Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 1 June 2005, Vol. 105, No. 11, pp. 4523-4526.
Prepublished online as a Blood First Edition Paper on February 10, 2005; DOI 10.1182/blood-2004-07-2762.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-07-2762v1
105/11/4523    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chan, E. M.
Right arrow Articles by Hromas, R. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chan, E. M.
Right arrow Articles by Hromas, R. A.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Neoplasia
Right arrow Oncogenes and Tumor Suppressors
Right arrow Brief Reports
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

NEOPLASIA
Brief report

AML1-FOG2 fusion protein in myelodysplasia

Edward M. Chan, Elisha M. Comer, Frank C. Brown, Kathleen E. Richkind, Melissa L. Holmes, Beng H. Chong, Roger Shiffman, Dong-Er Zhang, Marilyn L. Slovak, Cheryl L. Willman, Constance T. Noguchi, Yanjun Li, Devan J. Heiber, Lori Kwan, Rebecca J. Chan, Gail H. Vance, Heather C. Ramsey, and Robert A. Hromas

From the Departments of Medicine, Pediatrics, and Medical & Molecular Genetics, Indiana University School of Medicine, and the Indiana University Cancer Center, Indianapolis, IN; Genzyme Genetics, Santa Fe, NM; Department of Medicine, University of New South Wales, Sydney, Australia; Monterey Bay Oncology Center, Monterey, CA; Scripps Research Institute, La Jolla, CA; City of Hope National Medical Center, Duarte, CA; National Institute of Diabetes, Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD; Departments of Medicine and Pathology, and the Cancer Research & Treatment Center, University of New Mexico, Albuquerque, NM.


    Abstract
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 References
 
Core binding factor (CBF) participates in specification of the hematopoietic stem cell and functions as a critical regulator of hematopoiesis. Translocation or point mutation of acute myeloid leukemia 1 (AML1)/RUNX1, which encodes the DNA-binding subunit of CBF, plays a central role in the pathogenesis of acute myeloid leukemia and myelodysplasia. We characterized the t(X;21)(p22.3;q22.1) in a patient with myelodysplasia that fuses AML1 in-frame to the novel partner gene FOG2/ZFPM2. The reciprocal gene fusions AML1-FOG2 and FOG2-AML1 are both expressed. AML1-FOG2, which fuses the DNA-binding domain of AML1 to most of FOG2, represses the transcriptional activity of both CBF and GATA1. AML1-FOG2 retains a motif that recruits the corepressor C-terminal binding protein (CtBP) and these proteins associate in a protein complex. These results suggest a central role for CtBP in AML1-FOG2 transcriptional repression and implicate coordinated disruption of the AML1 and GATAdevelopmental programs in the pathogenesis of myelodysplasia.


    Introduction
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 References
 
Myelodysplasia arises from genetic alterations in the hematopoietic stem cell (HSC) that impair differentiation and lead to acute myeloid leukemia (AML).1 Differentiation of the HSC reflects restrictions in cell fate determined by transcription factors that function as master regulators of hematopoiesis.2 Thus, many genetic lesions in myelodysplasia affect transcription factors. Core binding factor (CBF) is a heterodimeric transcription factor, composed of a DNA-binding subunit AML1 (CBF{alpha}2/PEBP2{alpha}B/RUNX1)3 and its partner CBF{beta},4 which participates in specification of the HSC.5-7 Genetic alterations involving the AML1 gene include translocations and point mutations, which represent critical events in the development of both myelodysplasia and AML.8 We hypothesized that chromosomal aberrations involving AML1 might identify other developmental programs that cooperate in the pathogenesis of myelodysplasia.


    Study design
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 References
 
Fluorescence in-situ hybridization

Fluorescence in-situ hybridization (FISH) was performed as described9,10 with paints for chromosomes X (Vysis, Downer's Grove, IL) and 21 (Cambio, Cambridge, England). Involvement of AML1 was verified by FISH with the TEL/AML1 probe (Vysis). Translocation of the 3' end of FOG2 to the X chromosome was confirmed by FISH with the X chromosome centromere probe (Vysis) and bacterial artificial chromosome (BAC) RP11-152P17 (Children's Hospital Oakland Research Institute, Oakland, CA). Approval was obtained from the Indiana University institutional review board for these studies, and informed consent was provided according to the Declaration of Helsinki.

