Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 15 February 2005, Vol. 105, No. 4, pp. 1734-1741.
Prepublished online as a Blood First Edition Paper on October 19, 2004; DOI 10.1182/blood-2004-05-2042.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-05-2042v1
105/4/1734    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yu, J. L.
Right arrow Articles by Rak, J. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yu, J. L.
Right arrow Articles by Rak, J. W.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Neoplasia
Right arrowRelated Article in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

NEOPLASIA

Oncogenic events regulate tissue factor expression in colorectal cancer cells: implications for tumor progression and angiogenesis

Joanne L. Yu, Linda May, Vladimir Lhotak, Siranoush Shahrzad, Senji Shirasawa, Jeffrey I. Weitz, Brenda L. Coomber, Nigel Mackman, and Janusz W. Rak

From the Henderson Research Centre, Experimental Thrombosis Research, McMaster University, Hamilton, ON, Canada; Department of Biomedical Sciences, University of Guelph, Guelph, ON, Canada; Department of Pathology, International Medical Center of Japan, Tokyo, Japan; and Departments of Immunology and Vascular Biology, The Scripps Research Institute, La Jolla, CA.


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Tissue factor (TF) is the primary cellular initiator of blood coagulation and a modulator of angiogenesis and metastasis in cancer. Indeed, systemic hypercoagulability in patients with cancer and TF overexpression by cancer cells are both closely associated with tumor progression, but their causes have been elusive. We now report that in human colorectal cancer cells, TF expression is under control of 2 major transforming events driving disease progression (activation of K-ras oncogene and inactivation of the p53 tumor suppressor), in a manner dependent on MEK/mitogen-activated protein kinase (MAPK) and phosphatidylinositol 3'-kinase (PI3K). Furthermore, the levels of cell-associated as well as circulating (microvesicle-associated) TF activity are linked to the genetic status of cancer cells. Finally, RNA interference experiments suggest that TF expression is an important effector of the K-ras-dependent tumorigenic and angiogenic phenotype in vivo. Thus, this study establishes a causal link between cancer coagulopathy, angiogenesis, and genetic tumor progression. (Blood. 2005;105:1734-1741)


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Cancer is believed to arise and progress toward increasing malignancy as a result of cumulative genetic "hits" sustained by the tumor cell genome. Paradigmatic in this regard is the development of colorectal carcinoma (CRC), where sequential transition through clinical stages of the disease is paralleled by a series of well-characterized alterations in proto-oncogenes and tumor suppressor genes.1 In this tumor type, activation of mutant K-ras and subsequent inactivation/loss of p53 are key changes, which drive many interrelated aspects of the malignant phenotype including aberrant mitogenesis and survival.2 Moreover, both of these genetic alterations are thought to contribute to proangiogenic properties of affected cancer cells,3,4 and thereby enable them to exploit the host vascular system to advance malignant growth and metastasize in vivo.5

The involvement of the vascular system in malignancy encompasses not only angiogenesis but also systemic hypercoagulability. Blood clotting abnormalities are detected in up to 90% of patients with metastatic disease, and thrombosis represents the second most frequent cause of cancer-related mortality.6 Cancer coagulopathy is often linked to up-regulation of tissue factor (TF), the primary cellular initiator of the blood coagulation cascade.7,8 Interaction of coagulation factor VIIa with TF on the cell surface leads to activation of factor X and generation of thrombin, with subsequent involvement of platelets and formation of a fibrin clot.9 Remarkably, as a member of the class II cytokine receptor family, TF is also capable of transducing intracellular signals and regulating gene expression.10,11 Interestingly, elements of the coagulation/fibrinolytic system in general,12 and TF in particular, have been implicated in regulation of angiogenesis,13,14 as well as tumor growth15 and metastasis16 in various experimental settings. This is consistent with the observed up-regulation of TF in human malignancies and its elevation with advancing disease.17,18 For instance, in human CRC, TF positivity correlates with clinical stage, histologic grade, poor prognosis, and vascularity.19-21 Collectively, these observations suggest that TF is not only an important element of cancer-related coagulopathy but is also a correlate and indeed a likely determinant of malignant behavior of tumor cells.

In this context 2 main questions remain unanswered. First, what causes the up-regulation of TF in human cancer cells, with the subsequent increase in their malignancy? Second, how are the consequences of TF expression related to the phenotypic changes induced by underlying "cancer-causing" genetic alterations? Here we report that in CRC, TF expression by cancer cells is directly linked to their genetic status; for example, activation of the K-ras oncogene and loss of p53 are involved in TF regulation. These transforming alterations influence the level and activity of TF not only on the cell membrane but also on the surface of microvesicles shed by cancer cells into the circulation. We therefore suggest that both local and systemic hypercoagulability in cancer may have a hitherto unappreciated genetic cause or component. Finally, we demonstrate that TF is required for full expression of the K-ras-dependent tumorigenic and angiogenic phenotype of CRC cells in vivo, but not for cellular transformation in vitro.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Cell lines and reagents

The human CRC cell lines HCT116 and DLD-1, and their K-ras-deleted sublines (HKh-2, DKs-8, DKO-1, DKO-3) have been previously characterized.22 The p53-/- subline of HCT116 (379.2)23 was kindly provided by Dr Bert Vogelstein (Johns Hopkins University, Baltimore, MD). The 528ras+mTF cell line was produced by transfecting transformed murine 528ras fibroblasts24 with a full-length mouse TF expression vector to produce cells expressing high levels of mouse tissue factor (mTF) (J.L.Y. and J.W.R., unpublished data, 2004). The A549 human non-small cell lung carcinoma cell line was purchased from American Type Culture Collection (Manassas, VA). All cell lines were maintained in Dulbecco modified Eagle medium (DMEM; HyClone, Logan, Utah) with 10% fetal bovine serum (FBS; Gibco BRL/Invitrogen, Carlsbad, CA). For determination of cell growth in monolayer culture, cells were seeded into 24-well plates in complete medium. At each time point, cells (3 wells/cell line) were detached by trypsinization and cell number determined using a hemocytometer. The dominant-negative H-Ras-N17 mutant expression construct25,26 was a generous gift from Dr Abhijit Guha (University of Toronto, Toronto, ON, Canada). PD98059, LY294002, and AG1296 were purchased from Biomol Research Laboratories (Plymouth Meeting, PA). CI-1033 was made available by Pfizer, courtesy of Dr Christian Marsolais. All inhibitor stock solutions were prepared in dimethyl sulfoxide (DMSO).

Flow cytometric detection of cell-surface TF and cell sorting

For detection of surface TF antigen, cells were detached with 2 mM EDTA (ethylenediaminetetraacetic acid) to obtain a single-cell suspension. Cells (1.5 x 106) were washed in phosphate-buffered saline (PBS) with 1% FBS and 0.1% sodium azide and stained for 30 minutes at 4°C with a monoclonal antibody against human TF (American Diagnostica, Greenwich, CT). After washing, samples were incubated with Alexa Fluor 488 goat anti-mouse secondary antibody (Molecular Probes, Eugene, OR) for 30 minutes at 4°C, washed, and fixed in 1% paraformaldehyde before being acquired on a FACScalibur (BD Biosciences, Mountain View, CA). For cell sorting experiments, 2 x 107 HKh-2 cells were stained for TF as described, and a sterile sort performed on a FACStar Plus (BD Biosciences). Gates were set to collect the most TF+ and TF- viable cells; 3.5 x 105 cells from each side of the expression spectrum. The cells were collected and cultured in complete media containing penicillin-streptomycin (Gibco BRL/Invitrogen).

