Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 15 November 2004, Vol. 104, No. 10, pp. 3046-3051.
Prepublished online as a Blood First Edition Paper on June 29, 2004; DOI 10.1182/blood-2004-03-0897.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-03-0897v1
104/10/3046    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Frederiksen, J.
Right arrow Articles by Nordestgaard, B. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Frederiksen, J.
Right arrow Articles by Nordestgaard, B. G.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Clinical Trials and Observations
Right arrowRelated Letter in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

CLINICAL OBSERVATIONS, INTERVENTIONS, AND THERAPEUTIC TRIALS

Methylenetetrahydrofolate reductase polymorphism (C677T), hyperhomocysteinemia, and risk of ischemic cardiovascular disease and venous thromboembolism: prospective and case-control studies from the Copenhagen City Heart Study

Jeppe Frederiksen, Klaus Juul, Peer Grande, Gorm B. Jensen, Torben V. Schroeder, Anne Tybjærg-Hansen, and Børge G. Nordestgaard

From the Department of Clinical Biochemistry, Herlev University Hospital; the Department of Medicine B, Rigshospitalet, Copenhagen University Hospital; The Copenhagen City Heart Study, Bispebjerg University Hospital; and the Department of Vascular Surgery and Department of Clinical Biochemistry, Rigshospitalet, Copenhagen University Hospital, University of Copenhagen, Denmark.


    Abstract
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results
 Discussion
 References
 
Hyperhomocysteinemia is associated with ischemic cardiovascular disease (ICD) and venous thromboembolism (VTE). We tested the hypothesis that methylenetetrahydrofolate reductase (MTHFR) C677T homozygosity with hyperhomocysteinemia is associated with ICD and VTE. First, 9238 randomly selected whites from the general population were followed for 23 years. Second, 2125 whites with ischemic heart disease and 836 whites with ischemic cerebrovascular disease were compared with 7568 controls from the general population. Plasma homocysteine was elevated 25% in homozygotes versus noncarriers (P < .001) and 19% in ICD/VTE cases versus controls (P < .001). In prospective studies adjusted hazard ratios for ICD and VTE for homozygotes versus noncarriers did not differ from 1.0. Furthermore, MTHFR C677T homozygosity was not associated with increased risk of ICD or VTE in subgroups after stratification for sex, age, cholesterol, high-density lipoprotein cholesterol, lipoprotein(a), fibrinogen, triglycerides, body mass index, smoking, diabetes mellitus, hypertension, and factor V Leiden genotype. Finally, in case-control studies odds ratios for ischemic heart disease and ischemic cerebrovascular disease in homozygotes versus noncarriers did not differ from 1.0. In conclusion, MTHFR C677T homozygosity with hyperhomocysteinemia is not associated with ICD or VTE; however, ICD/VTE is associated with hyperhomocysteinemia. Therefore, ICD and VTE may cause hyperhomocysteinemia, rather than vice versa.


    Introduction
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results
 Discussion
 References
 
Recent meta-analyses suggest that hyperhomocysteinemia is a risk factor for ischemic cardiovascular disease (ICD) and venous thromboembolism (VTE)1-4; however, in prospective studies these associations are less consistent than in cross-sectional or case-control studies.3,5-7 It is therefore still difficult to conclude whether hyperhomocysteinemia causes ICD and VTE or vice versa. An alternative approach, therefore, is to study common genetic causes of hyperhomocysteinemia, like the C677T polymorphism in methylenetetrahydrofolate (MTHFR).2,8-11

MTHFR converts 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, the primary circulatory form of folate.12 MTHFR thereby regulates the remethylation of homocysteine into methionine by 5-methyltetrahydrofolate. The C677T polymorphism renders the enzyme thermo-labile and less active, resulting in hyperhomocysteinemia in the homozygous state.13 Meta-analyses demonstrate overall that TT homozygosity is associated with ICD and VTE;2,4,5,11 however, this could not be documented in the subgroup of nested case-control studies from prospective studies.11

We tested the hypothesis that MTHFR C677T homozygosity is associated with ICD and VTE. To do so, we performed a prospective study in the adult Danish general population with 23 years of follow-up of 9238 individuals; 4035 of these individuals were re-examined for plasma homocysteine levels in 2001-2003. In addition, we also performed 2 case-control studies including 2125 ischemic heart disease (IHD) cases, 836 ischemic cerebrovascular disease (ICVD) cases, and 7568 controls. Our prospective studies constitute the only population-based prospective studies published on MTHFR C677T and risk of ICD and VTE. Our case-control studies constitute by far the largest of any such study published on MTHFR C677T and risk of IHD and ICVD.


