|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, 1 October 2004, Vol. 104, No. 7, pp. 1961-1969. Prepublished online as a Blood First Edition Paper on June 10, 2004; DOI 10.1182/blood-2004-02-0637.
CHEMOKINES Chemokine receptor-mediated delivery directs self-tumor antigen efficiently into the class II processing pathway in vitro and induces protective immunity in vivoFrom the Laboratory of Immunology, Gerontology Research Center, National Institute on Aging, Baltimore, MD; Experimental Transplantation and Immunology Branch, Laboratory of Immunoregulation, National Cancer Institute, Frederick, MD; Department of Lymphoma/Myeloma, M.D. Anderson Cancer Center, Houston, TX; Intramural Research Support Program, Science Applications International Corporation (IRSP SAIC)–Frederick, Frederick, MD; and Divisione di Oncologia Medica Falck, Ospedale Niguarda Ca' Granda, Milan, Italy.
Nonimmunogenic antigens can be efficiently rendered immunogenic by targeting them to antigen-presenting cells via differentially expressed chemokine receptors. For example, self-tumor or HIV antigens genetically fused with proinflammatory chemoattractants elicit potent immune responses and protective antitumor immunity in mice. Herein we demonstrate that the mechanism by which chemokine fusions elicit responses is efficient uptake, processing, and presentation of antigens via the major histocompatibility complex class II pathway. Experiments with inhibitors of intracellular trafficking suggest that chemoattractant fusion proteins, but not antigen alone, were processed and presented through early/late endosomal and Golgi compartments and stimulated antigen-specific CD4+ T cells both in vitro and in vivo. Chemokine fusion also facilitated the presentation of antigen by dendritic cells to an autologous human tumor-specific CD4+ T-cell line. Taking advantage of chemokine redundancy, viral chemokine fusions were equally potent in inducing protective immunity in vivo, providing a possible strategy to circumvent hypothetical, vaccine-induced antihost chemokine autoimmunity, for example, by use of viral chemoattractants in humans.
Cell trafficking is regulated by differential expression of heterotrimeric Gi protein coupled 7-transmembrane–domain chemokine receptors (GPCRs).1 Sentinel antigen-presenting cells (APCs), the immature dendritic cells (DCs), preferentially express CCR1, CCR2, CCR5, and CCR6.2-4 Upon ligand binding the receptor is phosphorylated and endocytosed through clathrin-coated vesicles using  -arrestin adaptors,5-7 although some viral chemokine receptors, such as US28, are endocytosed independently of -arrestins.8 The internalized receptors may then be dephosphorylated and recycled back to the cell surface or targeted for degradation.5,9 CCR5 is transported to early endosomes and subsequently recycled to the cell surface, bypassing the Golgi apparatus and late endosomes, and this process does not involve protein synthesis.5 Upon chemokine receptor binding, the chemokine ligand is also internalized although its fate is not known and presumed to be degraded. Moreover, the fate of the internalized receptor and the bound ligand may be regulated by the strength of the ligand-induced signaling or the nature of the ligand itself. For example, CCR5 is endocytosed through clathrin-coated vesicles on binding to RANTES or AOP-RANTES (aminooxypentane regulated-on-activation normal T-expressed and secreted), although the latter drives CCR5 to a degradation pathway, whereas RANTES-bound CCR5 is recycled to the cell surface.5,10 The internalized receptors are degraded by proteosomes, which are considered as major regulators of cytokine receptor expression.11-13
Active immunotherapy based on the targeting of idiotypic antigen (Id), expressed by malignant B cells, is one of the most promising human cancer vaccine approaches.14 Recently, we have demonstrated that effective adaptive immunity against weakly immunogenic tumor antigens could be induced by targeted delivery of such antigens to chemokine receptors on professional APCs by linkage to their chemoattractant ligands ( Herein, we report that chemokine receptors can indeed facilitate uptake and processing of tumor antigens to elicit major histocompatibility complex (MHC) class II–restricted antigen presentation. We demonstrate that APCs incubated with functionally active, but not mutant, chemoattractants fused with model lymphoma antigens, single-chain antibody, and VL chain of MOPC315 tumor, or human lymphoma-derived Id induce efficient antigen-specific cellular responses both in vitro and in vivo. Our data suggest that chemokine receptors targeted with chemoattractant fusion proteins were internalized to early endocytic compartments and used the MHC class II antigen-processing pathway. Furthermore, the approach not only is potent and does not require any adjuvants, but also xenogeneic chemokines, such as the viral broad-range chemokine antagonist viral macrophage inflammatory protein II (vMIP-2), which binds to multiple chemokine receptors, can be used to reduce the possibility of vaccine-induced antihost chemokine autoimmunity.
