Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 15 September 2004, Vol. 104, No. 6, pp. 1711-1715.
Prepublished online as a Blood First Edition Paper on May 27, 2004; DOI 10.1182/blood-2004-02-0462.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-02-0462v1
104/6/1711    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lieby, P.
Right arrow Articles by Pasquali, J.-L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lieby, P.
Right arrow Articles by Pasquali, J.-L.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Immunobiology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY

Pathogenic antiphospholipid antibody: an antigen-selected needle in a haystack

Patricia Lieby, Vincent Poindron, Stamatiki Roussi, Cyril Klein, Anne-Marie Knapp, Jean-Claude Garaud, Martine Cerutti, Thierry Martin, and Jean-Louis Pasquali

From the Laboratoire d'Immunopathologie, Institut National de la Santé etdela Recherche Medicale, Equipe Mixte Inserum (INSERM EMI) 0222, Institut d'Immunohématologie, Hôpital central, Hôpitaux Universitaires de Strasbourg, France; and Institute National de la Recherche Agronomique—Centre National de la Recherche Scientifique—Unité Mixte de Recherche (INRA-CNRS-UMR) 5087, Laboratoire de pathologie comparée, 30380 St Christol les Ales, France.


    Abstract
 Top
 Abstract
 Introduction
 Patient, materials, and methods
 Results
 Discussion
 References
 
Antiphospholipid antibodies represent a heterogeneous group of autoantibodies directed against anionic phospholipids (PLs) usually linked to protein cofactors. Their presence during the antiphospholipid syndrome is associated with risks of thrombosis and fetal losses. Among 5 randomly selected monoclonal antiphospholipid antibodies, all originating from a single patient suffering from this autoimmune disease, only 1 induced fetal losses when passively injected into pregnant mice. Its antiphospholipid activity was dependent on annexin A5, and its variable regions contained mainly 3 replacement mutations. To clarify the role of these mutations in the pathogenicity of the antibody, they were in vitro reverted to the germ line configuration. The resulting "germ line" antibody reacted with multiple self-antigens and only partially lost its reactivity against PLs, but it was no more dependent on annexin A5 and, more importantly, was no more pathogenic. This study illustrates that the in vivo antigen-driven maturation process of natural autoreactive B cells can be responsible for pathogenicity. (Blood. 2004;104:1711-1715)


    Introduction
 Top
 Abstract
 Introduction
 Patient, materials, and methods
 Results
 Discussion
 References
 
Antiphospholipid antibodies (aPLs) constitute a heterogeneous set of autoantibodies directed against a variety of anionic phospholipids such as cardiolipin (CL) or phosphatidylserine. This heterogeneity is obvious at different levels: (1) the autoantibody fine specificity is widened by the cofactor dependency, which indicates the frequent requirement of a variety of phospholipid (PL) binding serum proteins named cofactors (such as {beta} 2-glycoprotein I, prothrombin, protein C, protein S, or annexin A5) for the antibody reactivity1-6; (2) the molecular structure of the variable regions of aPLs is extremely diverse7-9; and (3) APLs are secreted not only during autoimmune pathologies such as the antiphospholipid syndrome (APS), which is characterized by recurrent life-threatening arterial and venous thrombosis as well as recurrent fetal losses, but also under nonautoimmune conditions, such as infectious diseases, or even in healthy young adults without causing any thrombotic complication.

The links between normal and pathologic aPLs are not well understood. In particular, the appearance of these antibodies in physiological conditions leads to 3 main questions: What are the precise stimuli that induce the aPL production? What is the role, if any, of these autoantibodies? How is their production controlled? Different data suggest that aPLs are able to recognize phosphatidylserine (PS) when exposed at the outer part of the cell membrane during the early phase of apoptosis.10 Indeed, it seems that mouse aPLs can be positively selected but also that aPL-producing B cells stay under the control of tolerance mechanisms such as receptor editing.11,12 In human beings, aPL B cells are present in the normal peripheral repertoire, with a discrete pool of memory B cells able to produce somatically mutated forms of these antibodies.13 According to the current hypothesis, normal aPLs, owing to their ability to bind anionic PLs, participate in the clearance of apoptotic cells and apoptotic debris.14 On the other hand, during the autoimmune disease APS, some of these antibodies are known to be pathogenic because they can reproduce fetal losses or thrombosis when passively transferred in animal models.15-18 Are these pathogenic aPLs derived from physiologic ones?

