SEARCH:   Advanced

Blood, 15 July 2004, Vol. 104, No. 2, pp. 409-414. Prepublished online as a Blood First Edition Paper on March 23, 2004; DOI 10.1182/blood-2004-01-0126. This Article Abstract Full Text (PDF) All Versions of this Article: 2004-01-0126v1 104/2/409    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Sahni, A. Articles by Francis, C. W. Search for Related Content PubMed PubMed Citation Articles by Sahni, A. Articles by Francis, C. W. Related Collections Hemostasis, Thrombosis, and Vascular Biology Immunobiology Cell Adhesion and Motility Chemokines, Cytokines, and Interleukins Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY Interleukin-1 but not IL-1 binds to fibrinogen and fibrin and has enhanced activity in the bound form Abha Sahni, Min Guo, Sanjeev K. Sahni, and Charles W. Francis From the Hematology/Oncology Unit, Department of Medicine, University of Rochester School of Medicine & Dentistry, Rochester, NY.    Abstract Top Abstract Introduction Materials and methods Results Discussion References   Fibrin is formed at sites of injury or inflammation and provides the temporary matrix to support vascular cell responses that are also mediated by cytokines including interleukin-1 (IL-1). We have shown previously that fibroblast growth factor 2 (FGF-2) binds with high affinity to fibrin(ogen). Because IL-1 has a structure similar to FGF-2, we have investigated the possible binding of IL-1 to fibrin(ogen). Experiments using IL-1 immobilized on Sepharose beads and soluble iodine 125 (125I)-labeled fibrinogen demonstrated no specific interaction of IL-1 with fibrinogen, but IL-1 showed saturable and specific binding. Scatchard analysis indicated a single binding site with an apparent Kd = 1.5 nM and a maximum molar binding ratio of IL-1 to fibrinogen of 1.8:1. Binding of 125I-IL-1 to Sepharose-immobilized fibrinogen also demonstrated a single binding site with an apparent Kd of 3.5 nM. IL-1 also bound specifically to fibrin monomer and polymerized fibrin with apparent Kds of 3.4 nM and 2.3 nM, respectively. IL-1 displaced FGF-2 for binding to fibrin, indicating an interaction with the same or a closely related site. Compared with free form, fibrinogen-bound IL-1 stimulated increased activation of endothelial cell nuclear factor B (NF-B), monocyte chemoattractant protein-1 (MCP-1) secretion, and nitric oxide (NO) synthesis. We conclude that IL-1 binds with high affinity to fibrin(ogen) and demonstrates increased activity in the bound form. (Blood. 2004; 104:409-414)    Introduction Top Abstract Introduction Materials and methods Results Discussion References   Hemostatic activation and inflammatory responses both occur at sites of vascular injury, and coordination between these processes is needed for organized cell responses. Fibrinogen and fibrin are prominent at sites of injury, and increased vascular permeability results in movement of fibrinogen into the extracellular space where it may be converted to fibrin. Interactions of inflammatory cells with the endothelium are mediated by fibrinogen that acts as a bridge connecting endothelial cell receptors with inflammatory cells.1 Degradation products of fibrinogen and fibrin increase vascular permeability and induce chemotaxis at sites of inflammation.2,3 Fibrin that is formed at sites of injury is critical in hemostasis and also forms the provisional matrix to support cellular processes of repair. In this role, fibrin is not passive, but rather it actively directs cellular processes through specific receptor-mediated interactions to regulate permeability,4 endothelial cell adhesion,5 synthesis and secretion of tissue plasminogen activator and prostacyclin,6,7 plasminogen activator inhibitor-1,8 interleukin-8 (IL-8),9 and von Willebrand factor.10 Fibrinogen and fibrin are also implicated in the development, progression, and thrombotic complications of atherosclerosis, and they are found in increased amounts in atherosclerotic vessels.11 The vascular response to injury is also regulated by cytokines including those of the IL-1 family that are important in inflammation. The IL-1 polypeptides are pleiotropic cytokines that affect a wide variety of cells.12 IL-1 and IL-1 are 2 members that share many structural features and act on cells through the same receptors.12 However, they differ in their promoter regions, and IL-1 is primarily cell associated, whereas IL-1 is extracellular. In endothelial cells, IL-1 induces procoagulant activity,13 von Willebrand factor release,14 synthesis of plasminogen activator and plasminogen activator inhibitor-1,15 and inhibits the thrombomodulin-protein C anticoagulant pathway.16 On exposure to IL-1, endothelial cells increase synthesis of nitric oxide (NO)17 and chemoattractant cytokines18 and express the adhesion molecules intercellular adhesion molecule 1 (ICAM-1)19 and vascular cell adhesion molecule 1 (VCAM-1).20 These endothelial cell responses mediate inflammation and also influence hemostasis. We have shown previously that fibrinogen and fibrin bind to the angiogenic growth factors fibroblast growth factor 2 (FGF-2) and vascular endothelial growth factor (VEGF)21,22 and that fibrinogen potentiates FGF-2 function23 and provides protection from proteolysis.24 IL-1 and IL-1 have structural features similar to FGF-2 including a -barrel structure consisting of 12 strands.25 They both are synthesized as intracellular proteins without a hydrophobic leader peptide but are released from cells and bind specific receptors that also share structural similarities in their extracellular binding domains26 with a similar mode of ligand recognition. Because of their similarities in structure to FGF-2, we hypothesized that IL-1 and IL-1 would bind to fibrin(ogen) to coordinate inflammatory and hemostatic responses at sites of injury. The results demonstrate that IL-1 but not IL-1 binds specifically and with high affinity to fibrin(ogen) and that this augments the effects of IL-1 on endothelial cells.    