Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 15 March 2005, Vol. 105, No. 6, pp. 2403-2409.
Prepublished online as a Blood First Edition Paper on September 23, 2004; DOI 10.1182/blood-2004-01-0025.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-01-0025v1
105/6/2403    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thiebot, H.
Right arrow Articles by Le Grand, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thiebot, H.
Right arrow Articles by Le Grand, R.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Immunobiology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

IMMUNOBIOLOGY

Impact of bone marrow hematopoiesis failure on T-cell generation during pathogenic simian immunodeficiency virus infection in macaques

Hugues Thiebot, Bruno Vaslin, Sonia Derdouch, Jean-Marc Bertho, Franck Mouthon, Stéphane Prost, Gabriel Gras, Pierre Ducouret, Dominique Dormont, and Roger Le Grand

From the Commissariat à l'Energie Atomique (CEA), Laboratoire d'Immuno-Pathologie Expérimentale, Service de Neurovirologie, Centre de Recherches du Service de Santé des Armées, Ecole Pratique des Hautes Etudes, Institut Paris-Sud sur les Cytokines, Université Paris XI, Fontenay aux Roses, France; Institut de Recherche et de Sûreté Nucléaire, Fontenay aux Roses, France; and Université de Caen, Anestésiologie expérimentale et physiologie cellulaire, Caen, France.


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Experimental infection of macaques with pathogenic strains of simian immunodeficiency virus (SIV) represents one of the most relevant animal models for studying HIV pathogenesis. In this study, we demonstrated a significant decrease in the generation of CD4+ T cells from bone marrow (BM) CD34+ progenitors in macaques infected with SIVmac251. This decrease appears to result from changes in the clonogenic potential of BM progenitors of both the myeloid and lymphoid lineages. We also demonstrated a significant decrease in the numbers of the most immature long-term culture-initiating cells (LTC-ICs). Hematopoietic failure occurred as early as primary infection, in the absence of CD34+ BM cell infection and was not related to plasma viral load. No major change was observed in the phenotype of BM CD34+ cells from infected macaques, including apoptosis markers such as annexin V staining and BcL-2 expression, but a significantly higher that normal proportion of cells were in the G0/G1 phase. This is the first demonstration that failure of BM hematopoiesis results in impaired T-cell production, which may contribute to the disruption of T-lymphocyte homeostasis characteristic of pathogenic lentiviral infections in primates.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
HIV type 1 (HIV-1) infection typically involves a progressive loss of blood CD4+ T lymphocytes, associated with functional T-cell abnormalities and immunodeficiency. There may be several reasons for the decrease in CD4+ T-cell counts, including direct and indirect virus-mediated cell destruction and defective homeostasis.1,2 The half-life of peripheral blood T cells, which is approximately 82 days in healthy individuals, is more than 50 days shorter in HIV-infected patients3 and T-cell numbers appear to be maintained at high levels principally by an increase in the production of CD8+ T cells.

Different mechanisms have been proposed for explaining defective production of T lymphocytes, including deregulated thymus activity, infection, and depletion of immature thymocytes expressing CD4 and alteration of early progenitors including at the level of bone marrow (BM) CD34+ precursors. To our knowledge, this last point has never been clearly addressed and was therefore the purpose of our work.

Defective de novo production of T lymphocytes by the thymus may make a significant contribution to CD4+ T-cell lymphopenia. In HIV infection, a low proportion of recent thymic emigrants, with episomal DNA formed by rearrangement of the T-cell receptor genes (TREC),4 is correlated with disease progression, although the value of quantitative TREC measurement in HIV-seropositive patients remains unclear.5,6 Highly active antiretroviral therapy (HAART) helps to increase the number of CD4+ T cells in the periphery, probably due to both the expansion and redistribution of cell populations present in lymphoid tissues and the de novo generation of T lymphocytes by the thymus.7-9 T-cell counts are restored to high levels in a biphasic manner following the initiation of HAART. There is an initial rapid increase in the numbers of CD4+ and CD8+ T cells of the memory phenotype (CD45RO+), and then the proportion of naive T cells (CD45RA+CD62L+) increases.7 Changes in thymus volume and an increase in TREC levels in the periphery10 also provide evidence that successful HAART increases thymus activity.11 However, CD4+ T-cell counts remain below normal values in treated patients, suggesting that thymic production is not completely restored and is not necessarily associated with an increase in lymphocyte half-life3 and the complete restoration of efficient antiviral immunity.

