit (Dynal, Oslo, Norway) according to the manufacturer's directions. Monocyte purity was assessed by flow cytometry and was routinely 85% to 90%. Cells were plated at 7 x 105 cells/well in 24-well plates with RPMI 1640 (BioWhittaker, Walkersville, ML) containing 10% fetal calf serum and either macrophage colony-stimulating factor (M-CSF; 50 ng/mL; R&D Systems) or granulocyte-macrophage colony-stimulating factor (GM-CSF; 100 ng/mL; Peprotech, London, United Kingdom) and interleukin 4 (IL-4; 25 ng/mL; R&D Systems) for 3 or 6 days before stimulation with lipopolysaccharide (LPS; from Escherichia coli serotype 026:B6; Sigma-Aldrich) at various concentrations for different time periods as detailed in the text.

RT-PCR

Total RNA was isolated from cultured monocytes by means of RNAwiz (Ambion, Austin, TX) according to the manufacturer's protocol, and reverse transcription-polymerase chain reaction (RT-PCR) was performed as described.15 Primers used were (5' to 3') BCA-1: TGCTAATGAGCCTGGAC, AGGGATAAGGGAAGAATG and glyceraldehyde-3-phosphate dehydrogenase (GAPDH): AAATCCCATCACCATCTTCC, CATGAGTCCTTCCACGATACC. Annealing temperature for both primer pairs was 60°C, and 35 cycles of PCR amplification were performed. The PCR products were separated by electrophoresis in 1.6% (wt/vol) agarose gel and stained with ethidium bromide. The PCR product was confirmed by sequencing.

Sandwich enzyme-linked immunosorbent assay for CXCL13

Mouse mAb to human CXCL13 (53610.11; IgG1) was used as capture antibody and biotinylated goat IgG anti–human CXCL13 served as detection antibody (both from R&D Systems). Streptavidin-conjugated AP (Southern Biotechnology) was used to detect the biotinylated antibody and was visualized with diethanolamine. Absorption was measured at 405 nm. Recombinant human CXCL13 protein (R&D Systems) was used for standard curves. The detection limit was 200 pg/mL.


    Results
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results
 Discussion
 References
 
CXCL13-expressing cells are CD11c+ and not restricted to lymphoid follicles in inflamed tissue

In situ hybridization on tissue sections from RA and UC lesions showed that CXCL13 mRNA expression was not restricted to organized lymphoid structures but also occurred in areas with diffuse mononuclear cell infiltration and in small clusters of such cells (Figure 1A-B). Immunofluorescence staining for CXCL13 on parallel sections revealed that the CXCL13-expressing cells were CD11c+ and located within or near small collections of B cells (Figure 1C and data not shown). Evaluation of serial sections at different levels confirmed that CD11c+ CXCL13-expressing cells were not restricted to the 3-dimensional structure of organized lymphoid follicles. CXCL13-expressing cells were detected outside of follicles in all RA and UC specimens. However, these extrafollicular cells were most abundant in specimens characterized by high numbers of organized lymphoid structures or dense clusters of mononuclear cells; the figures are representative of such specimens. CXCL13-expressing cells were not convincingly detected in celiac disease biopsies.



View larger version (156K):
[in this window]
[in a new window]
 
Figure 1.. CXCL13-expressing cells in human lymphoid neogenesis and normal secondary lymphoid tissue are CD11c+. (A-B) In situ hybridization for CXCL13 mRNA (red) in inflammatory lesions: (A) RA and (B) UC (insets, same fields with sense controls). Cells with CXCL13 mRNA are abundantly present in irregular lymphoid aggregates (arrowheads) and also scattered in areas with diffuse mononuclear cell infiltration (arrows). (C-E) Single exposures of multicolor immunofluorescence staining for CXCL13, CD11c, and CD20 (see keys) in inflammatory lesion or germinal centers of normal lymphoid tissue. CXCL13-expressing scattered CD11c+ cells (arrows) occur in small collections of CD20+ B cells in RA (C) lesion, and in germinal center of tonsil (D) or Peyer patch (E). Note that in the RA lesion the cells show different CXCL13 expression levels consistent with ongoing up-regulation, whereas in the germinal centers this level appears similar among the positive cells. Bars represent 200 µm (A-B) and 50 µm (C-E).