Analysis of RNA and protein expression

TriZol (Gibco BRL/Invitrogen) was used to isolate total RNA from cells or homogenized tumor tissue. Northern blotting was performed as described previously,24 using vascular endothelial growth factor (VEGF), TF, thrombospondin 1 (TSP-1), or TSP-2 cDNA fragments as probes. For Western blotting, cells were lysed with nonidet-P40 (NP-40) lysis buffer (1% NP-40, 10% glycerol, 20 mM Tris (tris(hydroxymethyl)aminomethane)-HCl, pH 7.5, 137 mM NaCl, 100 mM NaF, 1 mM sodium vanadate, 1 mM phenylmethylsulfonyl fluoride [PMSF]), supplemented with complete protease inhibitor cocktail (Roche, Indianapolis, IN). Protein was quantified by Bradford assay (Bio-Rad, Hercules, CA), resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and transferred to Immobilon-P membrane (Millipore, Billerica, MA). Membranes were probed with rabbit anti-human TF IgG (American Diagnostica) followed by goat antirabbit secondary antibody (Jackson ImmunoResearch Labs, West Grove, PA). To confirm equal loading, membranes were probed with anti-ERK1/2 antibody (Upstate Biotechnology, Lake Placid, NY). The IMUBIND TF enzyme-linked immunosorbent assay (ELISA) kit (American Diagnostica) was used to quantify TF protein levels in plasma or conditioned medium.

TF activity assay

TF activity was measured as described previously.27 Standard curves were prepared using different dilutions of rabbit brain thromboplastin (Thromboplastin C Plus; Dade Behring, Marburg, Germany), and 1 U TF activity was defined as the activity of the 1:104 dilution of thromboplastin standard. Cell number was used to normalize the TF activity. Detection of TF activity in conditioned media was performed similarly, by adding the Tris-buffered saline (TBS) reaction mixture to 100 µL media (or supernatant, or resuspended microvesicles after centrifugation).

Animals and tumor analysis

All in vivo experiments were performed in 6- to 8-week-old severe combined immunodeficiency (SCID) mice (5-10/group; Charles River, Saint-Coustant, QC, Canada). Briefly, 1 to 5 x 106 CRC cells were injected subcutaneously in 0.2 mL PBS. Blood was collected from mice by cardiac puncture, into one-tenth volume 3.8% sodium citrate. Platelet-free plasma was prepared by centrifugation at 2000g for 15 minutes, 2000g for 5 minutes, and 16 000g for 5 minutes and stored at -80°C until use. Tumor growth was monitored by measurements with Vernier calipers, and tumor volume (mm3) estimated using the standard formula (length x width2 x 0.52). Animal studies were approved by the Animal Research Ethics Board at McMaster University.

Preparation of microvesicles from conditioned media

Cells were washed and fresh complete medium added for 24 hours. Conditioned medium was removed and centrifuged to eliminate debris (500g for 15 minutes, then 800g for 20 minutes), and then ultracentrifuged for 90 minutes at 4°C (100 000g) to pellet microvesicles, which were resuspended in PBS.

Immunohistochemistry.

Tumors were excised and fixed in 10% formalin. Deparaffinized 4-µm sections were stained with hematoxylin and eosin for analysis of gross morphology, or immunostained for TF after microwave antigen retrieval. Sheep anti-human TF IgG was used as primary antibody (Affinity Biologicals, Ancaster, ON, Canada), followed by Alexa Fluor 488 donkey anti-sheep IgG (Molecular Probes).

K-ras PCR-RFLP

Activating mutations in codon 13 of the K-ras gene were detected by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis.28 DNA was extracted using a DNeasy tissue kit (Qiagen, Valencia, CA). PCR was performed in a reaction volume of 50 µL containing 250 ng DNA, 1 x reaction buffer, 0.2 mM dNTP, 1.5 mM MgCl2, 0.2 µM of each primer, and 2.5 U Taq polymerase (Invitrogen, Carlsbad, CA). As described in Schimanski et al,28 the primers were RAS A (sense) 5'-ACTGAATATAAACTTGTGGTCCATGGAGCT-3' and RAS B (antisense) 5'-TTATCTGTATCAAAGAATGGTCCTGCACCA-3'. Amplification was performed in a thermocycler (Progene; Techne, Minneapolis, MN), and consisted of 30 cycles of 94°C for 1 minute, 55°C for 1 minute, and 72°C for 2 minutes. Two rounds of PCR were performed to obtain a very clean 166-base pair (bp) product. Then, 10 µL of the PCR reaction was digested with XcmI (10 U; New England Biolabs, Beverly, MA) for 20 hours at 37°C, in a total volume of 40 µL. When codon 13 is wild type, the PCR product contains a restriction site for XcmI, and digestion yields bands of 138 and 28 bp. If there is a mutation in either of the first 2 bases of codon 13, the mutant PCR fragment will not be cut by XcmI and will remain at its original size of 166 bp. Bands were visualized by electrophoresis on a 3.5% agarose gel. DNA extracted from the whole blood of a healthy donor was used as the wild-type K-ras codon 13 GGC-Gly control. DNAfrom HCT116 cells (heterozygously GAC mutated in codon 13)29 was used as the control for known K-ras mutation. Amplified products were confirmed by sequencing.

TF promoter activity assays

Cells grown in 6-well plates were transiently transfected with the dominantnegative H-Ras-N17 plasmid (1.5 µg) and 0.5 µg pGL2-hTF (full length: -2102 to +121 TF promoter sequence cloned into the pGL2 luciferase reporter plasmid), using Lipofectamine 2000 (Invitrogen). Empty pcDNA3.1 vector was used as a control for H-Ras-N17 transfection. LacZ expression vector (pcDNA3.1-LacZ, 0.25 µg) was cotransfected to monitor transfection efficiency. Luciferase activity was determined 24 hours after transfection using the Luciferase Assay System (Promega, Madison, WI) and TD-20/20 luminometer (Turner Designs, Sunnyvale, CA), according to supplied protocols. Alternatively cells transfected with pGL2-hTF were treated with PD98059 (50 µM) or LY294002 (20 µM) for 2 to 48 hours prior to read out. Values were normalized to the {beta}-galactosidase activity measured in the lysates.

TF gene silencing by siRNA

The small interfering RNA (siRNA) expression plasmid (pSN-TF) was constructed by annealing and cloning the following siRNA oligonucleotides into the pSuppressorNeo (pSN) vector (Imgenex, San Diego, CA): 5'-TCGAGGCGCTTCAGGCACTACAAATTCAAGAGATTTGTAGTGCCTGAAGCGC TTTTT-3' (forward) and 5'-CTAGAAAAAGCGCTTCAGGCACTACAAATCTCTTGAATTT GTAGTGCCTGAAGCGC-3' (reverse). These oligonucleotides use a previously validated siRNA sequence,30 and encode the sense siRNA sequence followed by a short spacer, the reverse complement of the sense strand, and a transcriptional termination signal. Thus, transcription of pSN-TF generates hairpin RNAs that are processed into siRNAs in the cell. As a control, oligonucleotides incorporating an siRNA sequence known to be inactive in TF silencing30 were used to construct a control expression vector (pSN-77): 5'-TCGAGTGGAGACCCCTGCCTGG CCTTCAAGAGAGGCCAGGCAGGGGTCTCCATTTTT-3' (forward) and 5'-CTAGAAAAATGGAGACCCCTGCCTGGCCTCTCTTGAAGGCCAGGCAGGGGTCTCCA-3'. HCT116 cells were transfected with pSN-TF and pSN-77 using Lipofectamine 2000 (Invitrogen), and clones screened for integration of the siRNA sequence by PCR (of gDNA) using the following primers: 5'-AATACGTGACGTAGAAAGTA-3' (forward) and 5'-CACATGTGATA TCCGCAG-3' (reverse). TF gene down-regulation in positive clones was then assessed by Northern blotting and TF activity assay.