Materials and methods Top Abstract Introduction Materials and methods Results Discussion References   Proteins Plasminogen-free human fibrinogen was purchased from Enzyme Research Laboratories (South Bend, IN), and fibronectin in the preparation was depleted by chromatography on gelatin-Sepharose (Pharmacia, Piscataway, NJ). Fibrinogen eluting from the gelatin-Sepharose column was further depleted of fibronectin by immunoaffinity chromatography, and the final preparation contained less than 0.02 ng/mL of fibronectin as determined by enzyme-linked immunosorbent assay (ELISA; American Diagnostica, Greenwich, CT) at a fibrinogen concentration of 1 mg/mL. Radioiodination of fibrinogen to a specific activity of 1.9 x 108 counts per minute (cpm)/mg was performed using the iodogen method, and unbound iodine 125 (125I) was removed following chromatography on Sephadex G-10 (Pharmacia). Human thrombin (3250 NIH U/mg [National Institutes of Health Units/mg]) was obtained from Calbiochem-Novabiochem (San Diego, CA). Human recombinant IL-1, IL-1, and polyclonal antibody to human IL-1 and IL-1 were purchased from Peprotech (Princeton, NJ). 125I-IL-1 and 125I-IL-1 were obtained from NEN Life Science Products (Boston, MA) at a specific activity of 100 µCi/µg (3.7 MBq/µg). Purified immunoglobulin G (IgG) of monoclonal antibody J88B reactive with a site within the sequence Arg63-Met78 of the human fibrinogen chain was kindly provided by Dr P. J. Simpson-Haidaris (Rochester, NY).27 Binding of fibrinogen to immobilized IL-1 and IL-1 IL-1 was immobilized on Affigel-15 beads (Biorad, Hercules, CA) as described previously.21 Briefly, 1 mL purified polyclonal IL-1 or IL-1 antibody (50 µg/mL) was incubated with 1 mL Affigel-15, which consists of a derivatized cross-linked agarose gel bead support with active N-hydroxysuccinimide esters, in 0.1 M sodium phosphate buffer (pH 7.4) containing 0.25 M NaCl and gently mixed at 25°C for 2 hours. More than 95% of the antibody was bound to the beads. Residual active ester sites were then blocked by the addition of 1 M ethanolamine (pH 8.0), and the suspension was washed several times with 0.1 M sodium phosphate buffer (pH 7.4) containing 0.25 M NaCl. IL-1 or IL-1 (10 µg/mL) was then added to this suspension and gently mixed at 25°C for 1 hour, following which unbound IL-1 was removed by washing with 0.1 M sodium phosphate buffer (pH 7.4) containing 0.25 M NaCl. The amount of IL-1 immobilized on the beads was 6.8 µg/mL and the amount of IL-1 was 7.7 µg/mL as determined by Bradford assay. For binding studies, 125I-fibrinogen at concentrations from 0.5 to 30 nM was incubated at 37°C with a 0.02-mL suspension of immobilized IL-1 or IL-1 in a final volume of 0.1 mL. Nonspecific binding was determined in concurrent parallel experiments using a 10-fold molar excess of unlabeled fibrinogen. Preliminary experiments demonstrated maximum-specific binding after 30 minutes incubation in 0.1 M sodium phosphate buffer (pH 7.4) containing 0.25 M NaCl, and these conditions were used for all subsequent experiments. Following incubation, the beads were separated by centrifugation at 5000g for 10 minutes after which the supernatant was removed, and the beads were then washed rapidly twice with 0.1 M sodium phosphate buffer (pH 7.4) containing 0.25 M NaCl at 4°C to minimize nonspecific association. The amount of bound fibrinogen was calculated from the radioactivity associated with the beads. Binding of 125I-IL-1 and 125I-IL-1 to fibrinogen and fibrin monomer A similar approach was used with 125I-IL-1 or 125I-IL-1 incubated with fibrinogen or fibrin monomer immobilized on Sepharose beads. Affigel-15 beads were first incubated with 1 mg/mL purified monoclonal J88B IgG in 0.2 M sodium bicarbonate buffer (pH 8.3) and gently mixed at 25°C for 2 hours. Residual sites were blocked by incubation in 1 M ethanolamine (pH 8.0), and the suspension was washed several times with 0.2 M sodium bicarbonate buffer (pH 8.3) containing 0.25 M NaCl. Gel with bound antibody was then incubated with 200 µg/mL fibrinogen in sodium phosphate buffer; it was then washed with sodium phosphate buffer (pH 7.4) containing 0.25 M NaCl to remove unbound fibrinogen. This was continued until no further fibrinogen was removed as determined by monitoring the optical density at 280 nm. To convert bound fibrinogen to fibrin monomer, beads were incubated with 0.5 U/mL thrombin at 37°C for 90 minutes. Characterization of binding of 125I-IL-1 or 125I-IL-1 to fibrin monomer was performed in the same way as 125I-fibrinogen binding to immobilized IL-1 or IL-1. 125I-IL-1 or 125I-IL-1 at concentrations from 0.1 to 100 nM was incubated with a 0.02-mL suspension of beads containing 0.1 µg fibrin in a final volume of 0.1 mL. Nonspecific binding was determined in concurrent parallel experiments using a 10-fold molar excess of unlabeled IL-1 or IL-1. Specificity of the binding of IL-1 to fibrin was confirmed by competition experiments in which 0.1 nM of 125I-IL-1 was incubated with 1 µg/mL immobilized fibrin monomer in a final volume of 0.1 mL, and the binding was competitively inhibited by unlabeled IL-1 at concentrations from 0.1 to 100 nM. Binding of IL-1 or IL-1 to polymerized fibrin 125I-IL-1 or 125I-IL-1 at concentrations of 0.1 to 100 nM was added to 100 µg/mL fibrinogen in 0.1 M Tris buffer (pH 7.4) containing 0.25 M NaCl. Thrombin was then added to a final concentration of 0.5 U/mL, which resulted in clotting of the solution. Following incubation at 37°C for 30 minutes, the clot