 

We also showed that scattered CXCL13-expressing cells in germinal centers of organized lymphoid tissue (Figure 1D-E and Carlsen et al15) and inflammatory B-cell aggregates (not shown) were CD11c+. This strongly suggested that they were identical to the previously described germinal center dendritic cells (GCDCs) reported to stimulate T cells in this lymphoid compartment.24

CD11c+ GCDCs express CD68

To further investigate the in situ phenotype of all CD11c+ cells in germinal centers, we costained for CD11c and the macrophage marker CD68 in sections from UC (Figure 2A) and RA (not shown) lesions as well as tonsils (Figure 2B) and Peyer patches (not shown). Surprisingly, all CD11c+ cells located in germinal centers expressed CD68 (Figure 2A-B). This was confirmed by application of different combinations of mAbs (not shown). As expected, numerous CD68+CD11c macrophages were detected outside of follicles in UC and RA (Figure 2A), whereas some CD68+CD11c macrophages together with CD11c+ CD68 dendritic cells were seen in the T-cell areas of lymphoid tissue such as Peyer patches and tonsils (Figure 2B). The largest and most prominent CXCL13-expressing cells were found within the germinal centers. These cells were evenly distributed in this compartment (Figure 2C), corresponding to the previously described distribution of GCDCs, whereas macrophages described in germinal centers, the so-called tingible body macrophages, are located mainly in the dark zone.24



View larger version (142K):
[in this window]
[in a new window]
 
Figure 2.. CXCL13-expressing cells in human lymphoid neogenesis and germinal centers of normal or aberrant human lymphoid tissue show macrophage phenotype. Multicolor immunofluorescence staining for CXCL13 and various markers (merged color separations; see keys). (A-B) All CD11c+ cells in follicles of UC lesion (A) and tonsil (B) with extensive germinal centers coexpress cytoplasmic CD68+ (right inset, enlarged cellular details). These cells appear red with yellow or green periphery because CD68 is intracellular, whereas CD11c is a surface marker. Outside of the CD20+ B-cell follicle are numerous purely red (CD68+CD11c) macrophages in UC (A), whereas scattered red macrophages and abundant purely green dendritic cells (CD11c+CD68) are seen in the extrafollicular area of tonsil (left inset, enlarged cellular details). Macrophages sometimes appear yellowish because of weak coexpression of CD11c. (C) CXCL13 is localized to the cytoplasm of CD11c+ cells in tonsillar germinal center; comparable field from section adjacent to panel B. (D) CXCL13-expressing scattered cells in dense collections of T cells (CD3+) are CD68+ (arrows) in UC lesion. Bars represent 100 µm (A-C) and 50 µm (D).

 

CXCL13 is expressed by both mature and recently recruited macrophages

Paired immunostaining for the macrophage marker CD68 in UC and RA lesions showed that CXCL13-expressing cells, both within germinal centers and scattered in the T-cell areas, as well as within or near small collections of B cells, also expressed variable levels of CD68 (Figure 2D and data not shown). Far from all CD68+ cells were positive for CXCL13, but costaining for the extracellular matrix protein fibronectin showed that this chemokine was either expressed by CD68+ cells or associated with extracellular fibrils (Figure 3A-C). Thus, our finding suggests that tissue macrophages constitute the major source of CXCL13 in these inflammatory lesions, and the secreted chemokine appeared to be subsequently deposited on fibrillar structures. Numerous CD68+ tissue macrophages were also present in celiac disease lesions, but none of these deemed to be positive for CXCL13 (Figure 3D).



View larger version (106K):
[in this window]
[in a new window]
 
Figure 3.. Recently recruited and mature macrophages express CXCL13 that is also associated with extracellular fibrils. Single exposures of multicolor immunofluorescence staining for CXCL13 and various markers (see keys) in inflammatory lesions or germinal centers of normal lymphoid tissue. (A) CXCL13-expressing CD68+ macrophages (arrows) in UC lesion, where the CXCL13+ meshwork colocalizes with fibronectin (arrowheads). (B) Concentration-matched isotype control for anti-CXCL13 mAb; comparable field from section adjacent to panel A. (C) CXCL13-expressing CD68+ macrophages in tonsillar germinal center (arrow) and fibronectin-bearing fibrils with associated CXCL13 (arrowhead). (D) CD68+ macrophages in celiac disease lesion do not express CXCL13. (E) CXCL13-expressing CD14+ cells (arrows) near small CD20+ B-cell follicle (delineated); CXCL13-expressing cells are also present within the follicle where no CD14+ cells are seen. Bars represent 50 µm.

 

To further investigate the phenotype of the CXCL13-expressing macrophages, we costained for CD14, which is a marker for recently recruited macrophages in inflammatory bowel disease lesions.25 Scattered CD14+ cells that expressed distinctly CXCL13 were detected outside of the lymphoid aggregates in inflamed tissue (Figure 3E), which suggested that such immature macrophages could give rise to the progeny of cells that constitute the major tissue source of this chemokine. Notably, CD68+CXCL13+ macrophages were also found at such sites where neither FDCs nor high endothelial venules (HEVs) could be detected. However, CXCL13-expressing macrophages were also abundantly found in organized lymphoid structures of inflammatory lesions where FDCs and HEVs could be identified.