Considering such heterogeneity of aPLs, it is important to define the precise characteristics of pathogenic aPLs. To approach this question, we randomly selected 5 different monoclonal aPLs (maPLs) originating from a single patient suffering from an APS7 and passively transferred each one of these maPLs into pregnant mice. Only one of these maPLs was pathogenic by inducing fetal resorptions. Its antibody variable regions mainly contained 3 mutations, which were shown to be directly linked to the acquisition of pathogenicity.


    Patient, materials, and methods
 Top
 Abstract
 Introduction
 Patient, materials, and methods
 Results
 Discussion
 References
 
Patient

The patient was a 27-year-old woman suffering from a primary APS. She presented with 6 recurrent spontaneous miscarriages and 2 episodes of deep vein thrombosis of the legs within the last 2 years. The patient's serum consistently contained marked elevated levels of aPL immunoglogulin G (IgG) (enzyme-linked immunosorbent assay [ELISA], 84 units GPL) and a weak and transient lupus anticoagulant. After obtaining informed consent from the patient, 30 mL blood was drawn and was used for single IgG aPL cell sorting as described.7

maPLs

The maPLs were obtained as described.7 Briefly, single aPL B cells from the patient's peripheral blood were sorted by flow cytometry using cardiolipin-labeled vesicles. Messenger RNAs of these single B cells were subjected to reverse transcriptase-polymerase chain reaction (RT-PCR) to amplify the V region genes of the H and L chains. The amplification products were cloned into recombinant baculovirus to produce monoclonal human Ig1K in insect cell (sf9) cultures. Monoclonal antibodies CIC3, CIC7, CIC11, CIC15, CIC19, and GL were then purified from the culture supernatants on columns of protein A-Sepharose according to the manufacturer's instructions (Sigma, St Louis, MO).

ELISAs for aPL reactivity, cofactor dependency, and autoantibody profiles

aPL reactivity of CIC7 and CIC15 was tested as previously described, as was cofactor dependency.7 The autoantibody profile was tested by using purified human thyroglobulin, human myoglobin, and purified ssDNA as previously described.19 The binding of CIC15 to annexin A5 or to annexin A5-CL complexes was tested by ELISA: Purified delipidized recombinant annexin A5 (gift from J. M. Freyssinet, Strasbourg, France) or complexes of previously incubated annexin A5 and CL—5 µg/mL annexin A5 and 50 µg/mL CL—in Tris (tris(hydroxymethyl)aminomethane)-buffered saline (TBS) containing CaCl2 were allowed to bind to plastic plates (Maxisorp, Nunc, Roksilde, Denmark). Plates were saturated with delipidized bovine serum albumin (BSA) (Roche Diagnostic, Mannheim, Germany), and then various concentrations of CIC15 or normal human IgG in TBS containing 2 mM CaCl2 were added for 2 hours at 37°C before peroxidase-labeled anti-human IgG (1:15 000), (Jackson ImmunoResearch Labs, West Grove, PA) was added.

Production of the germ line counterpart of CIC15

The PCR products of the CIC15 V regions originating from a single IgG aPL B cell were gel purified and sequenced with the primers used in the second round of PCR amplification and the Big Dye Terminator cycle DNA sequencing kit (Applied Biosystems, Foster City, CA) on an automated ABI 310 sequencer (Applied Biosystems). The V region genes of CIC15 were analyzed using the international ImMunoGeneTics (IMGT) information system, which provides integrated knowledge resources specializing in the immunoglobulin sequence comparisons (http://imgt.cines.fr/textes/IMGTcomparesequence.html).20