and supernatant were separated by vacuum filtration using GF/C glass microfiber filters (Sigma, St Louis, MO) previously soaked overnight in a solution of 0.5% polyvinyl pyrolidone and 0.1% Tween-20 to reduce nonspecific binding. The clot on the filter was washed quickly with cold 0.1 M Tris buffer (pH 7.4) containing 0.25 M NaCl, and associated radiolabel was measured. Nonspecific binding was determined in parallel experiments incorporating a 10-fold molar excess of unlabeled IL-1 or IL-1. Activation of nuclear factor B (NF-B) Human umbilical vein endothelial cells (HUVECs) were grown in McCoy medium (Flow Laboratories, McLean, VA) supplemented with 10 mM L-glutamine, 20% fetal bovine serum (FBS; HyClone Laboratories, Logan, UT), and 100 U/mL of penicillin and streptomycin (GIBCO BRL, Grand Island, NY). Cells were passaged by detaching with 0.05% trypsin and maintained at 37°C with 5% CO2. For experiments, cells were used at passage 2 and were plated to achieve 80% to 90% confluence after 3 to 5 days in culture. Hirudin (0.5 U/mL; Sigma) was added to inhibit thrombin present in serum. HUVECs were incubated with 2 ng/mL IL-1 in the presence or absence of 1 µg/mL fibrinogen for 2 hours. Lipopolysaccharide (LPS; 1 µg/mL) was used as a positive control. Preparation of nuclear extracts Nuclear proteins were extracted as described previously.28 In brief, cells were scraped, washed twice in cold phosphate-buffered saline (PBS), and resuspended in 20 µL buffer A (10 mM HEPES [N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid], pH 7.9; 10 mM KCl; 1.5 mM MgCl2; 0.5 mM dithiothreitol [DTT]; and 0.5 mM phenylmethylsulfonyl fluoride [PMSF]) and allowed to swell on ice for 20 minutes. The nuclei were separated from the cell lysates by centrifugation at 10 000g for 5 minutes. The nuclear pellet was resuspended in 20 µL extraction buffer (20 mM HEPES, pH 7.9; 420 mM NaCl; 1.5 mM MgCl2; 0.2 mM ethylenediaminetetraacetic acid [EDTA]; 25% glycerol; 0.5 mM PMSF; and 0.5 mM DTT) and incubated for 5 to 10 minutes on ice. The samples were then centrifuged at 9000g for 5 minutes at 4°C. The supernatant was mixed with 30 µL dilution buffer (20 mM HEPES, pH 7.9; 50 mM KCl; 0.5 mM DTT; 0.5 mM EDTA; 20% glycerol; 0.2 mM PMSF). The nuclear extracts, thus obtained, were assayed for protein using the Bradford assay method. Aliquots of the extracts were stored at -70°C for subsequent use in gel-shift assays. Electrophoretic mobility shift assay (EMSA) Gel-shift assays were performed as described previously.28 A double-stranded oligonucleotide containing the consensus DNA-binding site for the NF-B proteins (5'AGTTGAGGGGACTTTCCCAGGC 3') was end-labeled using -32P-adenosine triphosphate (ATP) according to the manufacturer's protocol (Promega, Madison, WI) and purified using a Sephadex G-25 column (Pharmacia). The binding assay was performed as previously described.28 Labeled probe was mixed with 3 µg nuclear protein extract and incubated at 37°C for 20 minutes, following which the samples were electrophoresed on a 5% nondenaturing acrylamide gel at 100 V for 3 hours. The gels were dried, and bands were detected by autoradiography. Gel scanning was used to quantify and analyze changes in band intensities. Measurement of NO HUVEC monolayers were exposed to IL-1 (10 ng/mL) with or without fibrinogen (10 µg/mL) for 1 hour. Medium was then collected, and NO concentration was measured as nitrite using the Nitrate/Nitrite colorimetric assay kit (Cayman Chemicals, Ann Arbor, MI). Acetylcholine (3 mM; Sigma) was used as a positive control, and L-NAME (N(omega)-nitro-L-arginine methyl ester) (3 mM; Sigma) was used to inhibit NO synthesis. Data analysis Unless indicated otherwise, data are expressed as mean ± SD. Scatchard analysis of the data was performed using the Ligand program29 from Biosoft (Ferguson, MO). Each experiment was performed at least 3 times, and the significance of differences in means was determined using a 2-tailed Student t test.    Results Top Abstract Introduction Materials and methods Results Discussion References   Binding of fibrinogen to immobilized IL-1 was saturable and specific with nonspecific binding representing less than 20% of the total (Figure 1A). Saturation of specific binding occurred at a fibrinogen concentration of approximately 10 nM, and an increase in nonspecific binding was observed at higher concentrations. In control experiments over the same range of concentrations there was a maximum of 5% binding of 125I-fibrinogen to beads with immobilized anti-IL-1 IgG only or to beads with no protein bound and active sites blocked with ethanolamine. A plot of bound versus bound/free fibrinogen (Figure 1B) was linear, suggesting the presence of a single binding site. This was confirmed by Scatchard analysis, which indicated that binding was best described by a single site model with an apparent Kd of 1.5 nM. Bmax (maximum specific binding) was 1.4 nM, and the maximum molar binding ratio of IL-1 to fibrinogen was 1.8:1. Using the same method, we observed no specific binding of IL-1 with fibrinogen (data not shown). View larger version (11K): [in this window] [in a new window]   Figure 1.. Binding of fibrinogen to immobilized IL-1 (A) 125I-fibrinogen was incubated with IL-1 immobilized on Sepharose beads, and the amount of bound protein was determined as radioactivity associated with the beads following centrifugation and washing. Nonspecific binding was determined in the same way in the presence of a 10-fold molar excess of unlabeled IL-1. Specific binding was calculated by subtracting the nonspecific from the total bound. Each point represents the mean of 3 different experiments. (B) Scatchard plot. The best fit of the data was determined by analysis using the Ligand program29 and suggests a single binding site.   