Rapid amplification of cDNA ends

Bone marrow RNA was used to prepare cDNA using primer QT (5'-ccagtgagcagagtgacgaggactcgagctcaagct18) with the Superscript First-strand Synthesis System (Invitrogen, Carlsbad, CA). We performed 3'–rapid amplification of cDNA ends (RACE) using nested polymerase chain reaction (PCR) primers and the Advantage 2 PCR Kit (Clontech, Palo Alto, CA). The first amplification included primers F4 (5'-ccacctaccacagagccatcaaaa) and Q1 (5'-ccagtgagcagagtgacgagg) with cycling: 95°C for 1 minute (1 time); 95°C for 30 seconds, 56°C for 30 seconds, 68°C for 3 minutes (35 times); 68°C for 3 minutes (1 time). The second amplification included primers G4 (5'-atcaaaatcacagtggatggg) and Q2 (5'-gacgaggactcgagctcaagc) with identical cycling. The amplified products were cloned, sequenced, and identified by BLAST searches.

Reverse transcriptase–polymerase chain reaction

Reverse transcriptase–PCR (RT-PCR) was performed with bone marrow RNA using paired PCR primers including AML1-3 (5'-gaaccaggttgcaag), AML1-6 (5'-ggggagtaggtgaaggcg), FOG2-15 (5'-gagacagacgactgggatggacc), and FOG2-12 (5'-cctctgacaccggagc). Cycling was as follows: 95°C for 1 minute (1 time); 95°C for 30 seconds, 45°C for 30 seconds, 68°C for 1 minute (35 times); 68°C for 1 minute (1 time).

Construction of AML1-FOG2 fusion

The AML1-FOG2 fusion was generated by overlap PCR using the following primers: AML1B-S (5'-gaggatccgcgatggcttcagacagcatatt), AML1-AS-OVLP (5'-tagttgtacaccaaagctgacccccctgcatctgactctgaggctgagg), FOG2-S-OVLP (5'-cctcagcctcagagtcagatgcaggggggtcagctttggtgtacaacta), and FOG2-AS-NT (5'-gaggatcctttgacatgttctgctgcatgtgatga) primers. The overlap product was ligated into the BamHI site of pCDNA3.1/V5-HisB (Invitrogen) and sequenced.

Reporter assay

One million 293 cells were transfected with calcium phosphate as described11,12 using combinations of plasmids AML1B, CBF{beta}, GATA1, AML1-FOG2, pcDNA3.1/V5-HisB, rous sarcoma virus (RSV)-LacZ, macrophage colony-stimulating factor receptor promoter luciferase (MCSFR-Luc) reporter, and erythropoietin receptor promoter luciferase (EPOR-Luc) reporter. Relative luciferase activity represents the quotient of luciferase and {beta}-galactosidase activities.

Immunoprecipitation

After transfection of 7 million 293 cells with either AML1-FOG2 or pcDNA3.1/V5-HisB, immunoprecipitation was performed with anti–V5 antibody (Invitrogen). Immunoblotting was performed with rabbit anti-CtBP (Santa Cruz Biotechnology, Santa Cruz, CA; sc-11 390) or goat anti-AML1 (Santa Cruz; sc-8563). Conversely, immunoprecipitation was performed with anti-CtBP followed by blotting with anti-V5.


    Results and discussion
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 References
 
A 78-year-old male developed pancytopenia. Bone marrow evaluation revealed 5% blasts with erythroid and megakaryocytic dysplasia. He was diagnosed with myelodysplasia (French-American-British subtype refractory anemia with excess blasts), which did not respond to erythropoietin therapy. At the time of his death, he had progressive anemia and thrombocytopenia but no evidence of leukemia in his peripheral blood. Karyotype was 46, Y, t(X; 21)(p22.3;q22) which was confirmed using FISH with paints for the X chromosome and chromosome 21 (Figure 1A). Since AML1 resides at 21q22, we hypothesized that the t(X;21) involved translocation of AML1 to the X chromosome. FISH detected AML1 sequences not only as expected on both copies of chromosome 21 but also aberrantly on the X chromosome (Figure 1B).