Elevated induction of CXCL13 in monocytes after in vitro maturation toward macrophages

The possibility exists that macrophages rapidly take up CXCL13 from another cellular source, resulting in the immunohistologic CD68+CXCL13+ phenotype. We therefore tested whether stimulated monocytes are able to produce CXCL13. Freshly isolated human monocytes from healthy donors did not contain detectable mRNA for CXCL13. However, 4 hours after stimulation with endotoxin (LPS) from E coli, such a message was detected in the monocytes (Figure 4A). We also matured monocytes for 3 days to differentiate them toward macrophages (with M-CSF; Becker et al26) or dendritic cells (DCs; with IL-4 and GM-CSF; Sallusto and Lanzavecchia27) prior to LPS stimulation. CXCL13 mRNA was not constitutively expressed in these cell populations as likewise observed for immature DCs.28 Nevertheless, after LPS stimulation, an increased level of CXCL13 mRNA was detected in the macrophages matured in vitro compared with monocytes; in contrast, the level in the DCs matured in vitro tended to be decreased (Figure 4A). CXCL13 protein was also detected by immunofluorescence staining of monocytes (Figure 4B) and macrophages matured in vitro following LPS stimulation (Figure 4C).



View larger version (81K):
[in this window]
[in a new window]
 
Figure 4.. Monocytes, freshly isolated or matured in vitro with M-CSF, express CXCL13 mRNA after LPS stimulation. (A) RT-PCR analysis of freshly isolated monocytes (top panel) and monocytes cultured for 3 days with either M-CSF (middle panel) or IL-4 and GM-CSF (bottom panel). Cells were stimulated with LPS (100 ng/mL) before total RNA was isolated at different time points after stimulation as indicated (2-48 hours). Representative results from 3 independent experiments are displayed in comparison with the expression levels of the "housekeeping" gene GAPDH in the same cultures. (B-C) Immunofluorescence staining of freshly isolated monocytes (B) and monocytes matured in vitro for 3 days with M-CSF (C). After 24 hours of LPS stimulation, the cells were stained for the markers indicated (merged color separations; see keys). Bars represent 20 µm.

 

Macrophages secrete more CXCL13 than monocyte-derived DCs

Association of CXCL13 with fibronectin-bearing extracellular fibrils is a striking feature of both normal lymphoid tissue and inflammatory aggregates (Figure 3A-C and Carlsen et al15). We therefore addressed the question of whether monocytes and macrophages can secrete CXCL13, which subsequently becomes positioned on extracellular matrix components. Supernatants of cultured monocytes were analyzed with a sandwich enzyme-linked immunosorbent assay (ELISA) specific for CXCL13. During 3 days of culture with LPS, increasing amounts of CXCL13 protein were detected, but with large individual differences (Figure 5A). Adding M-CSF at the start of culture did not alter the secretion of CXCL13 protein (data not shown). Dose-response experiments showed that in 2 of 3 individual cultures, CXCL13 protein was secreted by monocytes in response to LPS concentrations down to 0.1 ng/mL (Figure 5B). Increasing the LPS concentrations up to 1 µg/mL enhanced the secretion only slightly. However, macrophages generated in vitro secreted substantially elevated amounts of CXCL13 protein in response to increasing LPS concentrations (Figure 5C). When monocytes were cultured with M-CSF for 6 days prior to stimulation, the dose-response relationship with LPS was further elevated (Figure 5D). Conversely, when monocytes were differentiated toward DCs by incubation with IL-4 and GM-CSF for 3 days prior to LPS stimulation (100 ng/mL), no CXCL13 could be detected in the culture supernatant (data not shown).



View larger version (36K):
[in this window]
[in a new window]
 
Figure 5.. Freshly isolated monocytes and monocytes matured in vitro with M-CSF secrete CXCL13 after LPS stimulation. Supernatants of cultured cells were analyzed by sandwich ELISA specific for CXCL13. Note different scales of vertical axes. (A) Monocytes were stimulated with LPS (100 ng/mL) and supernatants harvested after 1, 2, and 3 days. Results of independent experiments from 3 different donors are shown. Two additional experiments from other donors were out of scale, one extremely poor and one excessive response, the latter up to 3200 pg/106 cells at day 3 (not shown). (B) Dose response of monocytes 24 hours after LPS stimulation; results of independent experiments from 3 different donors. (C) Dose response of monocytes matured in vitro with M-CSF for 3 days prior to stimulation for 24 hours with LPS; results of independent experiments from 3 different donors. (D) Dose response of monocytes ({blacksquare}), monocytes matured in vitro with M-CSF for 3 days ({square}), and monocytes matured in vitro with M-CSF for 6 days ({triangleup}) prior to stimulation for 24 hours with LPS; representative results of independent experiments from 3 different donors.