Fusion gene cloning and plasmid construction
Cloning of sFv from 38C13 has been reported previously.15 The same strategy was applied to clone VH and VL fragments from MOPC315 plasmacytoma (American Type Culture Collection [ATCC], Manassas, VA) and arrange them as sFv315 using the following primers: for VH chain, PRMOPC315VH-1, AAACATATGCTCGAGGACGTGCAGCTGCAGGAGTCT, and PRMOPC315VH-R1, TGTCGACGCCGCCGCCAGAACCACCACCACCTGAGGAGACTGTGAGAGT; for VL chain, PRMOPC315VL-2, AAACTCGAGGGTGGCGGTGGGAGCCAGGCTGTTGTGACTCAGGAA, and PRMOPC315VL-R2, ATAAGATCTTCCCGGGCCTAGGACAGTGACCTTGGT. Genes for mature murine Recombinant fusion proteins production
Fusion proteins were purified as inclusion bodies after overnight induction in SuperBroth (Digene Diagnostics, Beltsville, MD) with 0.8 mM isopropyl Cell lines The carcinogen-induced, C3H 38C-13 B-cell lymphoma23 was a gift from Dr Ronald Levy (Stanford, CA). MOPC315 plasmacytoma cells were purchased from ATCC. The 7A10B2 T-cell line, which recognizes the murine plasmacytoma MOPC315 immunoglobulin (amino acids 91-101), presented by the MHC class II molecule I-Ed,24 was a gift from Dr B. Bogen (Oslo, Norway). The murine epidermis-derived DC line XS52,25 displaying an immature phenotype, was kindly provided by Dr A. Takashima (Dallas, TX). Isolation of murine bone marrow-derived DCs Cells were isolated by the method described by Fields et al.26 Briefly, bone marrow was collected from tibias and femurs of 4- to 6-month-old BALB/c mice. Cells were cultured in DC medium (RPMI 1640 containing 5% heat-inactivated fetal bovine serum, 1% penicillin, streptomycin, 1% L-glutamine, and 5 x 10–5 2-mercaptoethanol [2-ME]) containing 10 ng/mL each of murine interleukin 4 (IL-4) and granulocyte-macrophage colony-stimulating factor (GM-CSF; PeproTech, Rocky Hill, NJ). Immature DCs (iDCs) at day 4 to 5 of cultivation were in general CD11+ (69%), B7.2+ and I-Ab+ (21%), B7.2– and I-Ab+ (18%), CD40+ (27%). On maturation, the DCs were CD11c+ (87%), B7.2+ and I-Ab+ (62%), B7.2– and I-Ab+ (3%), CD40+ (87%). Generation of human DCs Monocyte-derived iDCs were generated from cryopreserved peripheral blood mononuclear cells (PBMCs), as previously described,27 with some modifications. Briefly, PBMCs were enriched for monocytes by depletion of T cells with CD3 microbeads over a magnetic column (Miltenyi Biotec, Auburn, CA) using the manufacturer's protocol. The T cell–depleted PBMCs were plated in serum-free AIM-V medium (Invitrogen, Carlsbad, CA) at 1 x 106 /mL. After 2 hours of incubation at 37° C in 5% CO2 in air, nonadherent cells were discarded and cells were cultured for 7 days in AIM-V medium with IL-4 (500 U/mL) and GM-CSF (800 U/mL; PeproTech). Phenotypic characterization of the iDCs revealed moderate expression of CD11c, HLA DR, and CD86 and low expression or absence of CD14, CD80, and CD83.27 In vitro chemotaxis assay
The migration of DCs was assessed using a 48-well microchemotaxis chamber (Neuro Probe, Cabin John, MD) with a 5-µm polycarbonate filter (Osmonics, Livermore, CA) as described.28,29 Cells were incubated at 37° C with 5% CO2 for 1.5 hours. DCs migrating across the filter were counted using a Bioquant semiautomatic counting system (Bioquant Image Analysis, Nashville, TN). The results (as the mean ± SE of triplicate samples) are presented as chemotactic index (CI) defined as the fold increase in the number of migrating cells in the presence of test factors over the spontaneous cell migration (in the absence of test factors). MIP-3 Chemokine receptor-binding assays
