Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 15 November 2004, Vol. 104, No. 10, pp. 3169-3172.
Prepublished online as a Blood First Edition Paper on April 22, 2004; DOI 10.1182/blood-2003-11-3861.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-11-3861v1
104/10/3169    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bonci, D.
Right arrow Articles by De Maria, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bonci, D.
Right arrow Articles by De Maria, R.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Brief Reports
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

HEMATOPOIESIS
Brief report

Potential role of APRIL as autocrine growth factor for megakaryocytopoiesis

Désirée Bonci, Michael Hahne, Nadia Felli, Cesare Peschle, and Ruggero De Maria

From the Laboratory of Hematology and Oncology, Istituto Superiore di Sanità, Rome Italy; Institut de Génétique Moléculaire de Montpellier, Montpellier, France; Kimmel Cancer Center, Thomas Jefferson University, Philadelphia, PA; and Mediterranean Institute of Oncology, Catania, Italy.


    Abstract
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 References
 
A proliferation-inducing ligand (APRIL) is a new tumor necrosis factor family member implicated in tumor cell proliferation. We investigated the role of APRIL in megakaryocytopoiesis, a developmental hematopoietic process responsible for progenitor cell differentiation to megakaryoblasts and megakaryocytes, leading to platelet formation. APRIL is not expressed in CD34+ progenitor cells from healthy donors, but it is massively up-regulated during the proliferative phase of megakaryocytic cell differentiation. Exogenous APRIL expression in primary cells increases megakaryocytic cell growth, suggesting that APRIL acts as a proliferative factor in megakaryocytopoiesis. More importantly, neutralization of endogenous APRIL was able to dramatically reduce megakaryocyte expansion and platelet production. Thus, our data provide evidence that APRIL acts as a growth factor for terminal megakaryocytopoiesis and may promote physiologic platelet production.


    Introduction
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 References
 
The production of mature megakaryocytes (MKs) from multipotent hematopoietic progenitor cells requires the coordinated activity of different cytokine signaling pathways to ensure controlled cell proliferation, survival, and differentiation.1-3

Thrombopoietin (TPO) is a major hematopoietic growth factor that supports early hematopoietic cells and all the developmental stages of megakaryocytopoiesis.4,5 Several other cytokines can promote MK growth and platelet production in physiologic or pathologic circumstances, including stem cell factor (SCF), interleukin 1 (IL-1), IL-3, IL-6, and IL-11.1,2 Increased platelet production is observed in essential thrombocythemia and during inflammation, as the inflammatory environment promotes the formation of MKs.2 The tumor necrosis factor (TNF) family is a group of cytokines involved in the regulation of cell death, proliferation, activation, and differentiation. Some members of the TNF family bind and activate death receptors, a group of surface proteins able to transduce apoptotic signals on ligand binding.6-8 Death receptor ligands are likely to inhibit the megakaryocytopoietic process, as shown by the ability of CD95 (Fas/APO-1) ligand to block MK maturation through the specific targeting of key developmental transcription factors.9 Recently, a proliferation-inducing ligand (APRIL) has been identified as a new member of the TNF family proteolytically processed in the Golgi compartment by a furin convertase and released as a soluble form.10,11 Furin is involved in the maturation of growth factors and integrins synthesized by MKs and appears as a key enzyme for megakaryocytopoiesis and thrombocytopoiesis.12,13 APRIL mRNA levels are reportedly low in normal tissues. In contrast, high mRNA levels have been detected in tumor cell lines and in several primary tumor tissues.14-16 Such expression has been proposed to promote cancer cell survival and proliferation because exogenous expression of APRIL increased tumor cell growth in vitro and in vivo.10 Although APRIL can bind to B-cell maturation antigen (BCMA) and transmembrane activator and calcium modulator and cyclophillin ligand (CAML) interactor (TACI) receptors, the protumor effect of this cytokine seems mediated by at least one additional, yet unidentified, receptor.15 Similarly, recent evidence supports the presence of a functional receptor, different from BCMA and TACI, in fibroblast and epithelial cell lines.10,15 The existence of another functional receptor is further corroborated by the inability of BLys/BAFF, another member of the TNF family capable of binding BCMA and TACI, to promote the proliferation of APRIL-sensitive tumor cells.14,15,17

We speculate that the ability of APRIL to act as autocrine growth factor was not confined to tumor cells. Therefore, we investigated APRIL expression and function in hematopoiesis. Here, we show that MKs express considerable levels of APRIL and that targeting endogenous APRIL production severely affects MK proliferation and platelet generation.