 


    Discussion
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results
 Discussion
 References
 
We show here that human monocytes/macrophages are a potent source of CXCL13 and, in fact, appear to be its main source in inflammatory lesions of RA and UC where lymphoid neogenesis occurs. This novel finding was supported by the presence of both CXCL13 protein and mRNA in CD68+cells, whereas the protein alone was shown to be associated with extracellular fibrils. The presence of CD68+ CXCL13-expressing macrophages also at inflammatory sites where neither FDCs nor HEVs could be detected accorded well with an earlier finding that CXCL13 and lymphotoxin {beta} are necessary, but not sufficient, for the occurrence of FDCs in RA.1 It furthermore agreed with murine studies in which ectopic expression of CXCL1329 or other lymphoid chemokines30 was associated with lymphoid neogenesis, including development of HEVs, although failing to generate convincing FDCs.

The causative role of CXCL13 in inflammation-associated lymphoid neogenesis is difficult to address directly in human studies. However, in a study of 64 patients with RA1 CXCL13 mRNA at varying levels was detected in synovial tissue extracts. The largest quantities of CXCL13 mRNA were detected in synovial tissues that contained germinal centers, determined to be 15- to 30-fold more than in synovial tissues with T-cell/B-cell aggregates or diffuse lymphocytic infiltrates. This finding suggested that CXCL13 was necessary, but not sufficient, for a synovial germinal center reaction. Although the source of CXCL13 was not identified, CXCL13 protein was abundantly present in germinal centers but also dispersed throughout synovial tissue without germinal centers. We did not detect CXCL13 in biopsies from celiac disease, a chronic lesion with great immunologic activity but without lymphoid neogenesis. This discrepancy could, however, be a matter of sensitivity and inflammatory intensity because active UC is characterized by more severe mucosal inflammation than active celiac disease. Nevertheless, our findings suggested that a certain level of CXCL13 is necessary for the development of lymphoid follicles in inflamed tissue.

FDCs have been previously considered to be the main source of CXCL13, both in normal and aberrant lymphoid tissue. However, expression analyses of CXCL13 mRNA in human lymphoid tissue10,15,18 have not supported the notion that CXCL13 is actually produced by FDCs, and no CXCL13 protein could be detected after in vitro stimulation of isolated human FDC-like cells.21 Although vascular localization of CXCL13 has been detected in human and murine lymphoid tissue15,18,19 as well as in inflamed human tissue1,13,15 and malignant lymphoma,16 in situ hybridization for mRNA did not support the possibility that endothelial cells do synthesize CXCL13.12,15,16,18 This has led to the notion that the chemokine can be taken up in endothelial cells by transcytosis.13,16 Indeed, we have shown this earlier for another lymphoid chemokine, CCL19, which is present and functions in endothelial cells although being produced by extravascular cells.22 In a study of RA synovial tissue, CXCL13 expression was likewise detected in synovial fibroblasts despite the fact that endothelial cells were the most frequent cell type positive for CXCL13.1 Our finding of CXCL13 associated with extracellular fibrils could possibly explain its apparent expression by synovial fibroblast as shown by immunohistochemistry.1 However, the possibility remains that synovial fibroblasts might represent an additional source of CXCL13 in RA because these cells cannot be distinguished among scattered cells expressing CXCL13 mRNA.

In a recent study of primary lymphoma within the central nervous system, in situ hybridization verified the expression of CXCL13 mRNA by malignant B cells,16 and another study showed that malignant B cells obtained from follicular lymphomas could secrete CXCL13.31 Notably, malignant B cells31 and activated normal CD11c+ blood DCs28 are the only human cells previously reported to secrete CXCL13 protein. We show here that monocytes, macrophages, and immature DCs can be induced to express CXCL13 mRNA, whereas there is no constitutive expression in these cells. Interestingly, only activated monocytes and macrophages were found to secrete CXCL13 protein, as opposed to the immature DCs. Our negative mRNA data for unstimulated cells are in line with a study showing constitutive expression of CXCL13 mRNA in day 6 monocyte-derived DCs, whereas such expression was not detected in the day 3 immature DCs.28 Interestingly, our in vitro stimulation data showed that LPS titration only slightly influences CXCL13 secretion in monocytes, whereas in macrophages it is highly dependent on the LPS level. Thus, at the lowest LPS concentrations (0.1 ng/mL) only monocytes but not macrophages secreted detectable CXCL13 protein, whereas at 1 ng/mL LPS the two cell types secreted comparable amounts and the macrophages continued to show elevated secretion when the concentration of LPS was increased.