    Patients, materials, and methods
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results
 Discussion
 References
 
Study design

Prospective studies. Seven prospective studies were conducted within The Copenhagen City Heart Study. ICD was studied overall but also subclassified into IHD, ICVD, and intermittent claudication, while VTE was studied overall and subclassified into deep venous thrombosis (DVT) and pulmonary embolism (PE). The cohort was defined as participants in The Copenhagen City Heart Study who attended the 1991-1994 examination and gave blood for DNA analysis. All outcomes were recorded in the follow-up period from 1976 through 1999. Individuals diagnosed with ICD before entry into The Copenhagen City Heart Study were excluded from the relevant study, while participants with prior VTE were not excluded.

Case-control studies. Two case populations comprising 2125 IHD patients and 836 ICVD patients who attended the Copenhagen University Hospital were compared with 7568 control subjects from the Copenhagen City Heart Study; controls were free of IHD, ICVD, and intermittent claudication.

Subjects

The Copenhagen City Heart Study. This is a prospective cardiovascular study of individuals selected from the Central-Population-Register Code designed to reflect the adult Danish general population, including both men and women.14 Those invited were stratified into 5-year age groups from 20 to 95 years, with main emphasis placed on the 35- to 70-year-olds. In 1976-1978, a total of 19 329 individuals were invited, of whom 14 223 (74%) participated. In 1981-1983, the original cohort, supplemented with 500 in the 20- to 25-year-old group, was invited and 12 698 (70%) participated. In 1991-1994, the cohort, further supplemented with 3000 in the 20- to 49-year-old group, was invited and 10 135 (61%) participated. Finally, in 2001-2003 4035 individuals were re-examined for plasma homocysteine levels for the present study. More than 99% were whites of Danish descent. DNA was available on 9259 participants of whom 9238 were genotyped for MTHFR C677T.

Information on diagnoses of IHD (World Health Organization International Classification of Diseases, 8th ed. codes 410-414 and ICD-10 codes I21, I22), ICVD (ICD-8 codes 432-435) intermittent claudication (ICD-8 code 443.99 and ICD-10 code I73.9), DVT (ICD-8 codes 451.00, 451.08, 451.09, 451.90, 451.92, 671.01-671.09 and ICD-10 codes I80.1, I80.2, I80.3, O22.3, O87.1) and pulmonary embolism (ICD-8 codes 450.99, 673.99 and ICD-10 codes I26.0, I26.9, O88.2) were gathered until the end of 1999 (ICVD until the end of 1997) from the Danish National Hospital Discharge Register, the Danish National Register of Causes of Death, and medical records from general practitioners and hospitals.

The Danish ethics committees for the cities of Copenhagen, Frederiksberg, and Copenhagen County, as well as the institutional review board for Herlev University Hospital, approved the studies. Informed consent was obtained from participants.

Copenhagen University Hospital. Patients with IHD were identified among patients from the greater Copenhagen area referred for coronary angiography because of angina pectoris from 1991 through 2002. IHD was diagnosed by experienced cardiologists based on characteristic symptoms of stable angina pectoris,15 plus at least one of the following: stenosis on coronary angiography, previous myocardial infarction, or a positive exercise electrocardiography test. Two-thousand one-hundred and twenty-five IHD patients, aged 19-90, were genotyped for MTHFR C677T. More than 99% were whites of Danish descent.