The association of IL-1 and fibrinogen was also characterized using soluble 125I-radiolabeled IL-1 and fibrinogen immobilized on Sepharose beads (Figure 2). With this system, saturable and specific binding was also observed, and nonspecific binding represented 20% or less of the total. Scatchard analysis (Figure 2B) indicated the presence of a single binding site with apparent Kd of 3.5 nM, and a maximum molar binding ratio of IL-1 to fibrinogen was 2:1. We observed no specific binding of IL-1 with fibrinogen using this system (data not shown). View larger version (12K): [in this window] [in a new window]   Figure 2.. The association of IL-1 and fibrinogen characterized using soluble 125I-radiolabeled IL-1 and fibrinogen immobilized on Sepharose beads. (A) Binding of IL-1 to fibrinogen. 125I-IL-1 was incubated with fibrinogen immobilized on Sepharose beads, and the amount of bound protein was determined as radioactivity associated with the beads following centrifugation and washing. Nonspecific binding was determined in the same way in the presence of a 10-fold molar excess of unlabeled IL-1. Specific binding was calculated by subtracting the nonspecific from the total bound. (B) Scatchard plot. The best fit of the data was determined by analysis using the Ligand program29 and suggests a single binding site.   Conversion of fibrinogen to fibrin is mediated by thrombin, forming fibrin monomer, which then polymerizes to form a branching network of fibers. To characterize the association of IL-1 with fibrin, we incubated Sepharose-immobilized fibrinogen with thrombin. The antibody J88B mediated the immobilization of fibrinogen to the Sepharose beads, thereby limiting polymerization of the fibrin and forming a surface with immobilized fibrin monomer. Binding of 125I-IL-1 to fibrin monomer was found to be of high affinity with specific binding approaching saturation at a concentration of approximately 20 nM IL-1 (Figure 3A). Nonspecific binding was less than 20% at IL-1 concentrations below 100 nM and increased at higher concentrations. A plot of bound versus bound-free ligand was linear (Figure 3B), suggesting the presence of a single binding site, and this was confirmed by Scatchard analysis indicating the presence of one binding site with apparent Kd of 3.4 nM and Bmax of 4.1 nM and a maximum molar binding ratio of IL-1 to fibrin of 2.2:1. Using this method, we observed no specific binding of IL-1 with fibrin (data not shown). View larger version (13K): [in this window] [in a new window]   Figure 3.. Binding of 125I-IL-1 to fibrin monomer was found to be of high affinity. (A) Binding of IL-1 to fibrin monomer. Fibrinogen was immobilized on Sepharose beads and then converted to fibrin monomer by incubation with thrombin. 125I-IL-1 was incubated with the beads, and bound and free ligands were then separated by centrifugation. Nonspecific binding was measured in the presence of a 10-fold molar excess of unlabeled IL-1, and specific binding was determined by subtraction of nonspecific from total binding. Each point represents the mean of 3 different experiments. (B) Scatchard plot. The best fit of the data was determined using the Ligand program29 and indicated the presence of single binding site.   Characterization of binding to polymerized fibrin presents technical and interpretive problems because transport of IL-1 and IL-1 into the gel may be slow or incomplete, and access to potential binding sites within individual fibrin fibers may also be restricted. We chose, therefore, to add 125I-IL-1 or 125I-IL-1 to a solution of fibrinogen, which was then clotted with thrombin to limit problems of transport of IL-1 into a preformed gel. Total binding was measured with this clotting system in the absence of unlabeled competitor, whereas nonspecific binding was measured in the presence of 10-fold molar access of unlabeled competitor. No specific binding of IL-1 with fibrin was observed, whereas IL-1 showed a saturable and specific binding to polymerized fibrin (Figure 4A). A plot of bound versus bound-free 125I-IL-1 was linear (Figure 4B), and Scatchard analysis indicated a single binding site with an apparent Kd of 2.3 nM. View larger version (11K): [in this window] [in a new window]   Figure 4.. IL-1 showed a saturable and specific binding to polymerized fibrin. (A) Binding of 125I-IL-1 to polymerized fibrin. 125I-IL-1 was added to a solution of 100 µg/mL fibrinogen and clotted by the addition of 0.5 U/mL thrombin. Bound and unbound IL-1 were then separated by vacuum filtration, and nonspecific binding was determined in the presence of 10-fold molar excess of IL-1. Specific binding was calculated by subtracting nonspecific from total binding. Each point represents the mean of 3 different experiments. (B) Scatchard plot. The best fit of the data was determined using the Ligand program29 and indicated the presence of single binding site.   Due to the similarities in the structures of IL-1 and FGF-2, we performed competitive binding studies to determine if the same or related sites were involved. 125I-FGF-2 at a concentration of 0.2 nM was incubated with Sepharose-immobilized fibrin. Radioactivity associated with the beads after washing was defined as 100%. Varying concentrations of unlabeled IL-1 from 0.1 to 100 nM were then added to characterize the dissociation. The binding of 125I-FGF-2 was progressively reduced with increasing concentrations of unlabeled IL-1 (Figure 5). View larger version (11K): [in this window] [in a new window]   Figure 5.. Competitive inhibition of FGF-2 binding by IL-1 125I-FGF-2 was incubated with the fibrinogen immobilized on Sepharose beads. Increasing concentrations of unlabeled IL-1 were used to competitively inhibit the binding of 125I-FGF-2 to fibrinogen. Each point represents mean ± SD of 3 separate experiments.   