The 3 replacement mutations present in the first hypervariable region of CIC VK were reversed to the germ line configuration by site-directed mutagenesis using 3 sets of PCR. PCR1 used 2 primers, GACATTGAGCTCACCCAGTCTCCA ({alpha}, sense) and GCCAACCAGCTACTAATACTCTGACTGG (antisense), and PCR2 used 2 other primers, CGAGTCAGAGTATTAGTAGCTGGTTGGC (sense) and GGGACCAAGCTCGAGATCAAACGG ({beta}, antisense). The products of PCR1 and PCR2, which introduced the desired mutations, were mixed and amplified (PCR3) using {alpha} and {beta} oligonucleotides containing SacI and XhoI cloning sites (under-lined). The products of the PCRs were sequenced to verify the changes and cloned again into the baculovirus with CIC heavy chain V region. The germ line counterpart of CIC15 was then produced by infected sf9 cells and purified from the supernatant.

Model of Ig transfer into pregnant mice

aPL monoclonal antibodies (2 x 100 µg) or control normal human IgG (Novartis, Basel, Switzerland) were intravenously injected into the tail vein of female mice (BALB/c, 2 to 4 months) at day 1 and day 2 postcoitum. The serum level of human IgG present in these mice was tested 1 hour after the second injection to check for the quality of the injections. The pregnant animals were then killed at day 10 postcoitum for macroscopic examination of the embryos. Fetal resorptions were defined as 50% reductions of the normal fetal volume.

Molecular models

Tridimensional models of CIC15 and its germ line counterpart (GL) were generated using SWISS-MODEL, a protein structure homology-modeling server accessible via the program DeepView/swiss Pdb-viewer (http://www.expasy.org/spdbv).21,22 Known 3-dimensional structures (obtained by x-ray crystallography or nuclear magnetic resonance spectroscopy) were used as templates: 1fgvL.pdb, 1bvlB.pdb, and 1f3rB.pdb for CIC15 and 1hezA.pdb for GL; the sequence similarities of the templates to the target sequences are high, especially in the region of the light chain complementarity-determining region-1 (CDR1) loop where the 3 mutations are localized (73% to 82% homology).


    Results
 Top
 Abstract
 Introduction
 Patient, materials, and methods
 Results
 Discussion
 References
 
The purified IgG fraction from the serum of the patient contained polyclonal aPLs with various cofactor dependencies7 and pathogenic antibodies as judged by its capacity to induce fetal losses and fetal resorptions in a model of passive transfer into pregnant mice (data not shown). We took advantage of our previous analysis of the CIC aPL activity at the clonal level to track pathogenic autoantibodies among the polyclonal aPLs present in the serum.7 The variable regions of the heavy and light chains of the CIC aPL single-sorted B cells were cloned into a recombinant baculovirus to produce human monoclonal IgG1Ks in insect cell cultures. We randomly selected the first 5 maPLs that were produced in large enough quantities to test their pathogenicity after passive transfer in the murine model of pregnant mice. The reactivity and the cofactor dependency of 3 monoclonal antibodies (CIC3, CIC11, and CIC19) have already been described.7 Briefly, these 3 monoclonals react with both PS and CL; CIC3 is mainly dependent on {beta} 2-glycoprotein I, CIC11 is mainly dependent on protein C, and CIC19 is dependent on both prothrombin and protein S. The characteristics of CIC7 and CIC15 are described in Figure 1.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 1.. Reactivities and cofactor dependencies of CIC7, CIC15, and GL. See "Results." (A) Reactivity with CL, PS, and PC during ELISA assays in presence of FCS, CIC15 ({blacksquare}), CIC7 (), GL ({square}), and normal human IgG ({blacktriangleup}). (B) Cofactor dependency of CIC15 and GL anti-CL reactivity: Results are expressed as percentages of the increase of binding on CL in presence of FCS, prothrombin (Pt), protein S (S), protein C (C), annexin A5 (A5), {beta} 2-glycoprotein I (GpI), and BSA compared with the binding to CL without the cofactors. (C) Binding of CIC15 on delipidized recombinant annexin A5 ({diamond}) or complexes of CL-annexin A5 ({diamondsuit}).