Matrigel assay

HCT116, SI-2, and SI-3 cells were rendered mitotically incompetent by treatment for 2 hours with 10 µg/mL mitomycin C (Sigma, St Louis, MO), washed, and resuspended in Matrigel (BD Biosciences) at a concentration of 4 x 106 cells/mL. A total of 0.2 mL of the mixture was injected subcutaneously in the flanks of SCID mice. As a negative control, cell-free Matrigel alone was injected. Plugs were excised after 11 days, placed in Carnoy fixative (60% methanol, 30% chloroform, 10% glacial acetic acid) for 4 hours, then transferred to ethanol. Paraffin-embedded specimens were cut and stained with hematoxylin and eosin or immunostained for von Willebrand Factor (VWF). The primary antibody was rabbit anti-human VWF (1:300; Dako, Carpinteria, CA), followed by goat antirabbit secondary antibody (1:1000, Zymed Laboratories, San Francisco, CA), and color was developed with 3,3'-diaminobenzidine tetrahydrochloride dihydrate (DAB; Dako). Angiogenic response was quantified by measurement of the area occupied by VWF+ endothelial networks per x 20 field. A total of 5 fields were analyzed from 5 sections of 5 different Matrigel plugs per group. Image capture and analysis was performed using Northern Eclipse software (Eurpix Imaging, Mississauga, ON, Canada).

Statistics

Data are presented as means of several independent measurements ± SD. Statistical analyses (t test) were performed with GraphPad InStat software (GraphPad Software, San Diego, CA). Linear regression analysis was performed with Origin 6.1 (OriginLab, Northampton, MA).


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Impact of K-ras and p53 on TF expression by human CRC cells

Clinical progression of CRC is paralleled by sequential alterations in K-ras and p53 genes, as well as by increasing TF immunoreactivity.1,21 Two independent human CRC cell lines, DLD-1 and HCT116, both harbor 1 mutant (and 1 wild-type) K-ras allele and express elevated levels of TF.22 To determine whether mutation of the K-ras oncogene is directly linked to TF expression in CRC, we examined the consequences of selective disruption of the mutant K-ras allele by homologous recombination in previously characterized cellular variants.22 This procedure produced the DKs-8 and DKO-3 sublines (from DLD-1), as well as the HKh-2 subline (from HCT116), all of which consequently express only the wild-type K-ras allele and a diminished level of malignancy.22 DKO-1 cells were derived from DLD-1 after accidental disruption of the wild-type rather than the mutant K-ras allele (Figure 1).



View larger version (16K):
[in this window]
[in a new window]
 
Figure 1.. Genetic changes associated with CRC progression. The status of model CRC cell lines (HCT116 and DLD-1) with respect to changes in K-ras and p53 genes is indicated, in relation to the accepted model of CRC progression.1

 

Cell surface TF immunoreactivity was greatly diminished in cells without mutant K-ras (DKs-8, DKO-3, and HKh-2), relative to their respective isogenic but mutant K-ras-expressing DLD-1 and HCT116 counterparts (Figure 2A-B). TF mRNA, total TF protein, and cell surface TF activity were all down-regulated on mutant K-ras disruption (Figure 2C-E). These results suggest that TF up-regulation in CRC cells is directly linked to expression of the activated mutant K-ras oncogene.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 2.. TF expression in cancer cells parallels genetic tumor progression with an impact of K-ras and p53 status. Flow cytometric analysis of surface TF antigen levels present on (A) DLD-1 or (B) HCT116 CRC cells, and their respective sublines created by selective disruption of mutant K-ras or p53 by homologous recombination (+ indicates wild-type allele; mut, mutant allele; del, disrupted allele). Analysis of TF mRNA and protein expression in these cells by (C) Northern and (D) Western blotting. (E) Cell surface TF activity of HCT116 sublines parallels TF antigen expression. Error bars indicate standard deviation.

 

During CRC progression, activation of K-ras is frequently followed by loss-of-function mutations in the p53 tumor suppressor gene. Therefore, we next investigated whether p53 status has an impact on TF expression in cells representative of more advanced CRC. HCT116 cells harbor 2 wild-type p53 alleles, both of which have been disrupted in a previously generated variant (designated 379.2).23 Thus, 379.2 cells recapitulate natural loss-of-function alterations (loss of heterogeneity [LOH]) affecting this tumor suppressor in CRC. As with K-ras mutation, loss of p53 in 379.2 cells was associated with a marked further increase in cell surface TF activity, TF protein, and mRNA relative to their parental p53+/+ HCT116 counterparts (Figure 2B-E). It is noteworthy that the TF profile of p53-/- HCT116 (379.2) cells (which harbor mutant K-ras) reflects the cumulative impact of both transforming alterations (K-ras and p53); that is, TF expression is progressively up-regulated with these 2 sequential oncogenic events (HKh-2 < HCT116 < 379.2).

Impact of oncogenes on circulating TF levels

To explore whether up-regulation of TF in tumor cells translates into systemic release of this procoagulant, TF antigen concentration in the plasma of tumor-bearing mice was measured using a human-specific TF ELISA. Indeed, human (tumor-derived) TF was detected in the plasma of mice with HCT116 tumors, at a concentration corresponding with increasing tumor volume (Figure 3A). The plasma TF level in mice with extremely large tumors was somewhat reduced, possibly reflecting tumor necrosis and inefficient tumor perfusion. More important, the level of circulating human TF was significantly higher in mice bearing highly TF+ 379.2 (p53-/-) tumors, relative to mice with similarly sized HCT116 (p53+/+) tumors; poorly tumorigenic HKh-2 cells were not included in this analysis (Figure 3B). Thus, the p53-dependent increase in TF expression in 379.2 cells translated into a higher level of TF in the circulation. Plasma of mice harboring large murine fibrosarcomas engineered to express high levels of mouse TF (528ras+mTF) did not contain any human TF immunoreactivity detectable by this ELISA and neither did plasma of tumor-free animals (Figure 3B). Hence, essentially all circulating TF antigen detected in mice harboring HCT116 and 379.2 tumors is attributable to tumor cell-derived TF.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 3.. Oncogenic status of tumors influences circulating TF levels. (A) Circulating TF is detectable in the plasma of HCT116 tumor-bearing mice, and plasma TF concentration is proportional to tumor volume. Asterisked points were excluded from the linear regression. (B) Higher plasma TF concentrations are observed in mice with tumors originating from the p53-/- variant of HCT116 cells (379.2 cells), relative to those with HCT116 tumors of a similar size. The TF ELISA detects human (but not mouse) TF. Tumor volume (mean ± SD) for each group is indicated. (C) The cell-free TF activity produced by HCT116 and sublines is associated with pelleted membrane vesicles after ultracentrifugation. Error bars indicate standard deviation.

 

Although this particular assay does not offer insight into TF procoagulant activity related to either tumor or host cells, such activity was detected in conditioned medium from HCT116 cells, as well as from its mutant K-ras and p53-disrupted sublines (Figure 3C). As with cell-bound TF, the secretion of cell-free TF activity corresponded with the genetic status of the respective CRC cells (ie, K-raswt/p53wt < K-rasmut/p53wt < K-rasmut/p53mut). Surprisingly, all CRC cells expressed only minimal amounts of the recently described, soluble splice variant of TF (asHTF; data not shown),31 and instead most of the released cell-free TF activity could be isolated (pelleted) from the conditioned medium by ultracentrifugation (Figure 3C). Because viable cells are known to actively shed plasma membrane-derived vesicles (also called microvesicles or microparticles) that may contain procoagulant activity,32-35 this result is consistent with the ability of CRC cells to shed TF-containing microvesicles both into the media and the circulation. Indeed, such structures were observed under electron microscope in supernatants from CRC cell lines (data not shown). Again, the amount of cell-free vesicle-associated TF activity released by each cell line was proportional to their total TF production, which was dictated by their oncogenic status (Figure 3C). These data suggest that K-ras and p53 influence not only cell surface TF expression, but also the global amount of TF activity released from cancer cells into their surroundings and the circulation.