    Study design
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 References
 
Cell cultures and gene transfer studies

CD34+ cells were purified from cord blood samples by Ficoll gradient centrifugation and 3 rounds of microbead sorting (Miltenyi Biotec, Bergish-Gladbach, Germany). Megakaryocytic unilineage cultures were obtained by cultivating CD34+ cells in serum-free medium supplemented with 100 ng/mL TPO.18 Platelet production was evaluated as previously described.19

APRIL and BLyS cDNAs were cloned into the retroviral vector, PINCO-GFP (green fluorescent protein).20 CD34+ cells were subjected to 6 infection cycles and placed in growth medium supplemented with cycling growth factors (IL-3, 100 U/mL; SCF, 100 ng/mL; Flt3 100 ng/mL) for 48 hours before sorting. GFP+ cells were separated by flow cytometry and cultivated in serum-free medium containing 100 ng/mL TPO to obtain virtually pure transduced MK populations.

RT-PCR and immunoblot analysis

cDNA amplification was obtained by 35 polymerase chain reaction (PCR) cycles. PCR products were verified by sequencing, analyzed by Southern blotting, and normalized by amplification of the S26 gene. APRIL forward primer: 5'TAAAAAGTGGCTCCCAGCTT3'; reverse primer 5'GGTGGGAAT-GAAAAGGGAAA3'; probe: 5'CATCTTCCTGGGTTTGGCTCCCCGTTC-CTC3'. BCMA forward primer: 5'TTTCTTTGGCAGTTTTCGTG3'; reverse primer: 5'GATGCAGTCTTCACAGGTGC3'; probe: 5'GGTCTCCTGGGCAT-GGCTAACATTGACCTG3'. TACI forward primer: 5'CCAAGGATTGGAG-CACAGA3'; reverse primer: 5'GGCAGGCACACACACAAT3'; probe: 5'GCCCCGCTCAAGGCCCCGTCAAAGTCAAAGTCCGGC3'.

Real-time reverse transcription–PCR (RT-PCR) was performed by TaqMan technology, using the ABI PRISM 7700 DNA sequence detection system (Applied Biosystems, Foster City, CA). Thermal cycling conditions included 40 cycles at 95°C for 15 seconds and at 60°C for 1 minute. Original input RNA amounts were calculated with relative standard curves for APRIL and glyceraldehyde phosphate dehydrogenase (GAPDH) RNA. Gene expression values were reported as the normalized percentage derived by dividing the copy numbers of APRIL by GAPDH, using cells transduced with APRIL cDNA as reference control. Commercial ready-to-use primers/probe mixes were used (Assay-on-Demand Gene Expression products, Hs00601664_g1; Applied Biosystems).

Protein extracts were prepared by resuspending cell pellets in 1% nonidet P-40 (NP40) lysis buffer. Equal amounts of proteins were analyzed by standard immunoblot procedure. The rabbit polyclonal anti-APRIL antibody was produced as previously described11 and used at 5 µg/mL. Anti-BLyS polyclonal rabbit antibody (BD PharMingen, Los Angeles, CA) was used at a dilution of 1:1000.

Cell surface binding of APRIL was assessed by incubating 2 x 105 cells with 100 ng/mL Flag-APRIL (APRIL MEGA ligand; Alexis, Lausen, Switzerland) for 1 hour at 37°C. After incubation, cells were washed 3 times in phosphate-buffered saline (PBS) and APRIL receptor expression was evaluated by immunofluorescence staining using anti–Flag-M2 (Sigma, St Louis, MO) and a fluorescein isothiocyanate (FITC)–conjugated antimouse IgG antibody (Molecular Probes, Eugene, OR).


    Results and discussion
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 References
 
The megakaryocytic unilineage liquid culture system recapitulates physiologic megakaryocytopoiesis and allows the study of different steps of the differentiation process.18

In TPO-supplemented culture of cord blood CD34+ cells, morphologic evaluation indicates the presence of putative mononuclear megakaryoblasts at day 2 to 3, then at day 10 to 12 cells mature in binuclear and polynucleated MKs and begin to produce platelets.19