 

Only one maPL is able to induce fetal losses and fetal resorptions in mice

Female mice were intravenously injected at day 1 and day 2 postcoitum with 100 µg maPLs (groups of 5 to 10 pregnant mice per maPL or control human IgG). At day 2, the serum levels of the human IgGs reached approximately 18 µg/mL. The animals were killed and examined at day 10. By looking at the rosaries of embryos, we observed that CIC15 alone was able to induce fetal resorptions in a significant manner (P = .02, CIC15 versus normal human IgG) (Figure 2). Macroscopic examinations of the mice injected with CIC15 did not reveal any vascular thrombosis (data not shown).



View larger version (36K):
[in this window]
[in a new window]
 
Figure 2.. Effects of CIC maPLs on mouse pregnancy development. (A) Examples of macroscopic examinations of mouse embryos at day 10 after passive administration of maPLs or normal human IgG. (B) Rates of fetal resorptions after passive transfer of normal human IgG (n = 6), CIC3 (n = 7), CIC7 (n = 7), CIC11 (n = 6), CIC19 (n = 6), CIC15 (n = 10), and GL (n = 9). Horizontal brackets indicate mean values; horizontal bar with the star, statistical difference (P < .001).

 

Characteristics of the maPL CIC15

We precisely analyzed the characteristics of the pathogenic maPLs and showed that, in presence of fetal calf serum (FCS), CIC15 reacted only with cardiolipin but not with another anionic PL (PS) or with a neutral PL (phosphatidylcholine [PC]) (Figure 1A). This cardiolipin reactivity is dependent on the presence of annexin A5 as protein cofactor but not on {beta} 2-glycoprotein I, protein C, protein S, or prothrombin (Figure 1B). CIC15 was able to bind delipidized recombinant annexin A5, but its reactivity was enhanced by the presence of CL, showing that CIC15 mainly recognized the complexes formed between CL and annexin A5 (Figure 1C). Finally, the molecular analysis of CIC15 revealed that this antibody was made of almost unmutated heavy chain variable regions (VH, 2 replacement mutations in the first framework, compared with the closest germ line, IGVH4-61*02) but mutated VK regions (closest germ line, IGKV1-5*03) (Figure 3).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 3.. Molecular aspects of CIC15 and GL. Nucleotide sequences of CIC15 VH and CIC15 VK regions compared respectively with their closest VH and VK germ lines. CDRs are indicated; the box contains the VK CDR1 with the 3 replacement mutations distinguishing CIC15 from GL. European Molecular Biology Laboratory (EMBL) accession numbers of CIC15 VH and VK regions are AJ576037 [GenBank] and AJ576038 [GenBank] , respectively.

 

We confirmed that the putative VK germ line was the actual patient's germ line by sequencing it from the patient's polynuclear leukocyte DNA (not shown). The VK mutations are grouped together in the CDR1 of the VK domain, replacing 3 serine residues by asparagine residues, which are commonly described among aPL antibodies so far analyzed.9 These replacement mutations in a CDR of an antibody V region are usually considered to be a hallmark of an antigen selection process that affected the producing B cell.

For comparison, it is interesting that the previous molecular analysis of the nonpathogenic CIC11 VH region also revealed mutations located in a way that suggested an antigen-driven maturation process (replacement/silent mutations in the CDRs versus frameworks, P < .05; see Lieby et al7). On the contrary, the same analysis of VH and VK regions of CIC3 and CIC19 did not suggest such an antigen-driven process.