Since there were no known AML1 translocations to the X chromosome, we initially hypothesized that the t(X;21) fused AML1 to a novel partner gene on the X chromosome. Surprisingly, 3'-RACE identified this gene as Friend of GATA-2 (FOG2/ZFPM2), which encodes a corepressor for the GATA transcription factors and normally resides on chromosome 8. Therefore, we performed FISH with a BAC probe against the 3' end of FOG2 and independently confirmed translocation of the 3' end of FOG2 to the X chromosome (data not shown). Thus, the t(X;21) represents a complex translocation involving not only Xp22 and 21q22 (AML1) but also 8q23 (FOG2).

Signficantly, there are at least 20 reported cases of either myelodysplasia or acute myeloid leukemia with chromosomal aberrations involving 8q23 (http://cgap.nci.nih.gov/Chromosomes/Mitelman). These cases include a disproportionate number of erythroleukemias and megakaryoblastic leukemias as might be predicted from the important role of GATA developmental programs in erythroid and megakaryocytic differentiation. A search of the Southwest Oncology Group database identified 2 additional cases of acute myeloid leukemia involving 8q23. Collectively, these results raise the intriguing possibility that genetic events targeting FOG2 may occur more frequently in myeloid malignancies than previously recognized.



View larger version (62K):
[in this window]
[in a new window]
 
Figure 1.. The t(X;21) fuses AML1 to FOG2. (A) FISH with paints for chromosomes X (green) and 21 (red) confirms t(X;21). (B) FISH with the AML1 probe (red) hybridizes not only to both copies of chromosome 21 but also aberrantly to a third chromosome (indicated by arrow). (C) AML1-FOG2 fuses AML1 nt 805 to FOG2 nt 557 and encodes a chimeric protein composed of AML1 aa 1-268 fused to FOG2 aa 178-1151. (D) Structures for the chimeric fusion proteins are shown relative to those for AML1 and FOG2. AML1-FOG2 retains the DNA-binding domain (DBD; blue boxes) of AML1 plus the 8 zinc finger domains ({cjs2108}) and CtBP interaction domain (CID; red boxes) of FOG2, whereas FOG2-AML1 retains the activation domain (AD; green boxes) of AML1. The fusion breakpoints are indicated by arrows. (E) Model for transcriptional repression of CBF target genes in which AML1-FOG2 binds the promoter via the DBD from AML1 but aberrantly recruits the CtBP corepressor complex (GTF, general transcription factors). (F) Model for transcriptional repression of GATA1 target genes in which AML1-FOG2 binds the promoter via interaction with GATA1 but aberrantly recruits the CtBP corepressor complex.

 
The AML1-FOG2 breakpoint fuses nucleotide 805 from exon 6 of AML1 [U19 601] to nucleotide 557 from exon 6 of FOG2 [AF119 334] (Figure 1C). The protein consists of 1242 amino acids and fuses aa 1-268 of AML1 to aa 178-1151 of FOG2 (Figure 1D). Thus, AML1-FOG2 retains the DNA-binding domain of AML1 and most of FOG2 including its 8 zinc fingers and the interaction domain13,14 that recruits the corepressor C-terminal binding protein (CtBP). Whereas FOG2 normally plays an important role in sex determination15 and cardiac development,16,17 the t(X;21) represents the first demonstration of a role for the FOG family in neoplasia.

RT-PCR detected expression of not only AML1 but also the reciprocal gene fusions AML1-FOG2 and FOG2-AML1 (Figure 2A). Expression of FOG2 was not detectable despite structural evidence from FISH that the untranslocated allele was not deleted. The absence of FOG2 expression may reflect its normal tissue-specific expression pattern, alteration in its expression pattern induced by the fusions, or loss of heterozygosity for FOG2 as a result of the translocation.