We analyzed megakaryocytic cells at various differentiation stages for the expression of APRIL and its receptors. Flow cytometry analysis showed that APRIL binding to its putative receptors was absent in CD34+ cells, but gradually increased during MK differentiation (Figure 1A). Similarly, APRIL mRNA was not present in CD34+ cells or in day 3 megakaryoblasts but was easily detectable from day 5 until the end of the culture, reaching considerably high levels around day 9 (Figure 1B-C). Moreover, immunoblot analysis revealed the presence of both full-length and soluble APRIL in MKs (Figure 1D). In contrast, we were not able to detect TACI or BCMA mRNA at any stage of megakaryocytic differentiation (Figure 1B), suggesting that APRIL binding to MKs depends on the presence of a different receptor.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 1.. Expression of APRIL and its receptors during MK differentiation. (A) Flow cytometry analysis of cord blood CD34+ cells undergoing unilineage MK differentiation (from day 3 to day 14) labeled with recombinant Flag-APRIL (open histograms) as compared with staining controls (black histograms). Jurkat and 293 cells were used as positive and negative controls, respectively. (B-C) Semiquantitative RT-PCR (B) and real-time (C) analyses of CD34+ and differentiating megakaryocytic cells. Peripheral blood mononuclear cells (PBMCs) and hematopoietic progenitors transduced with empty vector (PINCO) or with APRIL cDNA (APRIL) were used as controls. Error bars indicate ± standard deviation (SD). (D) Immunoblot analysis of APRIL expression in CD34+ and differentiating megakaryocytic cells. 293 cells transfected with empty vector (P) or with APRIL cDNA (APRIL) were used as controls.

 

The expression of APRIL in megakaryoblasts prompted us to investigate whether APRIL could influence the growth of megakaryocytic cultures. We therefore transduced cord blood CD34+ progenitor cells with a retrovirus carrying the APRIL cDNA and GFP as reporter gene, so that the positive cells could be sorted by fluorescence-activated cell sorting. Both the empty vector and a vector containing the cDNA of BLyS/BAFF were transduced as negative controls. Expression of exogenous genes in GFP+ cells was confirmed by immunoblot analysis (Figure 2A). Sorted cells were cultivated in MK unilineage medium for 8 days because the previous exposure to the cycling factors during retroviral transduction reduces the time required for the complete maturation of hematopoietic precursors.9 Megakaryocytic culture quantification revealed a significantly increased expansion of APRIL-transduced cells during the proliferative phase as compared with the control populations, whereas during the late differentiation period the differentially transduced cells showed a comparable modest increase in number (Figure 2B). Thus, exogenous APRIL promotes the growth of megakaryocytocytic cells during their expansion phase.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 2.. APRIL promotes MK expansion and platelet production. (A) Cycling cord blood CD34+ cells were transduced with empty vector (P), with APRIL (APRIL) or BLyS (BLyS) cDNA and analyzed by immunoblot for APRIL and BLyS expression after cytofluorimetric sorting based on GFP+ cells. 293 cells transfected with empty vector (P) or with APRIL (APRIL) or BLyS (BLyS) cDNA were used as controls. (B) Cell growth of cells transduced and sorted as described in panel A and cultured in unilineage MK system from day 0 to day 3 and from day 5 to day 8. (C) Cell growth of cord blood CD34+ cells cultured in standard unilineage MK system (control) or in the presence of TACI-Fc or Fn14-Fc recombinant soluble proteins (Alexis). (D) Platelet production from unilineage MK culture or in the presence or in the absence of recombinant soluble TACI-Fc. Error bars indicate ± SD. *P < .01, **P < .001.

 

To determine whether the production of endogenous APRIL contributes to the megakaryopoietic process, cord blood CD34+ cells were grown in MK unilineage culture in the presence of soluble human recombinant TACI-Fc fusion protein, which binds APRIL and neutralizes its proliferative activity. As shown in Figure 2C, exposure to TACI-Fc fusion protein dramatically reduced the growth of megakaryocytic cells, whereas the Fn14-Fc fusion protein that interacts with TWEAK, another member of the TNF family, was ineffective. Similarly, the addition of TACI-Fc fusion protein in the culture medium from day 5 resulted in a significant decrease of platelet production (Figure 2D), confirming the contribution of autocrine APRIL production to megakaryocytopoiesis. On exposure to TACI-Fc, we did not observe a significant increase in apoptosis nor a decreased production of platelets per single MK (results not shown). Thus, the contribution of APRIL on megakaryocytopoiesis seems to be the result of a direct increase in MK proliferation.

Data presented here indicate that APRIL acts as an autocrine growth factor for megakaryocytic cells. During in vitro differentiation, APRIL is expressed from the promegakaryocytic stage until terminal maturation. The strong reductions of MK growth and platelet production obtained after neutralization of endogenous activity suggest that APRIL may promote the physiologic megakaryocytopoiesis.