Chemokine binding was performed with HEK293 cells transfected with CCR5 or CXCR4. The cells (1 x 106) in 100 µL RPMI 1640 (1% bovine serum albumin [BSA]) were incubated with 1 ng/mL radioiodinated chemokine (New England Biosciences, Boston, MA) in the presence of increasing concentrations of unlabeled fusion proteins or human MIP-1 MOPC315 Id-specific T-cell line stimulation
The BALB/c mouse CD4+ T-cell clone 7A10B2 specifically recognizes an idiotypic peptide from the light chain of the murine plasmacytoma MOPC315 immunoglobulin (amino acids 91-101), presented by the MHC class II molecule I-Ed,24 BALB/c bone marrow dendritic cells (BMDCs) were incubated with endotoxin-free fusion proteins overnight, washed extensively with cold PBS, irradiated (2000 rad), and placed in culture with 7A10B2 T cells in 96-well round-bottom plates at a 1:1 ratio (2 x 104 cells each) for 48 hours. Supernatants were assessed for interferon Human idiotype-specific T-cell line An idiotype-specific T-cell line was generated by repeated stimulation and rest cycles as described elsewhere30 from a patient with follicular lymphoma who had received Id-KLH vaccine.14 Briefly, after vaccination, PBMCs from patient LE were first stimulated in vitro with autologous Id protein (100 µg/mL). During subsequent restimulations, irradiated (3300 rad) autologous prevaccine PBMCs were used as APCs. The Id-specific T-cell line, LE-1, consisted of more than 99% CD3+CD4+ T cells and they recognized autologous Id in an HLA class II–associated manner.31 The T cells were generally used between 10 and 15 days following previous antigen stimulation. Cytokine induction assay for human idiotype-specific T-cell line
iDCs were irradiated to 2000 rads and plated in triplicate at 1 x 104 cells/100 µL/well in a 96-well U-bottom plate. DCs were cultured for 4 hours in the presence or absence of autologous idiotype protein (100 µg/mL), irrelevant idiotype protein (100 µg/mL), hMIP3sFvLF (10/100/1000 ng/mL), MIP3sFv38 (10/100/1000 ng/mL), sFvLF (100/1000 ng/mL), or LPS (10 ng/mL). The antigen was removed after 4 hours of incubation by washing the DCs twice with complete medium, and Id-specific LE-1 T cells (1 x 105/well) were added to the DCs in 200 µL complete medium. Supernatants were harvested and pooled from replicate wells after 72 hours of incubation. Cytokine production (IFN- Intracellular trafficking and processing of fusion proteins
BALB/c mouse splenocytes were incubated overnight with 100 ng/mL chemokine fusion proteins (MIP-3
In vivo uptake of chemokine fusion proteins
BALB/c mice (3/group) were subcutaneously immunized with 25 µg endotoxin-free MIP-3 In vivo immunization and tumor protection Animal care was provided in accordance with the procedures outlined in a Guide for the Care and Use of Laboratory Animals (National Institutes of Health publication no. 86-23, 1985). Six- to 9-week-old female C3H/HeNCrlBR mice (Charles River Laboratories, Frederick, MD) were immunized using the Helios Gene Gun System (Bio-Rad, Hercules, CA) with 1 to 2 µg plasmid DNA 3 times every 2 weeks as described.15 Two weeks after the last immunization, mice were challenged intraperitoneally with 2 x 103 38C13 cells and followed for survival. Differences in survival between groups were determined by nonparametric log-rank test (BMDP statistical software, Los Angeles, CA). P values refer to comparison with the group immunized with DNA expressing the same chemokine or defensin fused with an irrelevant sFv, or sFv fused with mutant chemokine, unless otherwise specified.