Importantly, our data clearly show that activation is required for CXCL13 protein secretion to occur from both monocytes and macrophages. This is well in keeping with the presence of recently extravasated macrophages in inflamed tissue. Because the purity of negative selection was not 100% in our monocyte cultures, a small population of contaminating cells could not be completely ruled out as an in vitro source of CXCL13. However, this possibility would not have explained the striking effect of culture with M-CSF as opposed to culture with IL-4 and GM-CSF prior to LPS stimulation. As shown by immunostaining, neither in vitro cultured monocytes nor macrophages appeared to produce uniformly CXCL13, which agrees with the relatively low level of CXCL13 secretion obtained. This heterogeneity could possibly reflect different activation stages or regulatory mechanisms, and accorded with our in situ data, where far from all monocytes/macrophages in RA and UC lesions were shown to express CXCL13.

CD4+CD11c+CD3 GCDCs were originally distinguished from tingible body macrophages (which likewise are CD4+CD11c+CD3) in tonsillar germinal centers by a flow cytometric procedure in which large cells with bright autofluorescence were gated out.24 GCDCs isolated from tonsils by this procedure have been reported to express CXCL13 mRNA.28 Our finding of strong CD68 expression in all germinal center CD11c+ cells suggested a common macrophage precursor for GCDCs and tingible body macrophages. Indeed, the latter cell type has previously been distinguished from GCDCs only by its intense autofluorescence and nonspecific esterase staining.24 Our data clearly implied that GCDCs and tingible body macrophages present in germinal centers represent different maturational or activation stages derived from the monocyte lineage. Importantly, all GCDCs did not express the same high level of CXCL13 as shown in Figures 1D-E and 2C, and such variability might reflect different activation stages of the actual germinal center. In our previous study of gut-associated lymphoid tissue,15 CXCL13 mRNA was detected in most, but not all, germinal centers by in situ hybridization, whereas CXCL13 mRNA always occurred at the periphery of the follicles. Together, these findings point to the possibility that GCDCs do not constitutively express CXCL13, but need a certain level of activation to produce this chemokine.

Myeloid DCs have been identified as a source of aberrant CXCL13 expression in murine lupus, and CXCL13 was suggested to play a pivotal role in the pathogenesis of this mouse model of autoimmune disease.32 In that study, CD11c+CD11b+ DCs were identified as the main source of this chemokine,32 which accords with our finding of CD11c+ GCDCs expressing CXCL13 in human chronic inflammatory lesions. Peritoneal macrophages have also been identified as a source of CXCL13 in normal mice.33 Interestingly, a recent study of mouse spleen showed that macrophages control the retention and trafficking of B lymphocytes in the marginal zones of this organ.34 However, there are no reports of CXCL13-producing tissue macrophages in murine disease models. Thus, our data are the first evidence for CXCL13 production by macrophages in inflammatory lesions. Our identification of scattered CD14+ and CXCL13-expressing cells outside of the lymphoid aggregates in inflamed tissue strongly suggests that extravasated monocytes may give rise to the progeny of tissue cells producing this chemokine. Importantly, these cells might also be the source of CXCL13 present in vascular endothelium1,15 and associated with other cell types as well.1

In conclusion, our study documents that human monocytes/macrophages are potent inducible producers of CXCL13 and appear to represent the main source of this chemokine in inflammatory lesions where lymphoid neogenesis occurs. Within germinal centers, these producers acquire the previously defined GCDC phenotype.24 Also notably, we identified CXCL13-expressing monocytes/macrophages at inflammatory sites even in the absence of FDCs or HEVs. Taken together, these results suggest that induction of CXCL13-producing cells of the monocyte linage is an early event in human lymphoid neogenesis associated with chronic inflammation. Therefore, such cells may represent a link between innate and specific immune responses in the pathogenesis of UC and RA. This points to circulating monocytes as candidates for targeted therapy of inflammatory disease in the future.


    Acknowledgements
 
The skillful technical assistance of Aaste Aursjø and Kathrine Hagelsteen is gratefully acknowledged.


    Footnotes
 
Submitted February 25, 2004; accepted June 7, 2004.

Prepublished online as Blood First Edition Paper, July 29, 2004; DOI 10.1182/blood-2004-02-0701.

Supported by the Norwegian Foundation for Health and Rehabilitation (through the Norwegian Association for Digestive Diseases; H.S.C.). This work was further supported by grants from the Norwegian Cancer Society (E.S.B, G.H., and P.B.), the Research Council of Norway (H.C.M., G.H., and P.B.), and the Anders Jahre's Fund (P.B.).