IL-1 induces NF-B activity in endothelial cells.30 To determine whether it retains its activity when bound to fibrinogen, we measured NF-B activation in HUVECs cultured for 2 hours in medium containing 2 ng/mL IL-1 in the presence or absence of 1 µg/mL fibrinogen. Fibrinogen alone did not cause activation of NF-B as measured by EMSA (Figure 6). Gel scanning showed a 30.2-fold increase in NF-B activation in the presence of IL-1 alone, which increased further to 43.4-fold with fibrinogen and IL-1 compared with medium alone. View larger version (87K): [in this window] [in a new window]   Figure 6.. NF-B activation by free or fibrinogen-bound IL-1 Endothelial cells were plated on gelatin-coated wells in McCoy 5A medium supplemented with 20% FBS, 50 µg/mL endothelial cell growth supplement (ECGS), and 100 µg/mL heparin and grown to confluence. The cells were then washed twice with McCoy medium and incubated with 2 ng/mL of IL-1 in the presence or absence of 1 µg/mL fibrinogen for 2 hours. Nuclear protein extracts were then prepared, and EMSA was performed using a double-stranded 32P-labeled consensus NF-B primer. LPS (1 µg/mL) was used as a positive control. Lanes are as follows: 1, LPS; 2, medium alone; 3, fibrinogen; 4, IL-1; and 5, fibrinogen plus IL-1.   NF-B activation induced by IL-1 in endothelial cells results in increased transcription of inflammatory mediators including monocyte chemoattractant protein-1 (MCP-1).31 Therefore, we measured the capacity of fibrinogen and IL-1 to stimulate MCP-1 secretion. IL-1 (2 ng/mL) was added to the culture medium in the presence or absence of 1 µg/mL fibrinogen, and MCP-1 concentration was measured by ELISA after 2 hours. The concentration with medium plus fibrinogen was 75 ± 7 pg/mL, and this was comparable to medium alone (101 ± 4 pg/mL). As expected, IL-1 significantly increased MCP-1 secretion (2005 ± 23 pg/mL), but the combination of both fibrinogen and IL-1 resulted in a further significant increase in MCP-1 in the medium to 3166 ± 340 pg/mL (P < .05; Figure 7) View larger version (11K): [in this window] [in a new window]   Figure 7.. Induction of MCP-1 secretion by fibrinogen-bound IL-1 Endothelial cells were plated on gelatin-coated wells in McCoy 5A medium supplemented with 20% FBS, 50 µg/mL ECGS, and 100 µg/mL heparin and allowed to reach confluence. The cells were washed twice with McCoy medium and incubated with 2 ng/mL of IL-1 in the presence or absence of 1 µg/mL fibrinogen for 2 hours. The medium was then collected, and MCP-1 was measured by ELISA. The results shown are the mean ± SD of 3 separate experiments.   IL-1 activates NO synthase and increases NO secretion by endothelial cells.32 To determine the activity of IL-1 in the presence of fibrinogen, we exposed confluent HUVEC monolayers to IL-1 (10 ng/mL) with or without fibrinogen (10 µg/mL) for 1 hour. Medium was then collected, and the NO concentration in the medium was measured as nitrite levels using the Griess reaction. Fibrinogen alone did not induce NO production, but IL-1 caused a 4.5- ± 1.2-fold increase in NO production compared with medium (P < .03). Compared with IL-1 alone, however, fibrinogen and IL-1 stimulated 3.8- ± 0.6-fold greater secretion of endothelial cell NO (P < .002; Figure 8). This effect was comparable to the response with 3 mM acetycholine, a potent inducer of NO production. L-NAME, an inhibitor of NO synthase, completely blocked the effect. These results indicate that fibrinogen augmented the capacity of IL-1 to stimulate NO synthesis in endothelial cells. View larger version (9K): [in this window] [in a new window]   Figure 8.. Effect of fibrinogen on IL-1 induced nitric oxide synthesis by endothelial cells. Confluent HUVEC monolayers were exposed to IL-1 (10 ng/mL) with or without fibrinogen (10 µg/mL) for 1 hour. Medium was then collected, and NO production was measured as nitrite concentration in the medium using the Griess reaction. Acetylcholine (3 mM) was used as a positive control, and L-NAME (3 mM) was used to inhibit NO synthesis. The results shown are mean ± SD of 3 separate experiments.      Discussion Top Abstract Introduction Materials and methods Results Discussion References   The results demonstrate that IL-1 binds specifically and with high affinity to fibrinogen and fibrin, whereas IL-1 does not. The apparent Kds were similar for fibrinogen, fibrin monomer, and polymerized fibrin with a maximal molar binding ratio of approximately 2:1 for each. Considering that fibrinogen is a dimerically symmetric molecule, the presence of a single binding site is consistent with the presence of one site on each half-molecule. We have shown previously that the angiogenic growth factors VEGF and FGF-2 also bind to fibrinogen and fibrin with high affinity, each demonstrating 2 high-affinity sites per fibrinogen molecule.21,22 FGF-1 showed no affinity,33 similar to the findings with IL-1. Competition for binding to fibrinogen indicates that FGF-2 and IL-1 are likely to interact with the same or related sites. The site on FGF-2 that interacts with fibrinogen has been localized by mutational analysis to 5 residues from Phe95 to Arg109.34 Characterization of changes in binding of FGF-2 to fibrinogen during plasmic degradation suggests that the interactive site may be localized in the carboxyl-terminal region of the chain.35 Further studies will be required to fully characterize the sites involved in the IL-1-fibrinogen interaction. The significance of IL-1 binding to fibrinogen must be considered in relation to both its tissue distribution and also the availability of other sites for binding. Notably, IL-1, which