Chemoattractant fusion proteins retain their functional activity
First, we produced a number of chemoattractant fusion proteins with idiotypic (Id) fragments isolated from MOPC315 plasmacytoma cells (Figure 1) by purifying them from bacterial inclusion bodies using cobalt affinity columns under denaturing conditions, followed by a refolding process and heparin-Sepharose affinity chromatography.16 Purity was on average above 95%, and endotoxin content was reduced (
Chemoattractant fusion proteins can be taken up, processed, and presented to antigen-specific T cells
Previously, we reported that immunizations with chemokines fused with Id, a weakly immunogenic lymphoma antigen, elicited effector CD8+ T cell–dependent antitumor immunity15 and hypothesized that the mechanism was chemokine receptor-mediated uptake. To elucidate this, we tested whether antigen uptake by APCs would be augmented by chemokine fusion, and, if so, whether the internalized antigens would be efficiently processed and presented to T cells. To this end, the CD4+ T-cell clone 7A10B2, which specifically recognizes an Id peptide from the
This observation was further confirmed using human fusion proteins; specifically, chemokine fusion proteins facilitated the uptake and presentation of a human lymphoma sFv and stimulated Id-specific T cells from the same patient. For example, patient DCs, treated with human MIP-3
Chemoattractant fusion proteins are also taken up, processed, and presented to T cells in vivo
Next, we tested whether APCs could uptake and present Id when targeted with chemoattractant fusion proteins in vivo. The 7A10B2 T cells were mixed with irradiated draining lymph node cells from BALB/c mice removed 10 and 48 hours after subcutaneous injection with 25 µg fusion proteins. Significant IFN- Mechanism of T-cell processing of chemoattractant fusion proteins
To further elucidate the mechanism of chemokine receptor-mediated antigen processing, various inhibitors of intracellular trafficking and processing were tested. Brefeldin A is a fungal metabolite that disassembles the Golgi apparatus and inhibits vesicle transport of newly synthesized MHC class II molecules between endoplasmic reticulum (ER) and Golgi32; monensin is a sodium/potassium/proton ionophore that blocks Golgi transport and prevents acidification of intracellular compartments and internalization of CCR5 receptors.33 These reagents were assessed for their effects on chemokine fusion protein processing and presentation by APCs. Both inhibitors completely abrogated T-cell stimulation by splenocytes pulsed with MIP-3 Viral chemokine antagonist fusions as candidate vaccines for clinical development Protein or DNA immunizations with lymphoma-derived Id and its fragments alone, particularly from 38C13 lymphoma, fail to induce immunity in syngeneic mice.15 However, as we reported recently, this nonimmunogenic antigen can be rendered immunogenic by vaccinating with fusion constructs with various syngeneic chemokines.16 However, use of host chemokine carriers may elicit antihost chemokine autoimmunity, which may hamper their future clinical use. Therefore, to circumvent this potential problem we tested whether xenogeneic ligand, viral chemokine antagonists vMIP-2 and MC148, would elicit anti-Id responses. Syngeneic mice were immunized with plasmids encoding vMIP-2 or MC148 fused with sFv38 (pvMIP2sFv38 and MC148sFv38, respectively) and challenged with a lethal dose of 38C13 lymphoma. Control mice were immunized with DNA constructs encoding sFv fused with mutated chemokines (pvMIP2M-sFv38) or prototypic protein vaccine consisting of lymphoma-derived Id chemically cross-linked with KLH (Ig38-KLH), currently being tested in a phase 3 clinical trial.14 No survival was observed in control groups of mice immunized with PBS (Figure 5A,E) or plasmids encoding sFv38 fused with inactive mutant viral chemokine constructs pvMIP2M-sFv38 (Figure 5A) or pMC148M-sFv38 (not shown). In contrast, significant protective immunity was elicited in mice immunized with both fusion constructs pvMIP2sFv38 or pMC148sFv38 (logrank P < .0001 compared with pvMIP2M-sFv38; Figure 5A). The protection elicited with both constructs was comparable to that induced by Ig38-KLH (Figure 5A). DNA vaccinations with fusion constructs with viral chemokines generated mostly significant levels of anti-Id IgG1 antibodies (Figure 5B,C). In contrast, no antibodies were produced in mice immunized with mutant constructs pvMIP2M-sFv38 and pMC148M-sFv38 (not shown), which were unable to bind the respective chemokine receptors. Similarly, as we reported for other host chemokines,15 no antibody was generated in mice immunized with DNA expressing a mixture of plasmids containing unlinked sFv and vMIP-2 (not shown), suggesting the importance of physical linkage between chemoattractant and antigen.