The mutations are responsible for the pathogenicity

The antibody fine specificity is mainly linked to the structure of its H and L CDRs, with a major impact of the H CDR3.19 Thus, to precisely define the role, if any, of these 3 somatic mutations in the pathogenicity, we reversed the CIC15 VK sequence to the germ line configuration to produce the "germ line" counterpart (GL) of CIC15. The GL antibody, which differs from CIC15 only by the 3 residues in the VK CDR1, partly lost its activity against cardiolipin but still reacted with this antigen in presence of FCS (Figure 1A). However, GL was no more dependent on annexin A5 (Figure 1B) and, more importantly, was no more pathogenic when passively administered to pregnant mice with serum levels equivalent to those obtained with CIC15 (percentage of fetal resorptions, 6%; GL versus CIC15, P < .0001) (Figure 2). Thus, the naturally occurring in vivo replacement of the 3 serine residues by 3 asparagines in the VK CDR1 maintained the general structure of the CDR1 loop and its flexibility (see the 3-dimensional modelizations in Figure 4) but also created the chemical conditions that allowed CIC15 to react with the PL-annexin A5 complexes. The replacement of serine by the more bulky asparagine in CIC15 introduces subtle changes in the 3-dimensional structure of the loop: In particular, 3 more nitrogen atoms are available to form hydrogen bonds with ligands, and the orientation of the amino acids flanking the mutations is modified. These changes were directly responsible for the observed CIC15 pathogenicity.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 4.. Tridimensional models of CIC15 and its germ line counterpart (GL). Only the amino acids of the VK CDR1 loop containing the 3 mutations (serine -> asparagine) are shown here. Balls and sticks represent the unmutated amino acids, whereas the "space-filling" representation (van der Waals surface) highlights the mutations. Atoms: black, N; dark gray, O; and light gray, C.

 

Finally, it is also interesting that the GL antibody has an autoreactivity profile that is similar to the known multireactivity of natural autoantibodies, binding to human thyroglobulin, human myoglobin, and ssDNA. On the contrary, CIC15 multireactivity is much less obvious (Figure 5).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 5.. Autoantibody profiles of CIC15, GL, and normal human IgG. {diamond} indicates human thyroglobulin; {square}, human myoglobin; and {triangleup}, ssDNA.

 


    Discussion
 Top
 Abstract
 Introduction
 Patient, materials, and methods
 Results
 Discussion
 References
 
Animal models of passively transferred polyclonal or monoclonal Ig with aPL reactivity have previously been reported15-18 and clearly demonstrated the potential pathogenicity of aPLs. Salmon and coworkers, using polyclonal aPLs, established that the activation of the complement C3 was of considerable importance in the effector phase of the pathogenicity using this model.23 Here, we show that the pathogenic antibody CIC15, which is able to reproduce the patient's obstetrical pathology, is "hidden" among nonpathogenic aPLs in the patient's serum. Indeed, the classical detection of aPLs takes advantage of the patient's serum and FCS-containing cofactors to reveal the general aPL reactivity but is unable to precisely detect the "few" pathogenic antibodies. It is interesting that, using a classical cofactor-dependency test with the patient's total serum, we were almost unable to detect annexin A5-dependent antibodies.7 This is probably the result of the low sensitivity of this assay. Such a detection of clinically relevant antibodies in women with recurrent fetal losses is an important goal for physicians, but the target could be difficult to reach without designing new tests, in particular if the relative amount of the pathogenic antibody is low compared with the others.

CIC15 is probably not the only pathogenic aPL present in our patient, but it was shown to be dependent on annexin A5, and this peculiarity is probably linked to its pathogenicity. Among the first 14 maPLs originating from the same patient, only CIC15 was dependent on annexin A5 (data not shown). Different arguments highlight the role of annexin A5 in the placenta: This protein, which binds anionic PL (PS and CL) with a high affinity, is strongly expressed by placental trophoblasts and syncytiotrophoblasts under 2-dimensional crystalline arrays,24 and the removal of annexin A5 from these cells creates the conditions for coagulation activation.25-27 Furthermore, injection of antiannexin A5 antibodies in pregnant mice also results in fetal losses.27 Using these arguments and others, Rand suggested that the high-affinity binding of aPLs to PL-protein complexes sterically interferes with the ability of an ordered crystal structure of annexin A5 to form on the cell surface.27 Under this hypothesis, aPLs could induce coagulation by disrupting the ordered structure of the annexin A5 shield, thereby increasing the availability of PL for coagulation reactions. In future experiments using CIC15, it will be interesting to test the precise placental localization of the antibody after passive administration into pregnant mice.