Patients with ICVD were identified among patients from the greater Copenhagen area referred from 1994 to 2002 for outpatient ultrasonography of the carotid artery. Experienced neurologists and vascular surgeons diagnosed ICVD on the basis of sudden onset of focal neurologic symptoms, together with carotid artery stenosis of at least 50% on the symptomatic or most stenotic side. Patients had ischemic stroke (focal neurologic symptoms lasting more than 24 hours when hemorrhage was excluded on computed tomography), transient ischemic attack (focal neurologic symptoms lasting less than 24 hours), or amaurosis fugax (transient monocular blindness). Eight-hundred and thirty-six patients, aged 35-88, were genotyped for MTHFR C677T. More than 99% were whites of Danish descent.

Analysis

The C677T polymorphism is caused by the substitution of thymidine for cytosine in exon 4 of the MTHFR gene. The polymorphism was identified by polymerase chain reaction (PCR) followed by restriction enzyme digestion and separation on a 3% agarose gel. The following sense and antisense primers within exon 4 were used: 5'GCCCAGCCACTCACTGTTTTA3' and 5'AGGACGGTGCGGTGAGAGTG3'. The PCR product of 418 bp was digested with HinFI, resulting in 77 and 341 bp bands for noncarriers, 77, 165, 176, and 341 bands for heterozygotes, and 77, 165, and 176 bands for homozygotes. To avoid misclassification of MTHFR genotype, all participants had their genotypes determined from the agarose gel by 2 independent investigators. Furthermore, data entry was performed in duplicate by 2 independent investigators. Genotyping for factor V Leiden was as previously described.16,17

Both measurement and detection of conventional cardiovascular risk factors was as described previously.18 Homocysteine was measured in EDTA (ethylenediaminetetraacetic acid)–plasma (separated from erythrocytes immediately after blood sampling) using the IMX system (Abbott Diagnostics, Abbott Park, IL).

Statistical analyses

We used SPSS software, version 10.0 (SPSS, Chicago, IL). Two-sided P values less than .05 were considered significant. Categorical variables were compared using Pearson chi-square test. Student t test, Mann-Whitney U test, and analysis of variance (ANOVA) compared continuous variables between groups.

Log-rank tests and Kaplan-Meier curves are given for prospective data. Cox regression analysis was used to estimate hazard ratios adjusted for sex and age or for sex, age, and medians of cholesterol, HDL-cholesterol, lipoprotein(a), fibrinogen, triglycerides, and body mass index, as well as smoking, diabetes mellitus, hypertension, and factor V Leiden genotype. AWald test was performed to test for trend in hazard ratios across MTHFR C677T genotypes. Unconditional logistic regression analyses assessed associations between MTHFR genotype and IHD and ICVD in case-control studies.


    Results
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results
 Discussion
 References
 
In the sample from the adult Danish population used for prospective studies, MTHFR C677T genotype distribution did not differ from that predicted by the Hardy-Weinberg equilibrium (P = .38): there were 4429 noncarriers, 3961 heterozygotes, and 848 homozygotes (Table 1). None of the characteristics listed in Table 1 differed by MTHFR C677T genotype; however, risk factors differed between cases and controls in prospective as well as case-control studies (Table 2).


View this table:
[in this window]
[in a new window]
 
Table 1.. Characteristics of participants in prospective studies by MTHFR C677T genotype

 

View this table:
[in this window]
[in a new window]
 
Table 2.. Characteristics of participants by disease status

 

Plasma homocysteine levels

Among the 4035 persons re-examined in 2001-2003, homocysteine levels were 14.7 ± 0.5 (mean ± SE), 11.8 ± 0.1, and 11.7 ± 0.1 µmol/L in homozygotes, heterozygotes, and noncarriers, respectively (ANOVA: P < .001, Figure 1); on post hoc tests homocysteine levels were 25% higher in homozygotes compared with both heterozygotes and noncarriers (both P < .001). We observed similar differences in homocysteine levels by MTHFR C677T genotype in ICD/VTE cases and controls separately (Figure 1). Overall, ICD/VTE cases and controls had mean homocysteine levels of 14.0 ± 0.4 µmol/L and 11.8 ± 0.1 µmol/L, respectively (19% higher; t test: P < .001).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 1.. Plasma homocysteine levels by MTHFR C677T genotype. Bars represent mean ± SE.