Next, we tested whether preexisting antichemokine immunity would affect anti-Id responses elicited by pvMIP2sFv38. Ten mice per group were first immunized twice with vMIP-2 constructs fused with an irrelevant antigen, human breast cancer antigen Muc1 (pvMIP2-Muc1). Then mice were immunized 3 more times with pvMIP2sFv38. Mice preimmunized with pvMIP2-Muc1 generated significant levels of anti-vMIP2 IgG antibody (pvMIP2-Muc1/pvMIP2-Muc1 and pvMIP2-Muc1/pvMIP2sFv38; Figure 5D). Nevertheless, these same mice that generated anti-vMIP2 antibody also produced idiotype-specific antibody when they were immunized with the specific pvMIP2sFv38 construct ((pvMIP2Muc1)pvMIP2sFv38; Figure 5B,C). Both groups of mice, naive or anti-vMIP2 antibody producer, immunized with pvMIP2sFv38 generated comparable levels of anti-Id antibody (P > .9; Figure 5C). However, only naïve mice immunized with pvMIP2sFv38 were clearly protected from tumor challenge (log-rank P < .03 compared with PBS; Figure 5E). In contrast, pvMIP2sFv38 immunizations of mice with existing anti-vMIP2 antibody elicited lower tumor protection in 2 of 2 experiments with 10 mice/group (Figure 5E, although not statistically significant). Tumor protection was not due to nonspecific effects of chemokine carriers because mice immunized with vMIP-2 fused to the irrelevant antigen (pvMIP2-Muc1; Figure 5E) were not protected. Overall, these data suggest that viral chemokine antagonists vMIP-2 and MC148 can be used to render a nonimmunogenic tumor antigen immunogenic and elicit protective antitumor immunity, even for a very aggressive lymphoma, 38C13, which kills all control mice within 20 days after challenge. To further test the idea that the immune response was a chemokine receptor-mediated process, we tried to inhibit immunity by coinjection of the competing ligand. Mice were immunized with either pvMIP2sFv38 mixed with DNA encoding an irrelevant chemokine (pMCP3-Muc1), or antigen (pMucS), or with vMIP-2 fused with irrelevant antigen (pvMIP2-Muc1; Figure 5F). Sera of mice immunized with pvMIP2sFv38 together with an irrelevant chemokine or antigen-expressing plasmid contained an amount of idiotype-specific IgG antibodies ranging between 100 and 150 µg/mL (pMCP3-Muc1 + pvMIP2sFv38, and pMucS + pvMIP2sFv38, respectively; Figure 5F). However, mice receiving coinjections of plasmids encoding pvMIP2sFv38 and competing pvMIP2-Muc1 generated significantly lower levels (up to 40 µg/mL) of anti-Id antibody (pvMIP2-Muc1+ pvMIP2sFv38; Figure 5F). Similarly, coinjection of competing plasmids pvMIP2-Muc1 and pvMIP2sFv38 also reduced tumor protection. Whereas 30% of mice immunized with pvMIP2sFv38 together with either an irrelevant chemokine fusion construct pMC3sFv38 or an irrelevant antigen plasmid pMucS were tumor free after 100 days after challenge, all mice given coinjections with a mixture of pvMIP2sFv38 and pvMIP2-Muc1 died by day 25 (not shown). Therefore, these data further support the view that immunity to nonimmunogenic tumor antigens fused with viral chemokines also depends on their ability to engage chemokine receptors.