Changes in thymus function in patients infected with HIV-1 result directly from degeneration of the stroma, infection of immature thymocytes, and dysregulation of thymocyte/stromal cell interactions.12-14 Decreases in the pool of early progenitor stem cells, including the most primitive CD34+ hematopoietic BM cells, may also limit T-cell regeneration.15,16 Indeed hematologic abnormalities are frequently observed during HIV infection and BM dysfunction probably contributes to the observed cytopenia.17 Intercurrent infections, antiviral drugs,18 and the antibiotics commonly used in patients with AIDS may all affect the production of blood cells. However, although hematopoietic cells do not seem to undergo direct infection with HIV, they may be directly damaged due to the inhibitory effect of HIV-related proteins19 or proinflammatory cytokines and chemokines, the production of which is dysregulated in response to HIV infection.20-22 It remains unclear whether BM failure in infected individuals affects T-cell lymphopoiesis. However, a few studies have provided evidence supporting this hypothesis. (1) In severe combined immunodeficiency (SCID) mice with human tissue grafts, HIV-1 infection interrupts multilineage hematopoiesis, resulting in the depletion of early hematopoietic progenitors even though these cells are not infected.15,23-25 (2) Decreases in the capacity of adult peripheral blood CD34+ progenitors from patients with HIV to develop T cells have been observed in murine fetal thymus organ culture (FTOC) assays.26

Macaques infected with pathogenic strains of simian immunodeficiency virus (SIV) or related chimeras expressing the envelope of HIV-1 (SHIV), constitute a powerful model for studies of the fundamental mechanisms of HIV pathogenesis. Indeed, SIV/SHIV and HIV have similar biologic properties and the infection of macaques with pathogenic SIV/SHIV isolates reproducibly induces an immunodeficiency strikingly similar to that observed in human AIDS.27 As in HIV-seropositive patients, hematologic disorders are commonly observed in macaques infected with SIV28,29 and T-lymphocyte turnover also appears to be rapid.30 Virus DNA is detected in the thymus and significant changes in this tissue are observed during primary infection.31,32 Finally, CD3-CD4+CD8- intermediate single-positive (ISP) thymocytes were found to be functionally impaired in murine FTOC assays after in vivo infection with SIVmac251.33 We and others demonstrated that BM hematopoiesis is severely damaged in primate models of AIDS.28,34 In the work presented here, we try to address in SIVmac251-infected macaques the relationship between alteration of early BM progenitors and de novo production of T cells.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Animals and virus

Adult male cynomolgus macaques (Macaca fascicularis) weighing 3.5 to 6 kg were imported from Mauritius and housed in single cages within level 3 biosafety facilities, in accordance with national guidelines. Animals were handled under ketamine chlorohydrate anesthesia (Rhone-Mérieux, Lyon, France). All experimental procedures were conducted in accordance with European guidelines for animal care (Journal Officiel des Communautés Européennes, L358, 18 décembre 1986). The pathogenic SIVmac251 was kindly provided by Dr A. M. Aubertin (Laboratoire de Virologie, Université Louis Pasteur, Strasbourg, France). The virus was isolated from macaque peripheral blood mononuclear cells (PBMCs) cocultured with a spleen homogenate from a rhesus macaque infected with SIVmac251 (provided by Dr R. C. Desrosiers, New England Regional Primate Center, Southborough, MA). The cell-free stock was obtained by a second passage of the isolate in macaque PBMCs. The in vivo titer of the resulting stock after intravenous inoculation was 40 000 AID50 (50% animal infectious dose) per milliliter. We injected 50 AID50 into the saphenous vein of the monkeys.