showed no affinity for fibrinogen, is primarily a cell-associated cytokine.12 IL-1 is normally present in blood with a plasma concentration of less than 0.6 pM, and, at a normal plasma fibrinogen concentration of approximately 7 µM and a Kd of 1.5 nM, nearly all IL-1 would be fibrinogen bound in the absence of other binding proteins. However, IL-1 also binds to other plasma proteins, including 2 macroglobulin, with which it interacts slowly, forming a covalent bond that inhibits receptor interaction.36 A specific IL-1-binding protein was previously identified in human plasma, and it did not interact with IL-1,37 similar to the pattern of fibrinogen binding presented. This protein was covalently cross-linked with IL-1 and had a molecular mass (Mr) of 43 kDa under reducing conditions, and this is consistent with that of the 46-kDa fibrinogen chain.35 IL-1 also binds to endothelial cells through IL-1 receptor (IL-R1) and exhibits Kds of 4.0 pM and 0.7 nM for high- and low-affinity interactions.38,39 Fibrin forms at sites of thrombosis, tissue injury, and inflammation, and IL-1 binding may serve to localize the activation of immune responses. In support of this concept, Perez and Roman40 have shown that fibrin colocalizes with IL-1 in lung granulomas using immunohistochemical methods. In addition to localizing its activity, binding to fibrin(ogen) modifies the cellular effects of IL-1. Our results show that fibrinogen-bound IL-1 not only retains activity but also has an increased capacity to activate NF-B and to stimulate MCP-1 secretion and NO synthesis. These endothelial effects of IL-1 are mediated through binding to IL-R1,41 and the mechanisms responsible for augmented activity with fibrinogen could be coordinated at the receptor level. Endothelial cells interact with surface-immobilized fibrinogen to support adherence, but the fibrinogen-binding integrins are also expressed on the free, nonadherent cell surface.42,43 There are several other examples that demonstrate the importance of interactions between growth factors and integrins. For example, ligand-mediated integrin clustering induces aggregation of FGFR44 and stimulates phosphorylation of platelet-derived growth factor- (PDGF-) receptors.45 Schneller et al46 reported that highly tyrosine phosphorylated PDGF- and insulin receptors coimmunoprecipitated with v3. PDGF and V3 coimmunoprecipitate in endothelial cells after activation and demonstrate synergistic stimulation.47 Rusnati et al48 demonstrated a direct interaction of surface-immobilized FGF-2 with v3 that could mediate adhesion, mitogenesis, and urokinase-type plasminogen activator (u-PA) up-regulation. Tanghetti et al49 found that FGFR and v3 cooperate in endothelial cell signaling, and combined growth factor and integrin activation may be required for sustaining prolonged cell activation.49 Together, this evidence indicates the specific interactions of adhesive proteins and that growth factor receptors mediate coordinated effects. Fibrin(ogen) is always present in blood and extracellular fluids, and the high-affinity binding to IL-1 suggests that it will serve to both localize activity and act as a cofactor to augment cellular effects. We have shown that fibrinogen increases IL-1-induced NF-B activation and secretion of MCP-1 and NO. In addition, Perez et al50 demonstrated that fibrinogen stimulated production of IL-1 message and protein by binding to CD18 on human monocytes, and this was confirmed using the monocytic cell line U937. Further, fibrin suppresses production of IL-1Ra in blood cells.40 Together, these findings demonstrate several levels of coordination between the hemostatic and inflammatory systems mediated through fibrinogen and IL-1.    Acknowledgements   The authors thank LiHua Rong for expert technical assistance in culturing primary endothelial cells and Jennifer Jodeksnis for excellent technical assistance. The assistance of Dawn Goetze in preparing this manuscript is acknowledged gratefully.    Footnotes   Submitted January 12, 2004; accepted March 10, 2004. Prepublished online as Blood First Edition Paper, March 23, 2004; DOI 10.1182/blood-2004-01-0126. Supported by grant HL-30616 from the National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD. The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734. Reprints: Abha Sahni, Department of Medicine, PO Box 610, University of Rochester Medical Center, 601 Elmwood Ave, Rochester, NY 14642; e-mail: abha_sahni{at}urmc.rochester.edu.    References Top Abstract Introduction Materials and methods Results Discussion References   Languino LR, Plescia J, Duperray A, et al. Fibrinogen mediates leukocyte adhesion to vascular endothelium through an ICAM-1-dependent pathway. Cell. 1993;73: 1423-1434.[CrossRef][Medline] [Order article via Infotrieve] Rowland FN, Donovan MJ, Picciano PT, Wilner GD, Kreutzer DL. Fibrin-mediated vascular injury: identification of fibrin peptides that mediate endothelial cell retraction. Am J Pathol. 1984;117: 418-428.[Abstract] Senior RM, Skogen WF, Griffin GL, Wilner GD. Effects of fibrinogen derivatives upon the inflammatory response: studies with human fibrinopeptide B. J Clin Invest. 1986;77: 1014-1019.[Medline] [Order article via Infotrieve] Dvorak HF, Nagy JA, Berse B, et al. Vascular permeability factor, fibrin, and the pathogenesis of tumor stroma formation. Ann N Y Acad Sci. 1992; 667: 101-111.[Medline] [Order article via Infotrieve] Chalupowicz DG, Chowdhury ZA, Bach TL, Barsigian C, Martinez J. Fibrin II induces endothelial cell capillary tube formation. J Cell Biol. 1995; 130: 207-215.[Abstract/Free Full Text] Kaplan KL, Mather T, DeMarco L, Solomon S. Effect of fibrin on endothelial cell production of prostacyclin and tissue plasminogen activator. Arteriosclerosis. 