The link between TF expression and aggressiveness of cancer cells in vivo

Low TF-expressing, mutant K-ras- HKh-2 cells are poorly tumorigenic in vivo (Figure 4A). Interestingly, HKh-2 tumors that eventually arise and assume more aggressive properties were found to display increased TF mRNA expression (50 days after cell injection), relative to their counterparts maintained in culture (Figure 4B top). Because analysis of early stage (day 7) HKh-2 tumors by TF immunostaining revealed the presence of extremely rare, but highly TF+ cells among the TF- majority (Figure 4C-E), we examined whether this TF positivity might be a signature of a cell subset with an overt growth advantage, which would subsequently contribute to the gradual increase in overall tumor aggressiveness in vivo. First, HKh-2 cells were stained with a TF antibody, and cell sorting was performed to collect the fractions with the 5% highest and lowest TF expression; these were designated TF-positive (TF-POS) and TF-negative (TF-NEG), respectively. Both cell subsets were expanded in vitro and analyzed for expression of TF mRNA and tumor-forming ability in SCID mice. In this setting, the TF-NEG cell subset was poorly tumorigenic in SCID mice, whereas TF-POS cells grew more aggressively (Figure 4F), a finding that suggests close cosegregation between TF expression and malignancy within a single tumor cell line.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 4.. TF up-regulation cosegregates with increased malignancy of CRC cells. (A) Growth of HCT116 ({circ}) and variant sublines HKh-2 ({blacksquare}) and 379.2 ({blacktriangleup}) in SCID mice. (B) Elevated TF mRNA expression was observed in HKh-2 tumors 50 days after injection of cells in vivo (top, middle); PCR-RFLP assay for detection of K-ras codon 13 mutation (bottom). The HKh-2 cell line used to establish tumors displayed a faint mutant K-ras band, suggesting the presence of rare revertant cells that sustained codon 13 mutations in the remaining undisrupted (wild-type) K-ras allele. Such cells were enriched in HKh-2 tumors, as indicated by the bright mutant K-ras band. TF immunohistochemical staining of (C) HKh-2 tumor, (D) HCT116 tumor, and (E) 379.2 tumor. Only rare, single TF+ cells (arrows in panel C) were observed in small early stage (day 7) HKh-2 tumors, whereas the greatest TF positivity was observed in 379.2 tumors, consistent with the levels of TF protein and mRNA expressed by these cells in vitro. (F) After sorting of cultured HKh-2 cells on the basis of TF positivity/negativity and injection into SCID mice, TF+ (TF-POS, {circ}) HKh-2 cells grew faster than the original HKh-2 ({blacksquare}) cell population in vivo, whereas TF- (TF-NEG,{triangleup}) HKh-2 cells were relatively nontumorigenic. TF Northern blotting confirmed the purity of the sort (inset). Results from 1 of 2 independent sorting experiments are depicted. (G) The TF-POS cell subpopulation ({blacksquare}) is enriched in revertant cells that express mutant K-ras, as indicated by the increased intensity of the mutant K-ras band (relative to the wild-type band, {cjs2108}). (H) Expression of dominant inhibitory Ras-N17 ({blacksquare}) in mutant ras-expressing HCT116, HKh-TUM2, DLD-1, and A549 cells diminishes TF promoter activity relative to controls ({cjs2108}). (I) Marked attenuation of TF promoter activity by pharmacologic inhibition of MEK1 (PD98059, 50 µM, {blacksquare}) downstream of Ras. This effect was observed in CRC cells harboring mutant K-ras (HCT116) and their derivatives with deleted p53 (379.2). {cjs2108} indicates DMSO control. Error bars indicate standard deviation.

 

One obvious way by which genetically unstable HKh-2 cells (K-rasdel/+) could reacquire increased aggressiveness is by re-expression of a dominant genetic lesion, for example, mutation in the remaining wild-type K-ras allele.36 Indeed, using a PCR-RFLP assay to detect mutations in K-ras, we found that HKh-2 cells expressed mostly wild-type K-ras allele, as expected. In contrast, HKh-2 cells isolated from tumors that eventually emerged in SCID mice contained a new K-ras mutation (Figure 4B bottom). Moreover, analysis of TF-POS and TF-NEG cells collected from 2 independent sorting experiments (including the one depicted in Figure 4F) revealed that even in culture, the more aggressive TF-POS subpopulation of HKh-2 cells (expressing high TF levels) is enriched in "revertants" expressing mutant K-ras (Figure 4G). In contrast, low TF-expressing and poorly tumorigenic TF-NEG cells continue to express the wild-type K-ras allele. These results suggest that either TF is a consistent molecular "marker" of greater malignancy (eg, K-ras mutation), or a more direct effector of the malignant phenotype, at least in the context of mutant K-ras.

To reinforce the role of mutant ras in up-regulation of TF expression, we examined the effect of expressing dominant inhibitory Ras-N17 mutant25,26 on TF promoter activity in Ras-driven cells. Even transient transfection of the Ras-N17 construct into HCT116 and DLD-1 CRC cells and A549 lung carcinoma cells diminished TF promoter activity relative to cells transfected with a control plasmid (Figure 4H). Expression of the dominant-negative Ras-N17 mutant also decreased TF promoter activity in HKh-TUM2 cells (Figure 4H), which were isolated from HKh-2 tumors (50 days after cell injection) and found to be revertants harboring de-novo K-ras mutation (Figure 4B). Moreover, pharmacologic inhibition of the MEK1/mitogen-activated protein kinase (MAPK) pathway (by PD98059) downstream of Ras resulted in similar inhibition of TF promoter activity in both HCT116 and 379.2 cells. Collectively, these results substantiate a causal role of the activated Ras pathway in up-regulation of TF in CRC cells (both with and without defects in p53) and point to at least partial contribution of a transcriptional mechanism in this process (Figure 4H).

Regulation of TF expression in CRC cells downstream of mutant K-ras

To further investigate some of the potential downstream events involved in TF up-regulation by mutant K-ras, we treated HCT116 cells with a panel of pharmacologic inhibitors. Again, selective inhibition of MEK1 (and MAPK pathway) with PD 98059 resulted in decreased TF protein levels (Figure 5A). Interestingly, blockade of phosphatidylinositol 3'-kinase (PI3K) activity also led to greatly diminished TF expression, to levels comparable to those of wild type K-ras-expressing Hkh-2 cells (compare Figures 1 and 5). In contrast, treatment of HCT116 cells with a pan-ErbB inhibitor (CI-1033) only slightly decreased TF expression, whereas a platelet-derived growth factor receptor (PDGFR) signaling inhibitor (AG1296) or vehicle (DMSO) had no effect. Similar results were observed following treatment of 379.2 cells with the same inhibitors (Figure 5B). These data suggest that the PI3K and MAPK pathways both contribute to up-regulation of TF in CRC cells expressing mutant K-ras even when this effect is amplified by the simultaneous loss of p53.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 5.. Downstream pathways regulating TF expression in CRC cells. (A) TF protein levels in mutant K-ras-dependent HCT116 cells were diminished by selective inhibition of the PI3K and MAPK pathways using LY294002 and PD98059, respectively. Specific inhibition of EGFR and ErbB2 kinases with CI-1033, a pan-ErbB inhibitor, slightly decreased TF levels, whereas PDGFR inhibition (AG1296) had no effect. (B) Similar results were observed in 379.2 cells, which have altered p53 function in addition to mutant K-ras. Inhibitor concentrations used were as follows: AG1296 (20 µM), CI-1033 (10 µM), PD98059 (50 µM), and LY294002 (20 µM).