The structural features of AML1-FOG2 indicate that the fusion protein may disrupt both the CBF and GATA developmental programs (Figure 1D). Because AML1-FOG2 retains the DNA-binding domain (DBD) from AML1 and the CtBP interaction domain (CID) from FOG2, we hypothesized that it binds the promoters of CBF target genes, such as macrophage colony-stimulating factor receptor (MCSFR), and blocks their expression through aberrant recruitment of CtBP (Figure 1E). Cotransfection of CBF with increasing amounts of AML1-FOG2 in the presence of the MCSFR-Luc reporter demonstrated that AML1-FOG2 represses CBF-mediated transcriptional activity (Figure 2B). Since AML1-FOG2 retains the zinc fingers that interact with the GATA transcription factors and the CtBP interaction domain from FOG2, we hypothesized that it also binds GATA proteins at the promoters of their target genes, such as erthyropoietin receptor (EPOR), and blocks their expression through aberrant recruitment of CtBP (Figure 1F). Predictably, cotransfection of GATA1 with increasing amounts of AML1-FOG2 in the presence of the EPOR-Luc reporter demonstrated that AML1-FOG2 also repressed GATA1-mediated transcriptional activity (Figure 2C). Importantly, future studies will need to investigate if AML1-FOG2 interacts directly with GATA1 and whether expression of AML1-FOG2 produces a hematopoietic phenotype. Finally, it is notable that the reciprocal fusion FOG2-AML1, which retains the activation domain but not the DBD of AML1 (Figure 1D), may also reduce the transcriptional activity of wild-type AML1 by sequestering specific coactivators such as camp response element binding protein (CREB).



View larger version (36K):
[in this window]
[in a new window]
 
Figure 2.. AML1-FOG2 functions as a transcriptional repressor and recruits CtBP. (A) The reciprocal transcripts AML1-FOG2 (AF) and FOG2-AML1 (FA) can be detected in the bone marrow by RT-PCR. The AML1 transcript is also detected, whereas the FOG2 transcript is not detected. Control PCR reactions were performed in parallel using identical primer pairs and 50 ng plasmid DNA as template. (B) AML1-FOG2 represses the transcriptional activity of CBF. For each transfection, the graph depicts the mean and standard deviation for 6 independent replicates. The amount of each plasmid transfected is indicated in micrograms. CBFb refers to CBF{beta}. (C) AML1-FOG2 represses the transcriptional activity of GATA1. For each transfection, the graph depicts the mean and standard deviation for 3 independent replicates. The amount of each plasmid transfected is indicated in micrograms. (D) AML1-FOG2 and CtBP associate in a protein complex. 293 cells were transfected with either pCDNA3.1/V5-HisB (CTRL) or V5-epitope tagged AML1-FOG2 (AF). Molecular weights of markers are indicated in kilodaltons. (i) Immunoprecipitation of AML1-FOG2 with anti–V5 antibody specifically recovers CtBP. (ii) Immunoprecipitation of CtBP with anti–CtBP antibody specifically recovers AML1-FOG2. (iii) Control immunoprecipitation with anti-V5 shows that AML1-FOG2 is expressed after transfection and can be detected with anti–AML1 antibody. (iv) Control blot with anti–CtBP antibody shows equal amounts of endogenous CtBP in the protein lysates used for immunoprecipitation experiments.

 
Since AML1-FOG2 contains the peptide motif that recruits the corepressor CtBP, we hypothesized that AML1-FOG2 and CtBP interact in a protein complex. Immunoprecipitation experiments in 293 cells transfected with either vector alone or AML1-FOG2 demonstrated that AML1-FOG2 and CtBP specifically associate in vivo (Figure 2D). Control experiments confirmed expression of AML1-FOG2 after transfection as well as equivalent amounts of endogenous CtBP in the protein lysates used for immunoprecipitation (Figure 2D). The CtBP repressor complex includes histone deacetylases and methyltransferases as well as Polycomb proteins.18 Thus, AML1-FOG2 may repress CBF hematopoietic developmental pathways by aberrantly recruiting the CtBP complex to CBF target genes. Such a mechanism is functionally reminiscent of that described for AML1-MDS1-EVI1 in myelodysplasia19 and may represent a central event in the pathogenesis of myelodysplasia.