 

Prospective studies

Cumulative incidences of ICD or VTE were similar for all genotypes (Figure 2); we observed 1374 and 208 ICD and VTE events during 165 913 and 173 125 person-years of follow-up. Hazard ratios for ICD and VTE in homozygotes or heterozygotes versus noncarriers did not differ from 1.0, when adjusted for sex and age or after multifactorial adjustment (Table 3). Test for trend in adjusted hazard ratios from noncarriers to heterozygotes to homozygotes were not significant for either end point.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 2.. Cumulative incidences during follow-up of ICD and VTE by MTHFR C677T genotype. Numbers at risk are at the beginning of each 5-year period.

 

View this table:
[in this window]
[in a new window]
 
Table 3.. Hazard ratios for ICD and VTE by MTHFR C677T genotype in prospective studies

 

Subanalyses of end points showed no differences in cumulative incidences of IHD, ICVD, intermittent claudication, DVT, or pulmonary embolism between C677T genotypes (data not shown); we observed 1043, 454, 39, 137, and 98 events during 168 519, 155 997, 187 011, 173 487, and 174 002 person-years of follow-up, respectively. Hazard ratios for IHD, ICVD, intermittent claudication, DVT, or pulmonary embolism for homozygotes or heterozygotes versus noncarriers did not differ from 1.0, adjusted for sex and age or after multifactorial adjustment (Table 4). Tests for trend in adjusted hazard ratios across genotypes were not significant for any end point; although the P value was .04 for ischemic cerebrovascular disease after age and sex adjustment, this trend test became insignificant after multifactorial adjustment.


View this table:
[in this window]
[in a new window]
 
Table 4.. Hazard ratios for IHD, ICVD, intermittent claudication, DVT, and PE by MTHFR C677T genotype in prospective studies

 

Finally, MTHFR C677T genotype was not associated with increased risk of ICD or VTE in any subgroup after stratification for sex, age, cholesterol, HDL-cholesterol, lipoprotein(a), fibrinogen, triglycerides, body mass index, smoking, diabetes mellitus, hypertension, and factor V Leiden genotype (data not shown). Tests of multiplicative interaction showed no evidence for interaction between C677T genotype and the covariates listed above on ICD or VTE.

Case-control studies

Odds ratios for IHD and ICVD in heterozygotes or homozygotes relative to noncarriers did not differ from 1.0 (Table 5).


View this table:
[in this window]
[in a new window]
 
Table 5.. Odds ratios for IHD and ICVD by MTHFR C677T genotype in case-control studies

 


    Discussion
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results
 Discussion
 References
 
MTHFR C677T homozygosity was not associated with ICD or VTE in our prospective study of the adult Danish general population. In subanalyses on IHD, ICVD, intermittent claudication, DVT, and pulmonary embolism, homozygosity also was not associated with either end point. Stratification by 12 risk factors for ICD and/or VTE did not reveal any significant context dependent associations between MTHFR C677T homozygosity and ICD or VTE. Finally, MTHFR C677T homozygosity was not associated with IHD or ICVD in our case-control studies.

In accordance with previous studies,4,9,11,13 we found that MTHFR C677T homozygotes versus noncarriers had a 25% increase in plasma homocysteine levels and that ICD/VTE cases versus controls had a 19% increase in plasma homocysteine levels. It is puzzling, therefore, that while ICD and VTE cases had increased homocysteine levels, MTHFR C677T homozygotes with genetically elevated homocysteine levels did not have increased ICD or VTE risk. This data therefore suggest that hyperhomocysteinemia is not causally related to ICD or VTE, at least not in MTHFR C677T homozygotes. Our data, however, does not contradict the hypothesis that ICD and/or VTE cause hyperhomocysteinemia.