 

Effect of TF gene silencing on HCT116 growth and angiogenesis in vivo

To determine the extent (if any) to which TF expression may be required for K-ras-driven tumorigenicity, we used an RNA interference (RNAi) approach to knock down TF expression in HCT116 cells. Previously validated small interfering RNA (siRNA) sequences30 were used to construct a TF siRNA expression plasmid suitable for generation of permanent cell lines, to achieve the long-term effects necessary for in vivo studies. Several TF siRNA-transfected HCT116 clones integrated the siRNA sequence (Figure 6A inset) and exhibited diminished TF activity and expression (Figure 6A and data not shown). Three of these clones (SI-2, SI-3, and SI-9) were selected for in vivo studies on the basis of their stable TF-suppressed phenotype.



View larger version (59K):
[in this window]
[in a new window]
 
Figure 6.. Effect of TF gene silencing on HCT116 tumor growth and angiogenesis. (A) TF siRNA-expressing clones (SI-2, SI-3, and to a lesser extent SI-9) demonstrate decreased cell surface TF activity consistent with TF gene knockdown. Presence of integrated TF siRNA sequence in the clones was confirmed by PCR (inset). (B) In vitro growth curves for HCT116 ({blacksquare}) and the TF siRNA-expressing clones (SI-2, {circ}; SI-3, {blacktriangleup}; SI-9, x) were found to be similar in monolayer culture. (C) In contrast, TF RNAi results in diminished in vivo tumor growth of HCT116 tumors in SCID mice. (D) After 11 days in vivo, robust formation of VWF+ vascular networks was observed in Matrigel plugs containing HCT116 cells. (E) Endothelial cell infiltration was noticeably reduced in plugs containing equivalent numbers of TF-deficient SI-3 cells. (F) The area occupied by VWF+ vascular networks was significantly lower in Matrigel plugs containing TF siRNA-expressing cells (after 11 days in vivo), relative to plugs containing parental HCT116 cells (*P < .0001; area was expressed as a percentage of the total area of a x 20 field). No significant host cell invasion or VWF positivity was detected in pellets consisting of Matrigel alone. Northern blotting of tumors derived from TF down-regulated SI-3 cells revealed significantly increased expression of 2 angiogenesis inhibitors, (G) TSP-1 and (H) TSP-2, relative to their parental HCT116 counterparts, whereas expression of VEGF (I) was only slightly decreased in SI-3 tumors. Numbers indicate intensity of band relative to 28S rRNA loading control. (J) The working model that illustrates how TF may participate in mediating the K-ras-dependent angiogenic phenotype, in part by deregulating expression of angiogenesis inhibitors TSP-1 and TSP-2. Error bars indicate standard deviation. For panels D and E, images were acquired with a Zeiss Axioskop 2 microscope equipped with a Zeiss Achroplan 20x/0.45 objective lens (Zeiss, Oberkochen, Germany). Images were captured with a Sony DXC-350 video system (Sony, San Diego, CA).

 

Whereas the in vitro growth properties of HCT116 cells were unaffected by down-regulation of TF even in hypoxic or spheroid cultures (Figure 6B and data not shown), the growth of tumors established from TF-suppressed clones was markedly retarded relative to parental HCT116 cells (Figure 6C). This effect was highly specific because growth of HCT116 cells transfected with an expression plasmid encoding an siRNA sequence known to be ineffective in TF gene silencing30 were indistinguishable from parental HCT116 (data not shown). Because TF status only affected the behavior of HCT116 cells in vivo, that is, in a manner that was likely host-dependent, this could be indicative of the proangiogenic role of TF in the context of mutant K-ras-driven tumorigenicity of these CRC cells. Hence, we assessed the global capacity of a fixed number of HCT116 cells or their TF-deficient variants to recruit host endothelial cells into Matrigel plugs in vivo. Cells were treated briefly with mitomycin C to prevent changes in cell number, resuspended in Matrigel, and injected subcutaneously into mice, and plugs were recovered 11 days later. Quantification of VWF+ vascular structures by morphometry indicated a consistent, and statistically significant, 3-fold difference in the proangiogenic potential of HCT116 cells relative to their TF down-regulated SI-2 and SI-3 counterparts (Figure 6D-F). In SI-2 and SI-3 plugs, VWF+ vasculature was found merely at the outer margins and rarely contained red blood cells (Figure 6E). Plugs consisting of Matrigel alone showed only minimal background invasion (Figure 6F). Because HCT116 cells ultimately depend on mutant K-ras for their tumorigenic and angiogenic properties,22 these results raise the possibility that TF is required for the expression of the angiogenic phenotype driven by this oncogene.

In keeping with this possibility, transcripts encoding 2 angiogenesis inhibitors (and oncogene targets), TSP-1 and TSP-2, were expressed at much higher levels in TF down-regulated cell lines than in their parental HCT116 counterparts (Figure 6G-H). Interestingly, this difference was only observed in vivo (and not between the respective cell lines in culture). This raises a possibility (but does not prove) that tumor-derived TF may interact with host-dependent ligands (eg, factor VIIa) to execute the "proangiogenic switch" in tumors harboring mutant K-ras. Expression of VEGF in HCT116 cells was minimally affected by their TF status (Figure 6I). Collectively, these results suggest that at least a portion of K-ras-dependent angiogenic activity expressed by CRC cells in vivo may be mediated through TF up-regulation and its multiple downstream angiogenic targets exemplified by TSP-1 and TSP-2 (Figure 6J).


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The intriguing properties of TF, which acts as a procoagulant and proangiogenic cellular receptor in various pathologic contexts, have recently been a subject of intense interest.13 Indeed, TF is consistently up-regulated in human cancer cells,13 but the causes and mechanisms of this change have remained unknown. In this regard our study led to several new findings.

First, our results suggest that TF is a target of at least 2 of the most common genetic alterations in human malignancy: inactivation of p53 and mutation of K-ras. Moreover, action of these respective transforming events appears to be cumulative in nature. Thus, in a unique and well-characterized series of isogenic human CRC cell lines engineered genetically to recapitulate 2 distinct steps in genetic tumor progression,1,22,23 activation of mutant K-ras and subsequent inactivation of p53 up-regulated TF expression and activity in a cooperative manner. There is a remarkable similarity between this stepwise increase in TF levels and the reported pattern of gradual increase in TF immunoreactivity in clinical specimens of human CRC,19-21 as well as the increasing frequency of systemic coagulopathy associated with advanced malignancy.6,37 Both K-ras and p53 likely act at the level of TF gene expression (rather than de-encryption) because TF mRNA, total protein, immunoreactivity, and procoagulant activity (both cell-associated and released in membrane vesicles) were affected in a parallel fashion by the genetic status of CRC cells. Taken together, our observations suggest the possibility that TF up-regulation and hypercoagulability in patients with cancer may have a hitherto unappreciated genetic cause.

The second major point presented in our study is that TF up-regulation is not merely a correlate ("marker") or consequence of oncogenic alterations, but also an important effector of K-ras-dependent tumorigenesis and angiogenesis, at least in human CRC. This finding causally links 2 hitherto separately studied solitudes, namely, the coagulation system and genetic tumor progression. In particular, tumor growth, angiogenesis, and metastasis have long been attributed, at least in part, to both canonical and noncanonical TF activities,15,38,39 including generation of thrombin, deposition of fibrin, and activation of proangiogenic platelets.12 In some of these instances, elevated TF expression in cancer cells elicited such cellular responses as constitutive up-regulation of VEGF, down-regulation of TSP-2,15 and increased metastatic38 and angiogenic capacity.15