Although original reports have focused their attention on the role of APRIL in tumorigenesis, APRIL expression has been found in monocytes and dendritic cells.21,22 Moreover, recent data indicate that APRIL modulates B- and T-cell immunity, 14,22,23 suggesting that APRIL may act on different hematopoietic cells.

BCMA and TACI expression appears to be restricted to B lymphocytes. Accordingly, no expression of TACI or BCMA could be detected in MKs. Therefore, we conclude that APRIL binding and growth signaling in MKs are mediated by another unknown receptor, as supposed by different authors in other systems.15,17 Different cytokines can increase MK growth and platelet production in concert with TPO. These promegakaryocytic factors are generally produced by other cell types, such as leukocytes, fibroblasts, and bone marrow stroma cells. However, MKs can produce cytokines that promote their differentiation program, such as platelet-derived growth factor and von Willebrand factor.24 Moreover, we have recently shown that autocrine-paracrine vascular endothelial growth factor (VEGF) loops can increase MK polyploidization through the stimulation of Flt1 receptor.25 The ability of endogenous APRIL to contribute to MK expansion suggests that it can constitute a major autocrine growth factor for megakaryocytopoiesis. Thus, it is likely that the activity of self-produced cytokines is not restricted to the accomplishment of the MK differentiation program but may play a considerable role in MK growth, eventually contributing to determine the amount of platelet production.


    Acknowledgements
 
The authors thank Paola Di Matteo, Stefano Guida, Gualtiero Mariani, and Giuseppe Loreto for their contribution to the paper.


    Footnotes
 
Submitted November 12, 2003; accepted April 8, 2004.

Prepublished online as Blood First Edition Paper, April 22, 2004; DOI 10.1182/blood-2003-11-3861.

Supported by funding from the Italian Association for Cancer Research (AIRC) and Association of International Cancer Research (AICR).

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Ruggero De Maria, Department of Hematology and Oncology, Viale Regina Elena 299, 00161 Rome, Italy; e-mail: rdemaria{at}tin.it.


    References
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 References
 

  1. Ellis MH, Avraham H, Groopman JE. The regulation of megakaryocytopoiesis. Blood Rev. 1995;9: 1-6.[Medline] [Order article via Infotrieve]

  2. Kaushansky K. Thrombopoietin. N Engl J Med. 1998;339: 746-754.[Free Full Text]

  3. Shivdasani RA. Molecular and transcriptional regulation of megakaryocyte differentiation. Stem Cells. 2001;19: 397-407.[Abstract/Free Full Text]

  4. Kaushansky K, Drachman JG. The molecular and cellular biology of thrombopoietin: the primary regulator of platelet production. Oncogene. 2002; 21: 3359-3367.[CrossRef][Medline] [Order article via Infotrieve]

  5. Alexander WS, Roberts AW, Nicola NA, Li R, Metcalf D. Deficiencies in progenitor cells of multiple hematopoietic lineages and defective megakaryocytopoiesis in mice lacking the thrombopoietic receptor c-Mpl. Blood. 1996;87: 2162-2170.[Abstract/Free Full Text]

  6. Pinkoski MJ, Green DR. Fas ligand, death gene. Cell Death Differ. 1999;6: 1174-1181.[CrossRef][Medline] [Order article via Infotrieve]

  7. Walczak H, Krammer PH. The CD95 (APO-1/Fas) and the TRAIL (APO-2L) apoptosis systems. Exp Cell Res. 2000;256: 58-66.[CrossRef][Medline] [Order article via Infotrieve]

  8. Smith CA, Farrah T, Goodwin RG. The TNF receptor superfamily of cellular and viral proteins: activation, costimulation, and death. Cell. 1994; 76: 959-962.[CrossRef][Medline] [Order article via Infotrieve]

  9. De Maria R, Zeuner A, Eramo A, et al. Negative regulation of erythropoiesis by caspase-mediated cleavage of GATA-1. Nature. 1999;401: 489-493.[CrossRef][Medline] [Order article via Infotrieve]

  10. Hahne M, Kataoka T, Schroter M, et al. APRIL, a new ligand of the tumor necrosis factor family, stimulates tumor cell growth. J Exp Med. 1998; 188: 1185-1190.[Abstract/Free Full Text]