E.S.B. and H.C.M. contributed equally to this work.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Hege S. Carlsen, LIIPAT, Institute of Pathology, Rikshospitalet University Hospital, N-0027 Oslo, Norway; e-mail: hege.carlsen{at}klinmed.uio.no.


    References
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results
 Discussion
 References
 

  1. Takemura S, Braun A, Crowson C, et al. Lymphoid neogenesis in rheumatoid synovitis. J Immunol. 2001;167: 1072-1080.[Abstract/Free Full Text]

  2. Surawicz CM, Haggitt RC, Husseman M, McFarland LV. Mucosal biopsy diagnosis of colitis: acute self-limited colitis and idiopathic inflammatory bowel disease. Gastroenterology. 1994;107: 755-763.[Medline] [Order article via Infotrieve]

  3. Hjelmstrom P. Lymphoid neogenesis: de novo formation of lymphoid tissue in chronic inflammation through expression of homing chemokines. J Leukoc Biol. 2001;69: 331-339.[Abstract/Free Full Text]

  4. Weyand CM, Goronzy JJ. Ectopic germinal center formation in rheumatoid synovitis. Ann N Y Acad Sci. 2003;987: 140-149.[Medline] [Order article via Infotrieve]

  5. Cyster JG. Chemokines and cell migration in secondary lymphoid organs. Science. 1999;286: 2098-2102.[Abstract/Free Full Text]

  6. Legler DF, Loetscher M, Roos RS, Clark-Lewis I, Baggiolini M, Moser B. B cell-attracting chemokine 1, a human CXC chemokine expressed in lymphoid tissues, selectively attracts B lymphocytes via BLR1/CXCR5. J Exp Med. 1998;187: 655-660.[Abstract/Free Full Text]

  7. Gunn MD, Ngo VN, Ansel KM, Ekland EH, Cyster JG, Williams LT. A B-cell-homing chemokine made in lymphoid follicles activates Burkitt's lymphoma receptor-1. Nature. 1998;391: 799-803.[CrossRef][Medline] [Order article via Infotrieve]

  8. Ansel KM, Ngo VN, Hyman PL, et al. A chemokine-driven positive feedback loop organizes lymphoid follicles. Nature. 2000;406: 309-314.[CrossRef][Medline] [Order article via Infotrieve]

  9. Forster R, Mattis AE, Kremmer E, Wolf E, Brem G, Lipp M. A putative chemokine receptor, BLR1, directs B cell migration to defined lymphoid organs and specific anatomic compartments of the spleen. Cell. 1996;87: 1037-1047.[CrossRef][Medline] [Order article via Infotrieve]

  10. Mazzucchelli L, Blaser A, Kappeler A, et al. BCA-1 is highly expressed in Helicobacter pylori-induced mucosa-associated lymphoid tissue and gastric lymphoma. J Clin Invest. 1999;104: R49–54.

  11. Shi K, Hayashida K, Kaneko M, et al. Lymphoid chemokine B cell-attracting chemokine-1 (CXCL13) is expressed in germinal center of ectopic lymphoid follicles within the synovium of chronic arthritis patients. J Immunol. 2001;166: 650-655.[Abstract/Free Full Text]

  12. Xanthou G, Polihronis M, Tzioufas AG, Paikos S, Sideras P, Moutsopoulos HM. "Lymphoid" chemokine messenger RNA expression by epithelial cells in the chronic inflammatory lesion of the salivary glands of Sjögren's syndrome patients: possible participation in lymphoid structure formation. Arthritis Rheum. 2001;44: 408-418.[CrossRef][Medline] [Order article via Infotrieve]

  13. Amft N, Curnow SJ, Scheel-Toellner D, et al. Ectopic expression of the B cell–attracting chemokine BCA-1 (CXCL13) on endothelial cells and within lymphoid follicles contributes to the establishment of germinal center-like structures in Sjögren's syndrome. Arthritis Rheum. 2001;44: 2633-2641.[CrossRef][Medline] [Order article via Infotrieve]

  14. Salomonsson S, Jonsson MV, Skarstein K, et al. Cellular basis of ectopic germinal center formation and autoantibody production in the target organ of patients with Sjögren's syndrome. Arthritis Rheum. 2003;48: 3187-3201.[CrossRef][Medline] [Order article via Infotrieve]

  15. Carlsen HS, Baekkevold ES, Johansen F-E, Haraldsen G, Brandtzaeg P. B cell attracting chemokine 1 (CXCL13) and its receptor CXCR5 are expressed in normal and aberrant gut associated lymphoid tissue. Gut. 2002;3: 364-371.