Such TF-induced changes resemble those described previously in the context of mutant oncogenes (eg, K-ras4). Our present results indicate that this is not merely a coincidence because we find TF expression to be required for full manifestation of the K-ras-dependent angiogenic and aggressive tumor cell phenotype in vivo (but not in vitro). Thus, enforced TF down-regulation in K-ras-expressing CRC cells by RNAi profoundly reduced global angiogenic capacity, led to increased levels of angiogenesis inhibitors (TSP-1 and TSP-2), and diminished growth of tumors in vivo without affecting the transformed phenotype and mitogenic properties of the cancer cells themselves (in vitro). Although TF does not seem to possess any overt cell autonomous transforming or growth regulatory properties in this setting, it clearly possesses the ability to modify tumor cell behavior in vivo, likely through interaction with host-derived entities. The nature of the latter remains unknown at present but the likely candidates include factor VIIa, factor Xa, and other putative TF ligands (eg, plasminogen, TF pathway inhibitor [TFPI]).40,41 Regardless of the molecular mechanism, the tumor-inhibitory effects of TF down-regulation highlight the possible validity of targeting TF in the context of K-ras-driven human tumors, such as pancreatic, colorectal, and lung cancer.2 In this context, TF-dependent regulation of the angiogenic phenotype in cancer cells must be distinguished conceptually and mechanistically from the role TF appears to play in the context of angiogenic host endothelial cells. The latter was recently linked with signaling properties of the TF cytoplasmic domain.14

At variance with earlier reports,15 we have not observed any significant link between the status of TF in HCT116 cells and expression of VEGF in vivo or in vitro. It is possible that VEGF in the context of HCT116 cells may be under TF-independent regulatory control (eg, by mutant K-ras itself4), a notion consistent with the pleiotropic and tumor/oncogene-specific nature of proangiogenic gene expression profiles characterized to date.24 This pleiotropism appears to extend to angiogenic mediators downstream of TF because our findings suggest that TF is linked to the regulation of at least 2 different endogenous angiogenesis inhibitors (TSP-1 and TSP-2). A more complete survey of TF-dependent and TF-independent effectors of oncogene-driven tumor angiogenesis is warranted, using approaches of functional genomics24 and proteomics.

Although many influences (including inflammation, hypoxia, and other) could contribute to TF up-regulation by cancer cells, our findings suggest that oncogenic events play an important and hitherto unappreciated role in this regard. It follows that oncogene-targeted therapies might be useful in reversing this increase. Unfortunately, no potent, specific, and proven pharmacologic modulators of K-ras and p53 status in the context of CRC are currently available. In contrast, recent clinical successes have been achieved with inhibitors of ErbB receptor kinases.42 We have observed that in A431 epithelial carcinoma cells, the malignant properties of which are mainly driven by overexpression/activation of EGFR, both epidermal growth factor receptor (EGFR)/ErbB1 and pan-ErbB inhibitors markedly diminished TF expression and reduced the levels of cancer cell-derived (human) TF in the circulation of tumor-bearing mice (J.L.Y. and J.W.R., unpublished data, 2004). It is worth considering whether TF levels in biopsy material or plasma of patients receiving certain oncogene-directed agents could provide a measure of the agent's biologic, and possibly also therapeutic, efficacy.

Because of technical considerations (xenograft model), our experiments did not provide direct evidence of the contribution of tumor cell-associated TF, and its oncogenic up-regulation, to the overall hypercoagulability associated with cancer (ie, with inclusion of host-dependent and inflammatory events). However, an observation that all-trans-retinoic acid (ATRA) attenuates coagulopathy in patients with acute promyelocytic leukemia (APL) serves as a thought-provoking precedent, as ATRA acts essentially by blocking the oncogenic action of the promyelocytic/retinoic acid receptor {alpha} (PML/RAR{alpha}) gene product on the malignant phenotype of APL cells.43

Collectively, TF expressed by cancer cells appears to act as both a regulatory target and an important mediator of oncogenedriven tumor growth and neovascularization. Future studies will determine the extent to which targeting and monitoring TF expression may be useful, from a diagnostic, prognostic, and therapeutic standpoint. A better understanding of the oncogenic defects driving malignant progression will likely provide important clues in this regard.


    Acknowledgements
 
We thank Sarah Gilpin for technical assistance and our colleagues Dr Sarka Lhotak, Alan Stafford, and Lindsay Watson for technical suggestions.


    Footnotes
 
Submitted June 1, 2004; accepted October 11, 2004.

Prepublished online as Blood First Edition Paper, October 19, 2004; DOI 10.1182/blood-2004-05-2042.

Supported by operating grants from the Terry Fox Foundation of the National Cancer Institute of Canada (NCIC; J.R.), Canadian Institutes of Health Research (CIHR; J.R.), Natural Sciences and Engineering Council of Canada (NSERC; J.R.), and Hamilton Health Sciences (HHS; J.R.) Corporation, as well as grants to from CIHR (B.L.C.). J.R. is a recipient of the Scientist Career Award from NCIC, and J.L.Y. is a recipient of a postdoctoral fellowship from CIHR.

An Inside Blood analysis of this article appears in the front of this issue.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Janusz W. Rak, Henderson Research Centre, 711 Concession St, Rm. 216, Hamilton, ON, Canada, L8V 1C3; e-mail: jrak{at}thrombosis.hhscr.org.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Fearon ER, Vogelstein B. A genetic model for colorectal tumorigenesis. Cell. 1990;61: 759-767.[CrossRef][Medline] [Order article via Infotrieve]

  2. McCormick F. Signal transduction networks. Ras as a paradigm. In: Rak J, ed. Oncogene-Directed Therapies. Totowa: Humana Press; 2003: 35-46.

  3. Bouck N, Stellmach V, Hsu SC. How tumors become angiogenic. Adv Cancer Res. 1996;69: 135-174.[Medline] [Order article via Infotrieve]

  4. Rak J, Yu JL, Klement G, Kerbel RS. Oncogenes and angiogenesis: signaling three-dimensional tumor growth. J Investig Dermatol Symp Proc. 2000;5: 24-33.[CrossRef][Medline] [Order article via Infotrieve]

  5. Folkman J. Clinical applications of research on angiogenesis. N Engl J Med. 1995;333: 1757-1763.[Free Full Text]

  6. Dvorak FH. Abnormalities of hemostasis in malignant disease. In: Coleman RB, Hirsh J, Marder VJ, Salzman JB, eds. Hemostasis and Thrombosis: Basic Principles and Clinical Practice. Philadelphia, PA: Lippincott; 1994: 1238-1254.

  7. Colman RW, Marder VJ, Salzman EW, Hirsh J. Overview of hemostasis. In: Coleman RB, Hirsh J, Marder VJ, Salzman JB, eds. Hemostasis and Thrombosis: Basic Principles and Clinical Practice. Philadelphia, PA: Lippincott; 1994: 3-18.

  8. Kakkar AK, DeRuvo N, Chinswangwatanakul V, Tebbutt S, Williamson RC. Extrinsic-pathway activation in cancer with high factor VIIa and tissue factor. Lancet. 1995;346: 1004-1005.[CrossRef][Medline] [Order article via Infotrieve]

  9. Nagy JA, Brown LF, Senger DR, et al. Pathogenesis of tumor stroma generation: a critical role of leaky blood vessels and fibrin deposition. Biochim Biophys Acta. 1989;948: 305-326.[Medline] [Order article via Infotrieve]

  10. Versteeg HH, Peppelenbosch MP, Spek CA. Tissue factor signal transduction in angiogenesis. Carcinogenesis. 2003;24: 1009-1013.[Abstract/Free Full Text]

  11. Chen J, Bierhaus A, Schiekofer S, et al. Tissue factor—a receptor involved in the control of cellular properties, including angiogenesis. Thromb Haemost. 2001;86: 334-345.[Medline] [Order article via Infotrieve]

  12. Browder T, Folkman J, Pirie-Shepherd S. The hemostatic system as a regulator of angiogenesis. J Biol Chem. 2000;275: 1521-1524.[Free Full Text]

  13. Rickles FR, Shoji M, Abe K. The role of the hemostatic system in tumor growth, metastasis, and angiogenesis: tissue factor is a bifunctional molecule capable of inducing both fibrin deposition and angiogenesis in cancer. Int J Hematol. 2001; 73: 145-150.[Medline] [Order article via Infotrieve]