The 2 largest meta-analyses on MTHFR C677T homozygosity and IHD risk both reach the conclusion that MTHFR C677T homozygosity is associated with a common odds ratio for IHD of 1.2 relative to noncarriers (Table 6).2,11 The largest meta-analysis on MTHFR C677T homozygosity and ICVD risk by Kelly et al4 reached a similar conclusion with a common odds ratio of 1.2. Finally, Wald et al2 reported a common odds ratio for VTE of 1.3. Importantly, most studies on which these meta-analyses are based are case-control studies. We could not reproduce the finding of an association between MTHFR homozygosity and any of these end points in our population-based prospective study. There are several possible explanations for this discrepancy, but differences in demographics and risk factor prevalence between previous studies and our study are likely contributors. Alternatively, differences in study design may account for the apparent discrepancy: clustering of additional risk factors among cases in case-control studies may introduce bias toward a higher risk estimate than in population based studies. Thus, subanalyses by Klerk et al11 demonstrated that the association between C677T homozygosity and the risk of IHD observed overall was due to associations observed in case-control studies rather than in nested case-control studies (which are conducted within prospective studies) (Table 6). However, the fact that we could not even reproduce an association between MTHFR C677T homozygosity and either IHD or ICVD in our case-control studies, which are by far the largest reported to date, suggest that design differences are not the only reason for discrepant results. Publication bias toward studies reporting positive associations between MTHFR C677T homozygosity and IHD and/or VTE also could contribute to the observed differences.


View this table:
[in this window]
[in a new window]
 
Table 6.. Meta-analyses of MTHFR C677T homozygosity versus noncarriers on ICD and VTE

 

Another important issue investigated by Klerk et al11 is effect modification of MTHFR C677T homozygosity by folate fortification of foods. Thus, stratification into European studies (where foods are not folate enriched) and North American studies (where foods are folate enriched) demonstrated that the overall association between C677T homozygosity and IHD was less pronounced in North American studies than in European studies (Table 6). However, despite the fact that our study was performed in Denmark where foods, like in other European countries, are not fortified, we could not demonstrate an association between MTHFR C677T homozygosity and ICD or VTE.

Limitations

The conclusions of our study apply to Danish white adults with a mean plasma homocysteine level of 10-15 µmol/L. Whether they also apply to populations with different ethnicity or with different homocysteine levels is unknown.

The fact that DNA samples were not obtained before the 1991-1994 examination is a source of potential bias. If the mortality were higher among MTHFR C677T homozygotes than among heterozygotes and noncarriers, our study would underestimate the association between MTHFR genotype and risk of ICD and/or VTE. However, the observed genotype frequency did not differ from that predicted by the Hardy-Weinberg equilibrium, suggesting that selective disappearance of C677T homozygotes from the cohort is unlikely. Additionally, genotype frequencies did not change with increasing age (MTHFR C677T genotype by 10-year age groups, chi2-test, P = .29). Finally, hazard ratios of ICD and VTE in homozygotes versus noncarriers only from 1991-1994 onwards also did not differ from 1.0.

In conclusion, MTHFR C677T homozygosity with hyperhomocysteinemia is not associated with increased risk of ICD or VTE. Therefore, ICD and VTE may cause hyperhomocysteinemia, rather than vice versa. Alternatively, ICD/VTE and the elevated homocysteine levels in diseased compared to healthy individuals could both be consequences of a common underlying factor. In support of either of these 2 interpretations, the recently published Vitamin Intervention for Stroke Prevention trial showed that moderate reduction of total homocysteine level after ischemic stroke had no effect on vascular outcomes during 2 years of follow-up, but that elevated homocysteine levels predicted increased vascular risk.19


    Acknowledgements
 
We thank Helle Koldkjær and Nina Dahl Kjersgaard for technical assistance.


    Footnotes
 
Submitted March 9, 2004; accepted June 3, 2004.

Prepublished online as Blood First Edition Paper, June 29, 2004; DOI 10.1182/blood-2004-03-0897.

Supported by The Danish Medical Research Council, The Danish Heart Foundation, and the Chief Physician Johan Boserup and Lise Boserup's Fund.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Børge G. Nordestgaard, Department of Clinical Biochemistry, Herlev University Hospital, Herlev Ringvej 75, DK-2730 Herlev, Denmark; e-mail: brno{at}herlevhosp.kbhamt.dk.