Herein, we expand our previous observation that chemokines are able to render a model self-tumor antigen, lymphoma idiotype,15 immunogenic by efficiently delivering antigen to APCs via chemokine receptors. These vaccines require chemokine receptor signaling because Id-specific antibody and protective antitumor immunity were elicited only in mice immunized with sFv physically linked with functionally active chemoattractant moieties. Moreover, immunizations with fusion constructs encoding mutant chemoattractants, which could not bind to respective chemokine receptors, failed to elicit any immune responses. Furthermore, similarly to other receptor-mediated phenomena,16 the immune responses elicited by viral chemokine-fused antigens can be efficiently abrogated by coinjection of a competing ligand. For example, both antibody (Figure 5F) and antitumor protection from pvMIP2sFv38 vaccine was abrogated by coinjection of vMIP-2–expressing constructs, but not an irrelevant chemokine MCP-3 or antigen. Thus, these data further support the idea that the viral chemokine-based vaccines also require chemokine receptor targeting to deliver and render fused antigens immunogenic and that immunity was not due to generation of an immunogenic neoantigen. The induction of local chemotaxis to the vaccine site alone is not sufficient to break nonresponsiveness to self-tumor antigens, probably due to inefficient antigen uptake by infiltrating cells.16
Our in vitro data support the hypothesis that chemokine-fused antigens are efficiently taken up and processed in early endocytic compartments of the APCs because T-cell stimulation by APCs treated with MIP-3
At present, we do not know whether chemokine-fused antigens can also use the MHC class I presentation pathway. However, we have previously reported data that mice immunized with HIV Env fused with MCP-3 or
It is noteworthy that chemoattractant-fused antigens do not require adjuvants and are able to stimulate immune responses in vivo16,34 and in vitro with relatively low doses. As we demonstrated, murine DCs and splenocytes treated with as little as 100 ng/mL fusion proteins with MIP-3 Overall, the use of chemokines as vaccine carriers is an efficient and simple strategy to elicit both humoral and cellular responses. Because of chemokine and chemokine receptor redundancy, human chemokine carriers may be effectively replaced by xenogeneic analogues, an important consideration in clinical trials to circumvent possible autoimmunity against host chemokines. Although, vMIP2-based vaccines elicited protective antitumor immunity against syngeneic B-cell lymphoma, not every viral chemokine is a carrier, because we could not get any immune responses in mice immunized with constructs expressing HHV-6–derived chemokine agonist U83 despite its chemotactic properties for the monocytic cell line, THP-143 (pU83SPsFv38, not shown). It is not clear whether its ineffectiveness is due to the receptor's inability to be internalized or poor stability of the fusion protein. The fate of the internalized receptor is thought to be controlled by the nature of the ligand and the strength of signaling, because it was observed during cross-desensitization of CXCR1 and CCR1, CXCR4 and CCR5, and inhibition of HIV-1 entry,44 and preferential inhibition of CCR5 recycling by AOP-RANTES.10 Selection of separate chemokines also enables controlled induction of humoral or cellular immune responses.16 For example, some T helper (Th) type 2–specific chemokines, such as MDCs, failed to elicit CD8+ CTLs, but generated superior levels of antibody.34 The broad-range viral antagonist vMIP-2 also has been classified as a Th2-specific chemoattractant, and its potency to elicit Th1-cellular responses has yet to be studied.
We are grateful to Orville C. Bowersox and Wanhua Gong for technical assistance; Elena Klyushnenkova for help with isolation of murine BM-derived DCs; Dr Akira Takashima for the gift of XS52 cells, Dr Bjarne Bogen for the gift of 7A10B2 cells, and Dr Joshua Farber for the gift of mCCR6/HEK293; Dr Dan Longo for helpful comments and suggestions.
Submitted February 23, 2004; accepted May 16, 2004.
Prepublished online as Blood First Edition Paper, June 10, 2004; DOI 10.1182/blood-2004-02-0637.
Supported in whole or in part with Federal funds from the National Cancer Institute, National Institutes of Health, under contract no. N01-CO-12400. The content of this publication does not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the US government.
An Inside Blood analysis of this article appears in the front of this issue.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Arya Biragyn, Laboratory of Immunology, Gerontology Research Center, National Institute on Aging, National Institutes of Health, 5600 Nathan Shock Dr, Box 21, Baltimore, MD; 21224; e-mail: biragyna{at}grc.nia.nih.gov.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Top
Abstract
Introduction
, or human MIP-3
emission. The rate of inhibition of binding was calculated by the formula: % inhibition = 1 – (cpm in the presence of unlabeled ligands/cpm in the presence of radiolabeled ligand alone) x 100%. 
0.1 EU/µg protein) using Acticlean etox resins (Sterogene Bioseparations). Chemoattractant fusion proteins retained functional activity after being fused with various immunoglobulin fragments, namely, single-chain antibody fragments (sFv) or VL from MOPC315 Ig
chain, such as MIP-3
subunit of proteosome,