  14. Belting M, Dorrell MI, Sandgren S, et al. Regulation of angiogenesis by tissue factor cytoplasmic domain signaling. Nat Med. 2004;10: 502-509.[CrossRef][Medline] [Order article via Infotrieve]

  15. Zhang Y, Deng Y, Luther T, et al. Tissue factor controls the balance of angiogenic and antiangiogenic properties of tumor cells in mice. J Clin Invest. 1994;94: 1320-1327.[Medline] [Order article via Infotrieve]

  16. Mueller BM, Reisfeld RA, Edgington TS, Ruf W. Expression of tissue factor by melanoma cells promotes efficient hematogenous metastasis. Proc Natl Acad Sci U S A. 1992;89: 11832-11836.[Abstract/Free Full Text]

  17. Contrino J, Hair G, Kreutzer DL, Rickles FR. In situ detection of tissue factor in vascular endothelial cells: correlation with the malignant phenotype of human breast disease. Nat Med. 1996;2: 209-215.[CrossRef][Medline] [Order article via Infotrieve]

  18. Wojtukiewicz MZ, Sierko E, Klement P, Rak J. The hemostatic system and angiogenesis in malignancy. Neoplasia. 2001;3: 371-384.[CrossRef][Medline] [Order article via Infotrieve]

  19. Nakasaki T, Wada H, Shigemori C, et al. Expression of tissue factor and vascular endothelial growth factor is associated with angiogenesis in colorectal cancer. Am J Hematol. 2002;69: 247-254.[CrossRef][Medline] [Order article via Infotrieve]

  20. Shigemori C, Wada H, Matsumoto K, Shiku H, Nakamura S, Suzuki H. Tissue factor expression and metastatic potential of colorectal cancer. Thromb Haemost. 1998;80: 894-898.[Medline] [Order article via Infotrieve]

  21. Seto S, Onodera H, Kaido T, et al. Tissue factor expression in human colorectal carcinoma: correlation with hepatic metastasis and impact on prognosis. Cancer. 2000;88: 295-301.[CrossRef][Medline] [Order article via Infotrieve]

  22. Shirasawa S, Furuse M, Yokoyama N, Sasazuki T. Altered growth of human colon cancer cell lines disrupted at activated Ki-ras. Science. 1993;260: 85-88.[Abstract/Free Full Text]

  23. Bunz F, Dutriaux A, Lengauer C, et al. Requirement for p53 and p21 to sustain G2 arrest after DNA damage. Science. 1998;282: 1497-1501.[Abstract/Free Full Text]

  24. Viloria-Petit A, Miquerol L, Yu JL, et al. Contrasting effects of VEGF gene disruption in embryonic stem cell-derived versus oncogene-induced tumors. EMBO J. 2003;22: 4091-4102.[CrossRef][Medline] [Order article via Infotrieve]

  25. Feldkamp MM, Lau N, Rak J, Kerbel RS, Guha A. Normoxic and hypoxic regulation of vascular endothelial growth factor (VEGF) by astrocytoma cells is mediated by Ras. Int J Cancer. 1999;81: 118-124.[CrossRef][Medline] [Order article via Infotrieve]

  26. Orchard PJ, Smith CM, Woods WG, Day DOL, Dehner LP, Shapiro R. Treatment of haemangioendotheliomas with alpha interferon. Lancet. 1989;2: 565-567.[Medline] [Order article via Infotrieve]

  27. Nishibe T, Parry G, Ishida A, et al. Oncostatin M promotes biphasic tissue factor expression in smooth muscle cells: evidence for Erk-1/2 activation. Blood. 2001;97: 692-699.[Abstract/Free Full Text]

  28. Schimanski CC, Linnemann U, Berger MR. Sensitive detection of K-ras mutations augments diagnosis of colorectal cancer metastases in the liver. Cancer Res. 1999;59: 5169-5175.[Abstract/Free Full Text]

  29. Jiang W, Kahn SM, Guillem JG, Lu SH, Weinstein IB. Rapid detection of ras oncogenes in human tumors: applications to colon, esophageal, and gastric cancer. Oncogene. 1989;4: 923-928.[Medline] [Order article via Infotrieve]

  30. Holen T, Amarzguioui M, Wiiger MT, Babaie E, Prydz H. Positional effects of short interfering RNAs targeting the human coagulation trigger tissue factor. Nucleic Acids Res. 2002;30: 1757-1766.[Abstract/Free Full Text]

  31. Bogdanov VY, Balasubramanian V, Hathcock J, Vele O, Lieb M, Nemerson Y. Alternatively spliced human tissue factor: a circulating, soluble, thrombogenic protein. Nat Med. 2003;9: 458-462.[CrossRef][Medline] [Order article via Infotrieve]

  32. Dvorak HF, Quay SC, Orenstein NS, et al. Tumor shedding and coagulation. Science. 1981;212: 923-924.[Abstract/Free Full Text]

  33. Mallat Z, Benamer H, Hugel B, et al. Elevated levels of shed membrane microparticles with procoagulant potential in the peripheral circulating blood of patients with acute coronary syndromes. Circulation. 2000;101: 841-843.[Abstract/Free Full Text]

  34. Nieuwland R, Berckmans RJ, McGregor S, et al. Cellular origin and procoagulant properties of microparticles in meningococcal sepsis. Blood. 2000;95: 930-935.[Abstract/Free Full Text]

  35. Shet AS, Aras O, Gupta K, et al. Sickle blood contains tissue factor-positive microparticles derived from endothelial cells and monocytes. Blood. 2003;102: 2678-2683.[Abstract/Free Full Text]

  36. Bhattacharyya NP, Skandalis A, Ganesh A, Groden J, Meuth M. Mutator phenotypes in human colorectal carcinoma cell lines. Proc Natl Acad Sci U S A. 1994;91: 6319-6323.[Abstract/Free Full Text]

  37. Nash GF, Walsh DC, Kakkar AK. The role of the coagulation system in tumour angiogenesis. Lancet Oncol. 2001;2: 608-613.[CrossRef][Medline] [Order article via Infotrieve]

  38. Fernandez PM, Rickles FR. Tissue factor and angiogenesis in cancer. Curr Opin Hematol. 2002;9: 401-406.[CrossRef][Medline] [Order article via Infotrieve]

  39. Ruf W, Mueller BM. Tissue factor in cancer angiogenesis and metastasis. Curr Opin Hematol. 1996;3: 379-384.[Medline] [Order article via Infotrieve]

  40. Albrecht S, Magdolen V, Herzog U, et al. Soluble tissue factor interferes with angiostatin-mediated inhibition of endothelial cell proliferation by lysine-specific interaction with plasminogen kringle domains. Thromb Haemost. 2002;88: 1054-1059.[Medline] [Order article via Infotrieve]

  41. Gonzalez-Gronow M, Gawdi G, Pizzo SV. Tissue factor is the receptor for plasminogen type 1 on 1-LN human prostate cancer cells. Blood. 2002; 99: 4562-4567.[Abstract/Free Full Text]

  42. Lin EH, Abbruzzese J. Clinical evaluation of agents targeting epidermal growth factor receptor (EGFR) in cancer. In: Rak J, ed. Oncogene-Directed Therapies. Totowa: Humana Press; 2003: 313-330.

  43. Kaplan R, DeLa Cadena RA. Mechanism of the coagulopathy associated with acute promyelocytic leukemia -clinical conference-. Am J Hematol. 1998;59: 234-237.[CrossRef][Medline] [Order article via Infotrieve]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?