    References
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results
 Discussion
 References
 

  1. Bautista LE, Arenas IA, Penuela A, Martinez LX. Total plasma homocysteine level and risk of cardiovascular disease: a meta-analysis of prospective cohort studies. J Clin Epidemiol. 2002;55: 882-887.[CrossRef][Medline] [Order article via Infotrieve]

  2. Wald DS, Law M, Morris JK. Homocysteine and cardiovascular disease: evidence on causality from a meta-analysis. Brit Med J. 2002;325: 1202-1206.[Abstract/Free Full Text]

  3. Clarke R, Collins R, Lewington S, et al. Homocysteine and risk of ischemic heart disease and stroke: a meta-analysis. JAMA. 2002;288: 2015-2022.[Abstract/Free Full Text]

  4. Kelly PJ, Rosand J, Kistler JP, et al. Homocysteine, MTHFR 677C -> T polymorphism, and risk of ischemic stroke: results of a meta-analysis. Neurology. 2002;59: 529-536.[Abstract/Free Full Text]

  5. Christen WG, Ajani UA, Glynn RJ, Hennekens CH. Blood levels off homocysteine and increased risks of cardiovascular disease: causal or casual? Arch Intern Med. 2000;160: 422-434.[Abstract/Free Full Text]

  6. Mangoni AA, Jackson SHD. Homocysteine and cardiovascular disease: current evidence and future prospects. Am J Med. 2002;112: 556-565.[CrossRef][Medline] [Order article via Infotrieve]

  7. Nygard O, Vollset SE, Refsum H, Brattstrom L, Ueland PM. Total homocysteine and cardiovascular disease. J Intern Med. 1999;246: 425-454.[CrossRef][Medline] [Order article via Infotrieve]

  8. Brattstrom L, Wilcken DEL. Homocysteine and cardiovascular disease: cause or effect? Am J Clin Nutr. 2000;72: 315-323.[Abstract/Free Full Text]

  9. Brattstrom L, Wilcken DEL, Ohrvik J, Brudin L. Common methylenetetrahydrofolate reductase gene mutation leads to hyperhomocysteinemia but not to vascular disease: the result of a metaanalysis. Circulation. 1998;98: 2520-2526.[Abstract/Free Full Text]

  10. Jee SH, Beaty TH, Suh I, Yoon YS, Appel LJ. The methylenetetrahydrofolate reductase gene is associated with increased cardiovascular risk in Japan, but not in other populations. Atherosclerosis. 2000;153: 161-168.[CrossRef][Medline] [Order article via Infotrieve]

  11. Klerk M, Verhoef P, Clarke R, Blom HJ, Kok FJ, Schouten EG. MTHFR 677C -> T polymorphism and risk of coronary heart disease: a meta-analysis. JAMA. 2002;288: 2023-2031.[Abstract/Free Full Text]

  12. Rosenblatt D, Fenton W. Inherited disorders of folate and cobalamin transport and metabolism. In: Scriver C, Beaudet A, Valle D, Sly W, eds. The Metabolic & Molecular Bases of Inherited Disease. New York, New York: McGraw-Hill; 2001: 3897-3933.

  13. Frosst P, Blom HJ, Milos R, et al. A candidate genetic risk factor for vascular disease—a common mutation in methylenetetrahydrofolate reductase. Nat Genet. 1995;10: 111-113.[CrossRef][Medline] [Order article via Infotrieve]

  14. Schnohr P, Jensen G, Lange P, Scharling H, Appleyard M. The Copenhagen City Heart Study—tables with data from the third examination 1991-1994. Eur Heart J. 2001;3(suppl H): 1-83.