But the most important part of our present data concerns the conclusive demonstration that the affinity maturation process of a natural autoantibody can lead to pathogenicity in human disease. After introduction of a foreign antigen, the usual localization where affinity maturation of antibodies takes place is the germinal center of the secondary lymphoid organ. The random introduction of the mutations along the variable regions of the B-cell antigen receptor (BCR) leads naive B cells to a double process of positive and negative selections. B cells will receive a selective advantage for proliferation if the mutations increase the BCR affinity for the selecting antigen. On the other hand, they will die if the mutations have been neutral or even reduce the BCR reactivity. In normal conditions, this process, which could induce the appearance of autoreactive B cells, is controlled by peripheral tolerance mechanisms to avoid pathologic autoimmunity.28-30 Our results clearly show that this was not the case in our patient, because the germ line version of CIC15, initially present under a multi-self-reactive BCR form on a naive B cell emigrating from bone marrow, was able to change its structure, escape peripheral tolerance mechanisms, and induce pathological consequences.

What could have been the driving forces that created such clinically important changes? Starting from the physiological presence of aPL B cells in human beings, repetition of normal stimuli (apoptosis) may induce the appearance of mutated forms of aPLs and the constitution of a memory B-cell pool.13 This B-cell pool is maintained in a state of immunologic ignorance, likely because of the still quite low affinity of these aPLs. Two circumstances could lead to the production of potentially pathogenic aPLs from this B-cell pool. In the first scenario, new stimuli could create the conditions that introduce additional mutations in the V regions of aPLs. For instance, systemic infections can both induce apoptosis of a variety of cells and stimulate, in particular, memory B cells through the constitutive expression of their Toll-like receptors.30 Under this scenario, intrinsically normal peripheral tolerance mechanisms are just overloaded and lose the control of potentially pathogenic B-cell clones. The catastrophic APS, an uncommon variant of APS, could respond to this scenario knowing the role of infections in precipitating the disease. A second scenario puts the light on primary abnormalities of the peripheral tolerance mechanisms (genetic defect?) without the need for a burden of stimuli.


    Footnotes
 
Submitted February 5, 2004; accepted April 27, 2004.

Prepublished online as Blood First Edition Paper, May 27, 2004; DOI 10.1182/blood-2004-02-0462.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Jean-Louis Pasquali, Laboratoire d'Immunopathologie, INSERM EMI 0222, Institut d'Immunohématologie, Hôpital central, Hôpitaux Universitaires de Strasbourg, 67091, France; e-mail: jean-louis.pasquali{at}hemato-ulp.u-strasbg.fr.


    References
 Top
 Abstract
 Introduction
 Patient, materials, and methods
 Results
 Discussion
 References
 

  1. McNeil HP, Simpson RJ, Chesterman CN, Krilis SA. Anti-phospholipid antibodies are directed against a complex antigen that includes a lipid-binding inhibitor of coagulation: beta 2-glycoprotein I (apolipoprotein H). Proc Natl Acad Sci U S A. 1990;87: 4120-4124.[Abstract/Free Full Text]

  2. Galli M, Comfurius P, Maassen C, et al. Anticardiolipin antibodies (ACA) directed not to cardiolipin but to a plasma protein cofactor. Lancet. 1990;335: 1544-1547.[CrossRef][Medline] [Order article via Infotrieve]

  3. Galli M, Barbui T. Antiprothrombin antibodies: detection and clinical significance in the antiphospholipid syndrome. Blood. 1999;93: 2149-2157.[Free Full Text]

  4. Arvieux J, Pernod G, Regnault V, Darnige L, Garin J. Some anticardiolipin antibodies recognize a combination of phospholipids with thrombin-modified antithrombin, complement C4b-binding protein, and lipopolysaccharide binding protein. Blood. 1999;93: 4248-4255.[Abstract/Free Full Text]

  5. Rand JH, Wu XX, Andree HA, et al. Antiphospholipid antibodies accelerate plasma coagulation by inhibiting annexin-V binding to phospholipids: a "lupus procoagulant" phenomenon. Blood. 1998;92: 1652-1660.[Abstract/Free Full Text]