Related Article in Blood Online:

Tissue factor and tumor cells: as bad as it gets?
Henri H. Versteeg
Blood 2005 105: 1374. [Full Text] [PDF]



This article has been cited by other articles:


Home page
JCOHome page
R. S. Kasthuri, M. B. Taubman, and N. Mackman
Role of Tissue Factor in Cancer
J. Clin. Oncol., October 10, 2009; 27(29): 4834 - 4838.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
C. Boccaccio and P. M. Comoglio
Genetic Link Between Cancer and Thrombosis
J. Clin. Oncol., October 10, 2009; 27(29): 4827 - 4833.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
S. Regina, J.-B. Valentin, S. Lachot, E. Lemarie, J. Rollin, and Y. Gruel
Increased Tissue Factor Expression Is Associated with Reduced Survival in Non-Small Cell Lung Cancer and with Mutations of TP53 and PTEN
Clin. Chem., October 1, 2009; 55(10): 1834 - 1842.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
C. L. Plumb, U. Adamcic, S. Shahrzad, K. Minhas, S. A.I. Adham, and B. L. Coomber
Modulation of the Tumor Suppressor Protein {alpha}-Catenin by Ischemic Microenvironment
Am. J. Pathol., October 1, 2009; 175(4): 1662 - 1674.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
G. M. Thomas, L. Panicot-Dubois, R. Lacroix, F. Dignat-George, D. Lombardo, and C. Dubois
Cancer cell-derived microparticles bearing P-selectin glycoprotein ligand 1 accelerate thrombus formation in vivo
J. Exp. Med., August 31, 2009; 206(9): 1913 - 1927.
[Abstract] [Full Text] [PDF]


Home page
CLIN APPL THROMB HEMOSTHome page
M. F. Barginear, M. Lesser, M. L. Akerman, M. Strakhan, I. Shapira, T. Bradley, and D. R. Budman
Need for Inferior Vena Cava Filters in Cancer Patients: A Surrogate Marker for Poor Outcome
Clinical and Applied Thrombosis/Hemostasis, June 1, 2009; 15(3): 263 - 269.
[Abstract] [PDF]


Home page
Anesth. Analg.Home page
N. Mackman
The Role of Tissue Factor and Factor VIIa in Hemostasis
Anesth. Analg., May 1, 2009; 108(5): 1447 - 1452.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Rong, V. E. Belozerov, C. Tucker-Burden, G. Chen, D. L. Durden, J. J. Olson, E. G. Van Meir, N. Mackman, and D. J. Brat
Epidermal Growth Factor Receptor and PTEN Modulate Tissue Factor Expression in Glioblastoma through JunD/Activator Protein-1 Transcriptional Activity
Cancer Res., March 15, 2009; 69(6): 2540 - 2549.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Al-Nedawi, B. Meehan, R. S. Kerbel, A. C. Allison, and J. Rak
Endothelial expression of autocrine VEGF upon the uptake of tumor-derived microvesicles containing oncogenic EGFR
PNAS, March 10, 2009; 106(10): 3794 - 3799.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. Sousou and A. A. Khorana
New Insights Into Cancer-Associated Thrombosis
Arterioscler Thromb Vasc Biol, March 1, 2009; 29(3): 316 - 320.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. Zhao, G. Aguilar, S. Palencia, E. Newton, and A. Abo
rNAPc2 Inhibits Colorectal Cancer in Mice through Tissue Factor
Clin. Cancer Res., January 1, 2009; 15(1): 208 - 216.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. C. Milsom, J. L. Yu, N. Mackman, J. Micallef, G. M. Anderson, A. Guha, and J. W. Rak
Tissue Factor Regulation by Epidermal Growth Factor Receptor and Epithelial-to-Mesenchymal Transitions: Effect on Tumor Initiation and Angiogenesis
Cancer Res., December 15, 2008; 68(24): 10068 - 10076.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J. Yu, L. May, C. Milsom, G. M. Anderson, J. I. Weitz, J. P. Luyendyk, G. Broze, N. Mackman, and J. Rak
Contribution of Host-Derived Tissue Factor to Tumor Neovascularization
Arterioscler Thromb Vasc Biol, November 1, 2008; 28(11): 1975 - 1981.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. H. Versteeg, F. Schaffner, M. Kerver, L. G. Ellies, P. Andrade-Gordon, B. M. Mueller, and W. Ruf
Protease-Activated Receptor (PAR) 2, but not PAR1, Signaling Promotes the Development of Mammary Adenocarcinoma in Polyoma Middle T Mice
Cancer Res., September 1, 2008; 68(17): 7219 - 7227.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. H. Versteeg, F. Schaffner, M. Kerver, H. H. Petersen, J. Ahamed, B. Felding-Habermann, Y. Takada, B. M. Mueller, and W. Ruf
Inhibition of tissue factor signaling suppresses tumor growth
Blood, January 1, 2008; 111(1): 190 - 199.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
C. A Staton, A. S A Chetwood, I. C Cameron, S. S Cross, N. J Brown, and M. W R Reed
The angiogenic switch occurs at the adenoma stage of the adenoma carcinoma sequence in colorectal cancer
Gut, October 1, 2007; 56(10): 1426 - 1432.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Varki
Trousseau's syndrome: multiple definitions and multiple mechanisms
Blood, September 15, 2007; 110(6): 1723 - 1729.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
N. Mackman, R. E. Tilley, and N. S. Key
Role of the Extrinsic Pathway of Blood Coagulation in Hemostasis and Thrombosis
Arterioscler Thromb Vasc Biol, August 1, 2007; 27(8): 1687 - 1693.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. A. Khorana, S. A. Ahrendt, C. K. Ryan, C. W. Francis, R. H. Hruban, Y. C. Hu, G. Hostetter, J. Harvey, and M. B. Taubman
Tissue Factor Expression, Angiogenesis, and Thrombosis in Pancreatic Cancer
Clin. Cancer Res., May 15, 2007; 13(10): 2870 - 2875.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
A. Falanga and F. R. Rickles
Management of Thrombohemorrhagic Syndromes (THS) in Hematologic Malignancies
Hematology, January 1, 2007; 2007(1): 165 - 171.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Rak, J. L. Yu, J. Luyendyk, and N. Mackman
Oncogenes, Trousseau Syndrome, and Cancer-Related Changes in the Coagulome of Mice and Humans.
Cancer Res., November 15, 2006; 66(22): 10643 - 10646.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Rong, F. Hu, R. Huang, N. Mackman, J. M. Horowitz, R. L. Jensen, D. L. Durden, E. G. Van Meir, and D. J. Brat
Early Growth Response Gene-1 Regulates Hypoxia-Induced Expression of Tissue Factor in Glioblastoma Multiforme through Hypoxia-Inducible Factor-1-Independent Mechanisms.
Cancer Res., July 15, 2006; 66(14): 7067 - 7074.
[Abstract] [Full Text] [PDF]


Home page
CLIN APPL THROMB HEMOSTHome page
M. Adess, R. Eisner, S. Nand, J. Godwin, H. L. Messmore Jr, and W. H. Wehrmacher
Thromboembolism in Cancer Patients: Pathogenesis and Treatment
Clinical and Applied Thrombosis/Hemostasis, July 1, 2006; 12(3): 254 - 266.
[Abstract] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
R. E. Tilley, B. Pedersen, R. Pawlinski, Y. Sato, J. H. Erlich, Y. Shen, S. Day, Y. Huang, D. T. Eitzman, W. A. Boisvert, et al.
Atherosclerosis in Mice Is Not Affected by a Reduction in Tissue Factor Expression
Arterioscler Thromb Vasc Biol, March 1, 2006; 26(3): 555 - 562.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
A. Y. Y. Lee
Thrombosis and Cancer: The Role of Screening for Occult Cancer and Recognizing the Underlying Biological Mechanisms
Hematology, January 1, 2006; 2006(1): 438 - 443.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
N. Mackman
Tissue-Specific Hemostasis in Mice
Arterioscler Thromb Vasc Biol, November 1, 2005; 25(11): 2273 - 2281.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-05-2042v1
105/4/1734    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yu, J. L.
Right arrow Articles by Rak, J. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yu, J. L.
Right arrow Articles by Rak, J. W.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Neoplasia
Right arrowRelated Article in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2005 by American Society of Hematology         Online ISSN: 1528-0020