  15. Julian DG, Bertrand ME, Hjalmarson A, et al. Management of stable angina pectoris: recommendations of the Task Force of the European Society of Cardiology. Eur Heart J. 1997;18: 394-413.[Free Full Text]

  16. Juul K, Tybjaerg-Hansen A, Steffensen R, Kofoed S, Jensen G, Nordestgaard BG. Factor V Leiden: The Copenhagen City Heart Study and 2 meta-analyses. Blood. 2002;100: 3-10.[Abstract/Free Full Text]

  17. Simioni P, Prandoni P, Lensing AW, et al. The risk of recurrent venous thromboembolism in patients with an Arg506 -> Gln mutation in the gene for factor V (factor V Leiden). N Engl J Med. 1997; 336: 399-403.[Abstract/Free Full Text]

  18. Sethi AA, Tybjaerg-Hansen A, Gronholdt ML, Steffensen R, Schnohr P, Nordestgaard BG. Angiotensinogen mutations and risk for ischemic heart disease, myocardial infarction, and ischemic cerebrovascular disease: six case-control studies from the Copenhagen City Heart Study. Ann Intern Med. 2001;134: 941-954.[Abstract/Free Full Text]

  19. Toole JF, Malinow MR, Chambless LE, et al. Lowering homocysteine in patients with ischemic stroke to prevent recurrent stroke, myocardial infarction, and death: the Vitamin Intervention for Stroke Prevention (VISP). Randomized Controlled Trial. JAMA. 2004;291: 565-575.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?

Related Letter in Blood Online:

Hyperhomocysteinemia: cause or effect of disease?
Rossella Marcucci, Anna Maria Gori, Rosanna Abbate, Jeppe Frederiksen, Klaus Juul, Anne Tybjærg-Hansen, and Børge G. Nordestgaard
Blood 2005 105: 3382-3384. [Full Text] [PDF]



This article has been cited by other articles:


Home page
J. Mol. Diagn.Home page
S. D. Barker, S. Bale, J. Booker, A. Buller, S. Das, K. Friedman, A. K. Godwin, W. W. Grody, E. Highsmith, J. A. Kant, et al.
Development and Characterization of Reference Materials for MTHFR, SERPINA1, RET, BRCA1, and BRCA2 Genetic Testing
J. Mol. Diagn., November 1, 2009; 11(6): 553 - 561.
[Abstract] [Full Text] [PDF]


Home page
CLIN APPL THROMB HEMOSTHome page
A.-M. Simundic, N. Nikolac, and E. Topic
Methodological Issues in Genetic Association Studies of Inherited Thrombophilia: Original Report of Recent Practice
Clinical and Applied Thrombosis/Hemostasis, June 1, 2009; 15(3): 327 - 333.
[Abstract] [PDF]


Home page
BloodHome page
A. M. Chamberlain, A. R. Folsom, S. R. Heckbert, W. D. Rosamond, and M. Cushman
High-density lipoprotein cholesterol and venous thromboembolism in the Longitudinal Investigation of Thromboembolism Etiology (LITE)
Blood, October 1, 2008; 112(7): 2675 - 2680.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
S. J Lewis, D. A Lawlor, B. G Nordestgaard, A. Tybjaerg-Hansen, S. Ebrahim, J. Zacho, A. Ness, S. Leary, and G. D. Smith
The methylenetetrahydrofolate reductase C677T genotype and the risk of obesity in three large population-based cohorts.
Eur. J. Endocrinol., July 1, 2008; 159(1): 35 - 40.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
W. Ageno, C. Becattini, T. Brighton, R. Selby, and P. W. Kamphuisen
Cardiovascular Risk Factors and Venous Thromboembolism: A Meta-Analysis
Circulation, January 1, 2008; 117(1): 93 - 102.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
R. P. Agarwal, S. M. Peters, M. Shemirani, and N. von Ahsen
Improved Real-Time Multiplex Polymerase Chain Reaction Detection of Methylenetetrahydrofolate Reductase (MTHFR) 677C>T and 1298A>C Polymorphisms Using Nearest Neighbor Model-Based Probe Design
J. Mol. Diagn., July 1, 2007; 9(3): 345 - 350.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
R. Y.L. Zee, S. Mora, S. Cheng, H. A. Erlich, K. Lindpaintner, N. Rifai, J. E. Buring, and P. M Ridker
Homocysteine, 5,10-Methylenetetrahydrofolate Reductase 677C>T Polymorphism, Nutrient Intake, and Incident Cardiovascular Disease in 24 968 Initially Healthy Women
Clin. Chem., May 1, 2007; 53(5): 845 - 851.
[Abstract] [Full Text] [PDF]