Since AML1-FOG2 retains the zinc fingers of FOG2 that interact with GATA proteins,14 it may also disrupt GATA-dependent hematopoietic programs in vivo. Interestingly, ectopic expression of FOG2 in Xenopus embryos produces severe anemia if the CtBP interaction motif is retained20 and raises the possibility that AML1-FOG2 represents ectopic expression of FOG2 in human hematopoietic cells. Moreover, the clinical phenotype associated with AML1-FOG2 demonstrates remarkable similarity to X-linked dyserythropoietic anemia and thrombocytopenia, which is due to a mutation in GATA1.21 Thus, it will be important to determine if AML1-FOG2 interacts with GATA proteins in hematopoietic cells, whether CtBP plays a more central role in the pathogenesis of myelodysplasia, and if genetic alterations in the CBF and GATA developmental pathways cooperate to induce hematologic malignancies.


    Footnotes
 
Submitted July 19, 2004; accepted January 21, 2005.

Prepublished online as Blood First Edition Paper, February 10, 2005; DOI 10.1182/blood-2004-07-2762.

Supported by American Cancer Society grant IRG-84-002-17 (E.M.C.) and by a grant from the Clarian Values Fund for Research (E.M.C.).

Presented in part at the 44th and 46th Annual Meetings of the American Society of Hematology, December 2002 and December 2004.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Edward M. Chan, Division of Hematology-Oncology, Department of Medicine, Indiana University School of Medicine, 1044 W Walnut St, R4-202, Indianapolis, IN 46202-5254; e-mail: echan{at}iupui.edu.


    References
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 References
 

  1. Heaney ML, Golde DW. Myelodysplasia. N Engl J Med. 1999;340: 1649-1660.[Free Full Text]

  2. Shivdasani RA, Orkin SH. The transcriptional control of hematopoiesis. Blood. 1996;87: 4025-4039.[Free Full Text]

  3. Miyoshi H, Shimizu K, Kozu T, Maseki N, Kaneko Y, Ohki M. t(8;21) breakpoints on chromosome 21 in acute myeloid leukemia are clustered within a limited region of a single gene, AML1. Proc Natl Acad Sci U S A. 1991;88: 10431-10434.[Abstract/Free Full Text]

  4. Ogawa E, Inuzuka M, Maruyama M, et al. Molecular cloning and characterization of PEBP2 beta, the heterodimeric partner of a novel Drosophila runt-related DNA binding protein PEBP2 alpha. Virology. 1993;194: 314-331.[CrossRef][Medline] [Order article via Infotrieve]

  5. North T, Gu TL, Stacy T, et al. Cbfa2 is required for the formation of intra-aortic hematopoietic clusters. Development. 1999;126: 2563-2575.[Abstract]

  6. Mukouyama Y, Chiba N, Hara T, et al. The AML1 transcription factor functions to develop and maintain hematogenic precursor cells in the embryonic aorta-gonad-mesonephros region. Dev Biol. 2000;220: 27-36.[CrossRef][Medline] [Order article via Infotrieve]

  7. Yokomizo T, Ogawa M, Osato M, et al. Requirement of Runx1/AML1/PEBP2alphaB for the generation of haematopoietic cells from endothelial cells. Genes Cells. 2001;6: 13-23.[Abstract]

  8. Speck NA, Gilliland DG. Core-binding factors in haematopoiesis and leukaemia. Nat Rev Cancer. 2002;2: 502-513.[CrossRef][Medline] [Order article via Infotrieve]

  9. Hromas R, Shopnick R, Jumean HG, Bowers C, Varella-Garcia M, Richkind K. A novel syndrome of radiation-associated acute myeloid leukemia involving AML1 gene translocations. Blood. 2000;95: 4011-4013.[Abstract/Free Full Text]

  10. Paskulin GA, Philips G, Morgan R, et al. Pre-clinical evaluation of probes to detect t(8;21) AML minimal residual disease by fluorescence in situ hybridization. Genes Chromosomes Cancer. 1998;21: 144-151.[CrossRef][Medline] [Order article via Infotrieve]