1989;9: 43-49.[Abstract/Free Full Text] Ramsby ML, Kreutzer DL. Fibrin induction of tissue plasminogen activator expression in corneal endothelial cells in vitro. Invest Ophthalmol Vis Sci. 1993;34: 3207-3219.[Abstract/Free Full Text] Fukao H, Matsumoto H, Ueshima S, Okada K, Matsuo O. Effects of fibrin on the secretion of plasminogen activator inhibitor-1 from endothelial cells and on protein kinase C. Life Sci. 1995;57: 1267-1276.[CrossRef][Medline] [Order article via Infotrieve] Qi J, Kreutzer DL. Fibrin activation of vascular endothelial cells: induction of IL-8 expression. J Immunol. 1995;155: 867-876.[Abstract] Ribes JA, Ni F, Wagner DD, Francis CW. Mediation of fibrin-induced release of von Willebrand factor from cultured endothelial cells by the fibrin beta chain. J Clin Invest. 1989;84: 435-442.[Medline] [Order article via Infotrieve] Bini A, Mesa-Tejada R, Fenoglio JJ Jr, Kudryk B, Kaplan KL. Immunohistochemical characterization of fibrin(ogen)-related antigens in human tissues using monoclonal antibodies. Lab Invest. 1989;60: 814-821.[Medline] [Order article via Infotrieve] Dinarello CA. Interleukin-1. Cytokine Growth Factor Rev. 1997;8: 253-265.[CrossRef][Medline] [Order article via Infotrieve] Bevilacqua MP, Pober JS, Majeau GR, Cotran RS, Gimbrone MA Jr. Interleukin 1 (IL-1) induces biosynthesis and cell surface expression of procoagulant activity in human vascular endothelial cells. J Exp Med. 1984;160: 618-623.[Abstract/Free Full Text] Paleolog EM, Crossman DC, McVey JH, Pearson JD. Differential regulation by cytokines of constitutive and stimulated secretion of von Willebrand factor from endothelial cells. Blood. 1990;75: 688-695.[Abstract/Free Full Text] Schleef RR, Bevilacqua MP, Sawdey M, Gimbrone MA Jr, Loskutoff DJ. Cytokine activation of vascular endothelium: effects on tissue-type plasminogen activator and type 1 plasminogen activator inhibitor. J Biol Chem. 1988;263: 5797-5803.[Abstract/Free Full Text] Nawroth PP, Handley DA, Esmon CT, Stern DM. Interleukin 1 induces endothelial cell procoagulant while suppressing cell-surface anticoagulant activity. Proc Natl Acad Sci U S A. 1986;83: 3460-3464.[Abstract/Free Full Text] Gross SS, Jaffe EA, Levi R, Kilbourn RG. Cytokine-activated endothelial cells express an isotype of nitric oxide synthase which is tetrahydrobiopterin-dependent, calmodulin-independent and inhibited by arginine analogs with a rank-order of potency characteristic of activated macrophages. Biochem Biophys Res Commun. 1991; 178: 823-829.[CrossRef][Medline] [Order article via Infotrieve] Rollins BJ, Yoshimura T, Leonard EJ, Pober JS. Cytokine-activated human endothelial cells synthesize and secrete a monocyte chemoattractant, MCP-1/JE. Am J Pathol. 1990;136: 1229-1233.[Abstract] Bevilacqua MP, Stengelin S, Gimbrone MA Jr, Seed B. Endothelial leukocyte adhesion molecule 1: an inducible receptor for neutrophils related to complement regulatory proteins and lectins. Science. 1989;243: 1160-1165.[Abstract/Free Full Text] Natarajan M, Udden MM, McIntire LV. Adhesion of sickle red blood cells and damage to interleukin-1 beta stimulated endothelial cells under flow in vitro. Blood. 1996;87: 4845-4852.[Abstract/Free Full Text] Sahni A, Odrljin T, Francis CW. Binding of basic fibroblast growth factor to fibrinogen and fibrin. J Biol Chem. 1998;273: 7554-7559.[Abstract/Free Full Text] Sahni A, Francis CW. Vascular endothelial growth factor binds to fibrinogen and fibrin and stimulates endothelial cell proliferation. Blood. 2000; 96: 3772-3778.[Abstract/Free Full Text] Sahni A, Sporn LA, Francis CW. Potentiation of endothelial cell proliferation by fibrin(ogen)-bound fibroblast growth factor-2. J Biol Chem. 1999;274: 14936-14941.[Abstract/Free Full Text] Sahni A, Baker CA, Sporn LA, Francis CW. Fibrinogen and fibrin protect fibroblast growth factor-2 from proteolytic degradation. Thromb Haemost. 2000;83: 736-741.[Medline] [Order article via Infotrieve] Zhang JD, Cousens LS, Barr PJ, Sprang SR. Three-dimensional structure of human basic fi-broblast growth factor, a structural homolog of interleukin 1 beta [erratum appears in Proc Natl Acad Sci U S A. 1991;88:5477]. Proc Natl Acad Sci U S A. 1991;88: 3446-3450.[Abstract/Free Full Text] Vigers GP, Anderson LJ, Caffes P, Brandhuber BJ. Crystal structure of the type-I interleukin-1 receptor complexed with interleukin-1beta. Nature. 1997;386: 190-194.[CrossRef][Medline] [Order article via Infotrieve] Odrljin TM, Rybarczyk BJ, Francis CW, Lawrence SO, Hamaguchi M, Simpson-Haidaris PJ. Calcium modulates plasmin cleavage of the fibrinogen D fragment gamma chain N-terminus: mapping of monoclonal antibody J88B to a plasmin sensitive domain of the gamma chain. Biochim Biophys Acta. 1996;1298: 69-77.[CrossRef][Medline] [Order article via Infotrieve] Sahni SK, Van Antwerp DJ, Eremeeva ME, Silverman DJ, Marder VJ, Sporn LA. Proteasome-independent activation of nuclear factor kappaB in cytoplasmic extracts from human endothelial cells by Rickettsia rickettsii. Infect Immun. 1998; 66: 1827-1833.[Abstract/Free Full Text] Munson PJ, Rodbard D. Ligand: a versatile computerized approach for characterization of ligand-binding systems. Anal Biochem. 1980;107: 220-239.[CrossRef][Medline] [Order article via Infotrieve] Li X, Tupper JC, Bannerman DD, et al. Phosphoinositide 3 kinase mediates Toll-like receptor 4-induced activation of NF-kappa B in endothelial cells TNF-alpha, inefficient by itself, potentiates IL-1beta-induced PGHS-2 expression in human pulmonary microvascular endothelial cells: requirement of NF-kappaB and p38 MAPK pathways. Infect Immun. 2003;71: 4414-4420.[Abstract/Free Full Text] Hoffmann A, Levchenko A, Scott ML, Baltimore D. The IkappaB-NF-kappaB signaling module: temporal control and selective gene activation [comment]. Science. 