  6. de Groot PG, Horbach DA, Derksen RH. Protein C and other cofactors involved in the binding of antiphospholipid antibodies: relation to the pathogenesis of thrombosis. Lupus. 1996;5: 488-493.[Medline] [Order article via Infotrieve]

  7. Lieby P, Soley A, Levallois H, et al. The clonal analysis of anticardiolipin antibodies in a single patient with primary antiphospholipid syndrome reveals an extreme antibody heterogeneity. Blood. 2001;97: 3820-3828.[Abstract/Free Full Text]

  8. Chukwuocha RU, Zhu M, Cho CS, et al. Molecular and genetic characterizations of five pathogenic and two non-pathogenic monoclonal antiphospholipid antibodies. Mol. Immunol. 2002;39: 299-311.

  9. Giles IP, Haley JD, Nagl S, Isenberg DA, Latch-man DS, Rahman A. A systematic analysis of sequences of human antiphospholipid and anti-beta2-glycoprotein I antibodies: the importance of somatic mutations and certain sequence motifs. Semin Arthritis Rheum. 2003;32: 246-265.[CrossRef][Medline] [Order article via Infotrieve]

  10. Fadok VA, Voelker DR, Campbell PA, Cohen JJ, Bratton DL, Henson PM. Exposure of phosphatidylserine on the surface of apoptotic lymphocytes triggers specific recognition and removal by macrophages. J Immunol. 1992;148: 2207-2216.[Abstract]

  11. Cocca BA, Seal SN, D'Agnillo P, et al. Structural basis for autoantibody recognition of phosphatidylserine-beta 2 glycoprotein I and apoptotic cells. Proc Natl Acad Sci U S A. 2001;98: 13826-13831.[Abstract/Free Full Text]

  12. Li H, Jiang Y, Cao H, Radic M, Prak EL, Weigert M. Regulation of anti-phosphatidylserine antibodies. Immunity. 2003;18: 185-192.[CrossRef][Medline] [Order article via Infotrieve]

  13. Lieby P, Soley A, Knapp AM, et al. Memory B cells producing somatically mutated antiphospholipid antibodies are present in normal individuals. Blood. 2003;102: 2459-2465.[Abstract/Free Full Text]

  14. Price BE, Rauch J, Shia MA, et al. Anti-phospholipid autoantibodies bind to apoptotic, but not viable, thymocytes in a beta 2-glycoprotein I-dependent manner. J Immunol. 1996;157: 2201-2208.[Abstract]

  15. Branch DW, Dudley DJ, Mitchell MD, et al. Immunoglobulin G fractions from patients with antiphospholipid antibodies cause fetal death in BALB/c mice: a model for autoimmune fetal loss. Am J Obstet Gynecol. 1990;163: 210-216.[Medline] [Order article via Infotrieve]

  16. Blank M, Cohen J, Toder V, Shoenfeld Y. Induction of anti-phospholipid syndrome in naive mice with mouse lupus monoclonal and human polyclonal anti-cardiolipin antibodies. Proc Natl Acad Sci U S A. 1991;88: 3069-3073.[Abstract/Free Full Text]

  17. Olee T, Pierangeli SS, Handley HH, et al. A monoclonal IgG anticardiolipin antibody from a patient with the antiphospholipid syndrome is thrombogenic in mice. Proc Natl Acad Sci U S A. 1996;93: 8606-8611.[Abstract/Free Full Text]

  18. Pierangeli SS, Liu X, Espinola R, et al. Functional analyses of patient-derived IgG monoclonal anti-cardiolipin antibodies using in vivo thrombosis and in vivo microcirculation models. Thromb Hae-most. 2000;84: 388-395.[Medline] [Order article via Infotrieve]

  19. Crouzier R, Martin T, Pasquali JL. Heavy chain variable region, light chain variable region, and heavy chain CDR3 influences on the mono- and polyreactivity and on the affinity of human monoclonal rheumatoid factors. J Immunol. 1995;154: 4526-4535.[Abstract]