  16. Smith JR, Braziel RM, Paoletti S, Lipp M, Uguccioni M, Rosenbaum JT. Expression of B-cell-attracting chemokine 1 (CXCL13) by malignant lymphocytes and vascular endothelium in primary central nervous system lymphoma. Blood. 2003; 101: 815-821.[Abstract/Free Full Text]

  17. Cyster JG, Ansel KM, Reif K, et al. Follicular stromal cells and lymphocyte homing to follicles. Immunol Rev. 2000;176: 181-193.[CrossRef][Medline] [Order article via Infotrieve]

  18. Schaerli P, Willimann K, Lang AB, Lipp M, Loetscher P, Moser B. CXC chemokine receptor 5 expression defines follicular homing T cells with B cell helper function. J Exp Med. 2000;192: 1553-1562.[Abstract/Free Full Text]

  19. Ebisuno Y, Tanaka T, Kanemitsu N, et al. Cutting edge: the B cell chemokine CXC chemokine ligand 13/B lymphocyte chemoattractant is expressed in the high endothelial venules of lymph nodes and Peyer's patches and affects B cell trafficking across high endothelial venules. J Immunol. 2003;171: 1642-1646.[Abstract/Free Full Text]

  20. Okada T, Ngo VN, Ekland EH, et al. Chemokine requirements for B cell entry to lymph nodes and Peyer's patches. J Exp Med. 2002;196: 65-75.[Abstract/Free Full Text]

  21. Husson H, Lugli SM, Ghia P, et al. Functional effects of TNF and lymphotoxin {alpha}1{beta}2 on FDC-like cells. Cell Immunol. 2000;203: 134-143.[CrossRef][Medline] [Order article via Infotrieve]

  22. Baekkevold ES, Yamanaka T, Palframan RT, et al. The CCR7 ligand ELC (CCL19) is transcytosed in high endothelial venules and mediates T cell recruitment. J Exp Med. 2001;193: 1105-1112.[Abstract/Free Full Text]

  23. Rugtveit J, Nilsen EM, Bakka A, Carlsen H, Brandtzaeg P, Scott H. Cytokine profiles differ in newly recruited and resident subsets of mucosal macrophages from inflammatory bowel disease. Gastroenterology. 1997;112: 1493-1505.[CrossRef][Medline] [Order article via Infotrieve]

  24. Grouard G, Durand I, Filgueira L, Banchereau J, Liu YJ. Dendritic cells capable of stimulating T cells in germinal centres. Nature. 1996;384: 364-367.[CrossRef][Medline] [Order article via Infotrieve]

  25. Rugtveit J, Brandtzaeg P, Halstensen TS, Fausa O, Scott H. Increased macrophage subset in inflammatory bowel disease: apparent recruitment from peripheral blood monocytes. Gut. 1994;35: 669-674.[Abstract/Free Full Text]

  26. Becker S, Warren MK, Haskill S. Colony-stimulating factor-induced monocyte survival and differentiation into macrophages in serum-free cultures. J Immunol. 1987;139: 3703-3709.[Abstract]

  27. Sallusto F, Lanzavecchia A. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor {alpha}. J Exp Med. 1994;179: 1109-1118.[Abstract/Free Full Text]

  28. Vissers JL, Hartgers FC, Lindhout E, Figdor CG, Adema GJ. BLC (CXCL13) is expressed by different dendritic cell subsets in vitro and in vivo. Eur J Immunol. 2001;31: 1544-1549.[CrossRef][Medline] [Order article via Infotrieve]

  29. Luther SA, Lopez T, Bai W, Hanahan D, Cyster JG. BLC expression in pancreatic islets causes B cell recruitment and lymphotoxin-dependent lymphoid neogenesis. Immunity. 2000;12: 471-481.[CrossRef][Medline] [Order article via Infotrieve]

  30. Luther SA, Bidgol A, Hargreaves DC, et al. Differing activities of homeostatic chemokines CCL19, CCL21, and CXCL12 in lymphocyte and dendritic cell recruitment and lymphoid neogenesis. J Immunol. 2002;169: 424-433.[Abstract/Free Full Text]

  31. Husson H, Freedman AS, Cardoso AA, et al. CXCL13 (BCA-1) is produced by follicular lymphoma cells: role in the accumulation of malignant B cells. Br J Haematol. 2002;119: 492-495.[CrossRef][Medline] [Order article via Infotrieve]

  32. Ishikawa S, Sato T, Abe M, et al. Aberrant high expression of B lymphocyte chemokine (BLC/CXCL13) by CD11b+CD11c+ dendritic cells in murine lupus and preferential chemotaxis of B1 cells towards BLC. J Exp Med. 2001;193: 1393-1402.[Abstract/Free Full Text]