2002;298: 1241-1245.[Abstract/Free Full Text] Xu R, Morales JA, Muniyappa R, Skafar DF, Ram JL, Sowers JR. Interleukin-1beta-induced nitric oxide production in rat aortic endothelial cells: inhibition by estradiol in normal and high glucose cultures. Life Sci. 1999;64: 2451-2462.[CrossRef][Medline] [Order article via Infotrieve] Sahni A, Altland OD, Francis CW. FGF-2 but not FGF-1 binds fibrin and supports prolonged endothelial cell growth. J Thromb Haemost. 2003;1: 1304-1310.[CrossRef][Medline] [Order article via Infotrieve] Peng H, Sahni A, Fay PJ, et al. Identification of a binding site on human FGF-2 for fibrinogen. Blood. 2004;103: 2114-2120.[Abstract/Free Full Text] Sahni A, Francis CW. Plasmic degradation modulates activity of fibrinogen-bound fibroblast growth factor-2. J Thromb Haemost. 2003;1: 1271-1277.[CrossRef][Medline] [Order article via Infotrieve] Borth W, Scheer B, Urbansky A, Luger TA, Sottrup-Jensen L. Binding of IL-1 beta to alpha-macroglobulins and release by thioredoxin. J Immunol. 1990;145: 3747-3754.[Abstract] Eastgate JA, Symons JA, Duff GW. Identification of an interleukin-1 beta binding protein in human plasma. FEBS Lett. 1990;260: 213-216.[CrossRef][Medline] [Order article via Infotrieve] Cozzolino F, Torcia M, Aldinucci D, et al. Interleukin 1 is an autocrine regulator of human endothelial cell growth. Proc Natl Acad Sci U S A. 1990; 87: 6487-6491.[Abstract/Free Full Text] Thieme TR, Hefeneider SH, Wagner CR, Burger DR. Recombinant murine and human IL 1 alpha bind to human endothelial cells with an equal affinity, but have an unequal ability to induce endothelial cell adherence of lymphocytes. J Immunol. 1987;139: 1173-1178.[Abstract] Perez RL, Roman J. Fibrin enhances the expression of IL-1 beta by human peripheral blood mononuclear cells: implications in pulmonary inflammation. J Immunol. 1995;154: 1879-1887.[Abstract] Boraschi D, Rambaldi A, Sica A, et al. Endothelial cells express the interleukin-1 receptor type I. Blood. 1991;78: 1262-1267.[Abstract/Free Full Text] Conforti G, Dominguez-Jimenez C, Zanetti A, et al. Human endothelial cells express integrin receptors on the luminal aspect of their membrane. Blood. 1992;80: 437-446.[Abstract/Free Full Text] Dejana E, Languino LR, Polentarutti N, et al. Interaction between fibrinogen and cultured endothelial cells: induction of migration and specific binding. J Clin Invest. 1985;75: 11-18.[Medline] [Order article via Infotrieve] Plopper GE, McNamee HP, Dike LE, Bojanowski K, Ingber DE. Convergence of integrin and growth factor receptor signaling pathways within the focal adhesion complex. Mol Biol Cell. 1995; 6: 1349-1365.[Abstract] Sundberg C, Rubin K. Stimulation of beta1 integrins on fibroblasts induces PDGF independent tyrosine phosphorylation of PDGF beta-receptors. J Cell Biol. 1996;132: 741-752.[Abstract/Free Full Text] Schneller M, Vuori K, Ruoslahti E. Alpha V beta 3 integrin associates with activated insulin and PDGF beta receptors and potentiates the biological activity of PDGF. EMBO J. 1997;16: 5600-5607.[CrossRef][Medline] [Order article via Infotrieve] Woodard AS, Garcia-Cardena G, Leong M, Madri JA, Sessa WC, Languino LR. The synergistic activity of alphavbeta3 integrin and PDGF receptor increases cell migration. J Cell Sci. 1998;111: 469-478.[Abstract] Rusnati M, Tanghetti E, Dell'Era P, Gualandris A, Presta M. alphavbeta3 integrin mediates the cell-adhesive capacity and biological activity of basic fibroblast growth factor (FGF-2) in cultured endothelial cells. Mol Biol Cell. 1997;8: 2449-2461.[Abstract/Free Full Text] Tanghetti E, Ria R, Dell'Era P, et al. Biological activity of substrate-bound basic fibroblast growth factor (FGF2): recruitment of FGF receptor-1 in endothelial cell adhesion contacts. Oncogene. 2002;21: 3889-3897.[CrossRef][Medline] [Order article via Infotrieve] Perez RL, Ritzenthaler JD, Roman J. Transcriptional regulation of the interleukin-1beta promoter via fibrinogen engagement of the CD18 integrin receptor. Am J Respir Cell Mol Biol. 1999;20: 1059-1066.[Abstract/Free Full Text] CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This article has been cited by other articles: C. Karlsson, M. Morgelin, M. Collin, R. Lood, M.-L. Andersson, A. Schmidtchen, L. Bjorck, and I.-M. Frick SufA - a bacterial enzyme that cleaves fibrinogen and blocks fibrin network formation Microbiology, January 1, 2009; 155(1): 238 - 248. [Abstract] [Full Text] [PDF] T. Hou, S. Ray, and A. R. Brasier The Functional Role of an Interleukin 6-inducible CDK9{middle dot}STAT3 Complex in Human {gamma}-Fibrinogen Gene Expression J. Biol. Chem., December 21, 2007; 282(51): 37091 - 37102. [Abstract] [Full Text] [PDF] A. Sahni, A. A. Khorana, R. B. Baggs, H. Peng, and C. W. Francis FGF-2 binding to fibrin(ogen) is required for augmented angiogenesis Blood, January 1, 2006; 107(1): 126 - 131. [Abstract] [Full Text] [PDF] A. Sahni, S. K. Sahni, and C. W. Francis Endothelial Cell Activation by IL-1{beta} in the Presence of Fibrinogen Requires {alpha}V{beta}3 Arterioscler. Thromb. Vasc. Biol., October 1, 2005; 25(10): 2222 - 2227. [Abstract] [Full Text] [PDF] This Article Abstract Full Text (PDF) All Versions of this Article: 2004-01-0126v1 104/2/409    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Sahni, A. Articles by Francis, C. W. Search for Related Content PubMed PubMed Citation Articles by Sahni, A. Articles by Francis, C. W. Related Collections Hemostasis, Thrombosis, and Vascular Biology Immunobiology Cell Adhesion and Motility Chemokines, Cytokines, and Interleukins Social Bookmarking                   What's this?

	Copyright © 2004 by American Society of Hematology         Online ISSN: 1528-0020