  11. Hromas R, Busse T, Carroll A, et al. Fusion AML1 transcript in a radiation-associated leukemia results in a truncated inhibitory AML1 protein. Blood. 2001;97: 2168-2170.[Abstract/Free Full Text]

  12. Zhang DE, Hetherington CJ, Meyers S, et al. CCAAT enhancer-binding protein (C/EBP) and AML1 (CBF alpha2) synergistically activate the macrophage colony-stimulating factor receptor promoter. Mol Cell Biol. 1996;16: 1231-1240.[Abstract]

  13. Turner J, Crossley M. Cloning and characterization of mCtBP2, a co-repressor that associates with basic Kruppel-like factor and other mammalian transcriptional regulators. EMBO J. 1998;17: 5129-5140.[CrossRef][Medline] [Order article via Infotrieve]

  14. Holmes M, Turner J, Fox A, Chisholm O, Crossley M, Chong B. hFOG-2, a novel zinc finger protein, binds the co-repressor mCtBP2 and modulates GATA-mediated activation. J Biol Chem. 1999;274: 23491-23498.[Abstract/Free Full Text]

  15. Tevosian SG, Albrecht KH, Crispino JD, Fujiwara Y, Eicher EM, Orkin SH. Gonadal differentiation, sex determination and normal Sry expression in mice require direct interaction between transcription partners GATA4 and FOG2. Development. 2002;129: 4627-4634.[Abstract/Free Full Text]

  16. Crispino JD, Lodish MB, Thurberg BL, et al. Proper coronary vascular development and heart morphogenesis depend on interaction of GATA-4 with FOG cofactors. Genes Dev. 2001;15: 839-844.[Abstract/Free Full Text]

  17. Pizzuti A, Sarkozy A, Newton AL, et al. Mutations of ZFPM2/FOG2 gene in sporadic cases of tetralogy of Fallot. Hum Mutat. 2003;22: 372-377.[CrossRef][Medline] [Order article via Infotrieve]

  18. Shi Y, Sawada J, Sui G, et al. Coordinated histone modifications mediated by a CtBP co-repressor complex. Nature. 2003;422: 735-738.[CrossRef][Medline] [Order article via Infotrieve]

  19. Senyuk V, Chakraborty S, Mikhail FM, Zhao R, Chi Y, Nucifora G. The leukemia-associated transcription repressor AML1/MDS1/EVI1 requires CtBP to induce abnormal growth and differentiation of murine hematopoietic cells. Oncogene. 2002;21: 3232-3240.[CrossRef][Medline] [Order article via Infotrieve]

  20. Deconinck AE, Mead PE, Tevosian SG, et al. FOG acts as a repressor of red blood cell development in Xenopus. Development. 2000;127: 2031-2040.[Abstract]

  21. Nichols KE, Crispino JD, Poncz M, et al. Familial dyserythropoietic anaemia and thrombocytopenia due to an inherited mutation in GATA1. Nat Genet. 2000;24: 266-270.[CrossRef][Medline] [Order article via Infotrieve]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
L. F. Peterson, M. Yan, and D.-E. Zhang
The p21Waf1 pathway is involved in blocking leukemogenesis by the t(8;21) fusion protein AML1-ETO
Blood, May 15, 2007; 109(10): 4392 - 4398.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. Asou, M. Yanagida, L. Huang, M. Yamamoto, K. Shigesada, H. Mitsuya, Y. Ito, and M. Osato
Concurrent transcriptional deregulation of AML1/RUNX1 and GATA factors by the AML1-TRPS1 chimeric gene in t(8;21)(q24;q22) acute myeloid leukemia
Blood, May 1, 2007; 109(9): 4023 - 4027.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-07-2762v1
105/11/4523    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chan, E. M.
Right arrow Articles by Hromas, R. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chan, E. M.
Right arrow Articles by Hromas, R. A.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Neoplasia
Right arrow Oncogenes and Tumor Suppressors
Right arrow Brief Reports
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2005 by American Society of Hematology         Online ISSN: 1528-0020