  20. Lefranc MP. IMGT, the international ImMuno-GeneTics database. Nucleic Acids Res. 2003;31: 307-310.[Abstract/Free Full Text]

  21. Gueix N, Peitsch MC. SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis. 1997;18: 2714-2723.[CrossRef][Medline] [Order article via Infotrieve]

  22. Schwede T, Kopp J, Guex N, Peitsch MC. SWISS-MODEL: an automated protein homology-modeling server. Nucleic Acids Res. 2003;31: 3381-3385.[Abstract/Free Full Text]

  23. Holers VM, Girardi G, Mo L, et al. Complement C3 activation is required for antiphospholipid antibody-induced fetal loss. J Exp Med. 2002;195: 211-220.[Abstract/Free Full Text]

  24. Krikun G, Lockwood CJ, Wu XX, et al. The expression of the placental anticoagulant protein, annexin V, by villous trophoblasts: immunolocalization and in vitro regulation. Placenta. 1994;15: 601-612.[Medline] [Order article via Infotrieve]

  25. Vogt E, Ng AK, Rote NS. Antiphosphatidylserine antibody removes annexin-V and facilitates the binding of prothrombin at the surface of a chorio-carcinoma model of trophoblast differentiation. Am J Obstet Gynecol. 1997;177: 964-972.[CrossRef][Medline] [Order article via Infotrieve]

  26. Rand JH, Wu XX, Guller S, Scher J, Andree HA, Lockwood CJ. Antiphospholipid immunoglobulin G antibodies reduce annexin-V levels on syncytiotrophoblast apical membranes and in culture media of placental villi. Am J Obstet Gynecol. 1997;177: 918-923.[CrossRef][Medline] [Order article via Infotrieve]

  27. Rand JH. Molecular pathogenesis of the antiphospholipid syndrome. Circ Res. 2002;90: 29-37.[Abstract/Free Full Text]

  28. Goodnow CC, Cyster JG, Hartley SB, et al. Self-tolerance checkpoints in B lymphocyte development. Adv Immunol. 1995;59: 279-368.[Medline] [Order article via Infotrieve]

  29. Notidis E, Heltemes L, Manser T. Dominant, hierarchical induction of peripheral tolerance during foreign antigen-driven B cell development. Immunity. 2002;17: 317-327.[CrossRef][Medline] [Order article via Infotrieve]

  30. Bernasconi NL, Onai N, Lanzavecchia A. A role for Toll-like receptors in acquired immunity: up-regulation of TLR9 by BCR triggering in naive B cells and constitutive expression in memory B cells. Blood. 2003;101: 4500-4504.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
I. Giles, C. Pericleous, X. Liu, J. Ehsanullah, L. Clarke, P. Brogan, M. Newton-West, R. Swerlick, A. Lambrianides, P. Chen, et al.
Thrombin Binding Predicts the Effects of Sequence Changes in a Human Monoclonal Antiphospholipid Antibody on Its In Vivo Biologic Actions
J. Immunol., April 15, 2009; 182(8): 4836 - 4843.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I. Giles, N. Lambrianides, N. Pattni, D. Faulkes, D. Latchman, P. Chen, S. Pierangeli, D. Isenberg, and A. Rahman
Arginine Residues Are Important in Determining the Binding of Human Monoclonal Antiphospholipid Antibodies to Clinically Relevant Antigens
J. Immunol., August 1, 2006; 177(3): 1729 - 1736.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
S. Yurasov, H. Wardemann, J. Hammersen, M. Tsuiji, E. Meffre, V. Pascual, and M. C. Nussenzweig
Defective B cell tolerance checkpoints in systemic lupus erythematosus
J. Exp. Med., March 7, 2005; 201(5): 703 - 711.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-02-0462v1
104/6/1711    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lieby, P.
Right arrow Articles by Pasquali, J.-L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lieby, P.
Right arrow Articles by Pasquali, J.-L.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Immunobiology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2004 by American Society of Hematology         Online ISSN: 1528-0020