Home page
CLIN APPL THROMB HEMOSTHome page
S. Kabukcu, N. Keskin, A. Keskin, and E. Atalay
The Frequency of Factor V Leiden and Concomitance of Factor V Leiden With Prothrombin G20210A Mutation and Methylene Tetrahydrofolate Reductase C677T Gene Mutation in Healthy Population of Denizli, Aegean Region of Turkey
Clinical and Applied Thrombosis/Hemostasis, April 1, 2007; 13(2): 166 - 171.
[Abstract] [PDF]


Home page
Nephrol Dial TransplantHome page
C. A. Boger, M. Stubanus, T. Haak, A. K. Gotz, J. Christ, U. Hoffmann, G. A. J. Riegger, B. K. Kramer, and for the GENDIAN Study Group
Effect of MTHFR C677T genotype on survival in type 2 diabetes patients with end-stage diabetic nephropathy
Nephrol. Dial. Transplant., January 1, 2007; 22(1): 154 - 162.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
M. C. Reed, H. F. Nijhout, M. L. Neuhouser, J. F. Gregory III, B. Shane, S. J. James, A. Boynton, and C. M. Ulrich
A Mathematical Model Gives Insights into Nutritional and Genetic Aspects of Folate-Mediated One-Carbon Metabolism
J. Nutr., October 1, 2006; 136(10): 2653 - 2661.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
A. M Devlin, R. Clarke, J. Birks, J. G. Evans, and C. H Halsted
Interactions among polymorphisms in folate-metabolizing genes and serum total homocysteine concentrations in a healthy elderly population
Am. J. Clinical Nutrition, March 1, 2006; 83(3): 708 - 713.
[Abstract] [Full Text] [PDF]


Home page
BMJHome page
S. J Lewis, S. Ebrahim, and G. Davey Smith
Meta-analysis of MTHFR 677C->T polymorphism and coronary heart disease: does totality of evidence support causal role for homocysteine and preventive potential of folate?
BMJ, November 5, 2005; 331(7524): 1053.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
A. Tripodi, V. Chantarangkul, M. Menegatti, L. Tagliabue, and F. Peyvandi
Performance of Clinical Laboratories for DNA Analyses to Detect Thrombophilia Mutations
Clin. Chem., July 1, 2005; 51(7): 1310 - 1311.
[Full Text] [PDF]


Home page
BMJHome page
T. Fahey, P. Brindle, and S. Ebrahim
The polypill and cardiovascular disease
BMJ, May 7, 2005; 330(7499): 1035 - 1036.
[Full Text] [PDF]


Home page
BMJHome page
G. Davey Smith and S. Ebrahim
What can mendelian randomisation tell us about modifiable behavioural and environmental exposures?
BMJ, May 7, 2005; 330(7499): 1076 - 1079.
[Full Text] [PDF]


Home page
BloodHome page
R. Marcucci, A. M. Gori, R. Abbate, J. Frederiksen, K. Juul, A. Tybjaerg-Hansen, and B. G. Nordestgaard
Hyperhomocysteinemia: cause or effect of disease?
Blood, April 15, 2005; 105(8): 3382 - 3384.
[Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
F. Aucella, M. Margaglione, E. Grandone, M. Vigilante, G. Gatta, M. Forcella, M. Ktena, A. De Min, G. Salatino, D. A. Procaccini, et al.
The C677T methylenetetrahydrofolate reductase gene mutation does not influence cardiovascular risk in the dialysis population: results of a multicentre prospective study
Nephrol. Dial. Transplant., February 1, 2005; 20(2): 382 - 386.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
D. Ginsburg
Genetic Risk Factors for Arterial Thrombosis and Inflammation
Hematology, January 1, 2005; 2005(1): 442 - 444.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-03-0897v1
104/10/3046    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Frederiksen, J.
Right arrow Articles by Nordestgaard, B. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Frederiksen, J.
Right arrow Articles by Nordestgaard, B. G.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Clinical Trials and Observations
Right arrowRelated Letter in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2004 by American Society of Hematology         Online ISSN: 1528-0020