  33. Ansel KM, Harris RB, Cyster JG. CXCL13 is required for B1 cell homing, natural antibody production, and body cavity immunity. Immunity. 2002;16: 67-76.[CrossRef][Medline] [Order article via Infotrieve]

  34. Karlsson MC, Guinamard R, Bolland S, Sankala M, Steinman RM, Ravetch JV. Macrophages control the retention and trafficking of B lymphocytes in the splenic marginal zone. J Exp Med. 2003; 198: 333-340.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
A. Cagigi, F. Mowafi, L. V. Phuong Dang, K. Tenner-Racz, A. Atlas, S. Grutzmeier, P. Racz, F. Chiodi, and A. Nilsson
Altered expression of the receptor-ligand pair CXCR5/CXCL13 in B cells during chronic HIV-1 infection
Blood, December 1, 2008; 112(12): 4401 - 4410.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Burkle, M. Niedermeier, A. Schmitt-Graff, W. G. Wierda, M. J. Keating, and J. A. Burger
Overexpression of the CXCR5 chemokine receptor, and its ligand, CXCL13 in B-cell chronic lymphocytic leukemia
Blood, November 1, 2007; 110(9): 3316 - 3325.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Lasagni, R. Grepin, B. Mazzinghi, E. Lazzeri, C. Meini, C. Sagrinati, F. Liotta, F. Frosali, E. Ronconi, N. Alain-Courtois, et al.
PF-4/CXCL4 and CXCL4L1 exhibit distinct subcellular localization and a differentially regulated mechanism of secretion
Blood, May 15, 2007; 109(10): 4127 - 4134.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
O. M. Steinmetz, R. A. K. Stahl, and U. Panzer
Formation of lymphoid-like tissue in the kidney--is there a role for chemokines?
Nephrol. Dial. Transplant., February 1, 2007; 22(2): 350 - 352.
[Full Text] [PDF]


Home page
BloodHome page
A. Meraouna, G. Cizeron-Clairac, R. L. Panse, J. Bismuth, F. Truffault, C. Tallaksen, and S. Berrih-Aknin
The chemokine CXCL13 is a key molecule in autoimmune myasthenia gravis
Blood, July 15, 2006; 108(2): 432 - 440.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. V. Bagaeva, P. Rao, J. M. Powers, and B. M. Segal
CXC chemokine ligand 13 plays a role in experimental autoimmune encephalomyelitis.
J. Immunol., June 15, 2006; 176(12): 7676 - 7685.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. O. Orlova, K. B. Majorov, I. V. Lyadova, E. B. Eruslanov, C. E. M'lan, C. M. T. Greenwood, E. Schurr, and A. S. Apt
Constitutive differences in gene expression profiles parallel genetic patterns of susceptibility to tuberculosis in mice.
Infect. Immun., June 1, 2006; 74(6): 3668 - 3672.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
Q. Pan, V. Kravchenko, A. Katz, S. Huang, M. Ii, J. C. Mathison, K. Kobayashi, R. A. Flavell, R. D. Schreiber, D. Goeddel, et al.
NF-{kappa}B-Inducing Kinase Regulates Selected Gene Expression in the Nod2 Signaling Pathway
Infect. Immun., April 1, 2006; 74(4): 2121 - 2127.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
W. Vermi, F. Facchetti, E. Riboldi, H. Heine, S. Scutera, S. Stornello, D. Ravarino, P. Cappello, M. Giovarelli, R. Badolato, et al.
Role of dendritic cell-derived CXCL13 in the pathogenesis of Bartonella henselae B-rich granuloma
Blood, January 15, 2006; 107(2): 454 - 462.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
M. Krumbholz, D. Theil, S. Cepok, B. Hemmer, P. Kivisakk, R. M. Ransohoff, M. Hofbauer, C. Farina, T. Derfuss, C. Hartle, et al.
Chemokines in multiple sclerosis: CXCL12 and CXCL13 up-regulation is differentially linked to CNS immune cell recruitment
Brain, January 1, 2006; 129(1): 200 - 211.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. S. Carlsen, G. Haraldsen, P. Brandtzaeg, and E. S. Baekkevold
Disparate lymphoid chemokine expression in mice and men: no evidence of CCL21 synthesis by human high endothelial venules
Blood, July 15, 2005; 106(2): 444 - 446.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-02-0701v1
104/10/3021    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carlsen, H. S.
Right arrow Articles by Brandtzaeg, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carlsen, H. S.
Right arrow Articles by Brandtzaeg, P.
Related Collections
Right arrow Immunobiology
Right arrow Phagocytes
Right arrow Chemokines, Cytokines, and Interleukins
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2004 by American Society of Hematology         Online ISSN: 1528-0020