  11. Lopez-Fraga M, Fernandez R, Albar JP, Hahne M. Biologically active APRIL is secreted following intracellular processing in the Golgi apparatus by furin convertase. EMBO Rep. 2001;2: 945-951.[CrossRef][Medline] [Order article via Infotrieve]

  12. Laprise MH, Grondin F, Cayer P, McDonald PP, Dubois CM. Furin gene (fur) regulation in differentiating human megakaryoblastic Dami cells: involvement of the proximal GATA recognition motif in the P1 promoter and impact on the maturation of furin substrates. Blood. 2002;100: 3578-3587.[Abstract/Free Full Text]

  13. Wise RJ, Barr PJ, Wong PA, Kiefer MC, Brake AJ, Kaufman RJ. Expression of a human proprotein processing enzyme: correct cleavage of the von Willebrand factor precursor at a paired basic amino acid site. Proc Natl Acad Sci U S A. 1990; 87: 9378-9382.[Abstract/Free Full Text]

  14. Stein JV, Lopez-Fraga M, Elustondo FA, et al. APRIL modulates B and T cell immunity. J Clin Invest. 2002;109: 1587-1598.[CrossRef][Medline] [Order article via Infotrieve]

  15. Rennert P, Schneider P, Cachero TG, et al. A soluble form of B cell maturation antigen, a receptor for the tumor necrosis factor family member APRIL, inhibits tumor cell growth. J Exp Med. 2000;192: 1677-1684.[Abstract/Free Full Text]

  16. Roth W, Wagenknecht B, Klumpp A, et al. APRIL, a new member of the tumor necrosis factor family, modulates death ligand-induced apoptosis. Cell Death Differ. 2001;8: 403-410.[CrossRef][Medline] [Order article via Infotrieve]

  17. Ware CF. APRIL and BAFF connect autoimmunity and cancer. J Exp Med. 2000;192: F35-38.[Free Full Text]

  18. Guerriero R, Testa U, Gabbianelli M, et al. Unilineage megakaryocytic proliferation and differentiation of purified hematopoietic progenitors in serum-free liquid culture. Blood. 1995;86: 3725-3736.[Abstract/Free Full Text]

  19. Mattia G, Vulcano F, Milazzo L, et al. Different ploidy levels of megakaryocytes generated from peripheral or cord blood CD34+ cells are correlated with different levels of platelet release. Blood. 2002;99: 888-897.[Abstract/Free Full Text]

  20. Grignani F, Kinsella T, Mencarelli A, et al. High-efficiency gene transfer and selection of human hematopoietic progenitor cells with a hybrid EBV/retroviral vector expressing the green fluorescence protein. Cancer Res. 1998;58: 14-19.[Abstract/Free Full Text]

  21. Medema JP, Planelles-Carazo L, Hardenberg G, Hahne M. The uncertain glory of APRIL. Cell Death Differ. 2003;10: 1121-1125.[CrossRef][Medline] [Order article via Infotrieve]

  22. Litinskiy MB, Nardelli B, Hilbert DM, et al. DCs induce CD40-independent immunoglobulin class switching through BLyS and APRIL. Nat Immunol. 2002;3: 822-829.[CrossRef][Medline] [Order article via Infotrieve]

  23. Balazs M, Martin F, Zhou T, Kearney J. Blood dendritic cells interact with splenic marginal zone B cells to initiate T-independent immune responses. Immunity. 2002;17: 341-352.[CrossRef][Medline] [Order article via Infotrieve]

  24. Greenberg SM, Chandrasekhar C. Hematopoietic factor-induced synthesis of von Willebrand factor by the Dami human megakaryoblastic cell line and by normal human megakaryocytes. Exp Hematol. 1991;19: 53-58.[Medline] [Order article via Infotrieve]

  25. Casella I, Feccia T, Chelucci C, et al. Autocrine-paracrine VEGF loops potentiate the maturation of megakaryocytic precursors through Flt1 receptor. Blood. 2003;101: 1316-1323.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
haematolHome page
D. Bonci, M. Musumeci, V. Coppola, A. Addario, C. Conticello, M. Hahne, M. Gulisano, F. Grignani, and R. De Maria
Blocking the APRIL circuit enhances acute myeloid leukemia cell chemosensitivity
Haematologica, December 1, 2008; 93(12): 1899 - 1902.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-11-3861v1
104/10/3169    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bonci, D.
Right arrow Articles by De Maria, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bonci, D.
Right arrow Articles by De Maria, R.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Brief Reports
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2004 by American Society of Hematology         Online ISSN: 1528-0020