Culture of BM hematopoietic myeloid cells

BM mononuclear cells were obtained from the iliac crest by aspiration and isolated by standard Ficoll density-gradient centrifugation (MSL, Eurobio, Les Ulis, France). Cells were washed once in 3% fetal calf serum (FCS; Boehringer-Mannheim, Mannheim, Germany) in phosphate-buffered saline (PBS) and resuspended in PBS for subsequent staining. T cells were eliminated by an immunomagnetic sorting system (MACS; Miltenyi Biotec, Paris, France) according to the manufacturer's instructions, using anti-CD2 (clone MT910; Dako, Trappes, France) and anti-CD3{epsilon} (clone SP34; BD PharMingen, San Diego, CA) monoclonal antibodies (mAbs). The resulting fraction, depleted of CD3+ and CD2+ cells, was washed twice in Dulbecco modified Eagle medium (DMEM) Glutamax supplemented with 10% FCS (Roche, Meylan, France) and 1% commercial antibiotic solution (penicillin-streptomycin-neomycin sulfate [PSN]; Gibco, Courbevoie, France). The fraction was then enriched in CD34+ cells by positive immunomagnetic selection (Dynal, Compiègne, France), using an anti-CD34 mAb (clone 563, BD PharMingen), accordingly to the manufacturer's instructions.

CD34+ mononuclear BM cells (5 x 104) were then suspended in 1 mL Methocult HF4434 medium (StemCell Technologies, Meylan, France) in 35-mm Petri dishes. Cells were incubated at 37°C for 14 days and scored by examination under an inverted microscope for granulocyte-macrophage colony-forming units (GM-CFUs), granulocyte colony-forming units (G-CFUs), macrophage colony-forming units (M-CFUs), and erythrocyte burst-forming units (BFU-Es).

Long-term culture-initiating cells (LTC-ICs) were obtained as follows. Feeder MS-5 stromal cells were cultured in 96-well plates at a density of 6 x 103 cells/well, in 100 µL long-term culture medium per well (Myelocult GF4434; StemCell Technologies) to which 10-6 M hydrocortisone hemisuccinate (StemCell Technologies) had been added. MS-5 cultures were incubated for 24 hours at 37°C under an atmosphere containing 5% CO2 and were then placed in coculture with CD34+ BM cells. A limiting-dilution coculture method was used; CD34+ cells were added to MS-5 cultures, with 200, 100, 50, or 20 cells/well added to 20 wells for each dilution point. Cocultures were initiated in long-term Myelocult H5100 medium (StemCell Technologies) supplemented with 10-6 M hydrocortisone hemisuccinate. We replaced half the medium each week and cultures were maintained for 5 weeks. The entire content of each well was treated with trypsin (Eurobio) for 5 minutes and then plated in 1 mL Methocult GF4434 medium in 35-mm Petri dishes. Cells were incubated at 37°C in an atmosphere containing 5% CO2 for 14 days and for the number of CFUs present was then determined under an inverted microscope.

Coculture of thymic stromal cells and purified CD34+ progenitors

Human thymus was obtained from newborns aged 2 to 15 days who had undergone cardiac surgery; thymic cells were isolated as previously described.35 Briefly, the thymus was ground into small fragments and subjected to 8 rounds of digestion as follows: 45 minutes at 37°C with gentle shaking, in serum-free DMEM (Gibco) supplemented with 500 µg/mL collagenase (Sigma Chemicals, St Louis, MO) and 1 µg/mL DNAse (Sigma Chemicals). During the first 4 rounds of digestion, the thymic cells were nonadherent. The last 4 digestion mixtures were enriched in adherent stromal cells. These cells were washed 3 times in DMEM Glutamax (Gibco) supplemented with 10% FCS (Roche), and 1% commercial antibiotic solution (PSN; Gibco). After digestion, each thymus provided approximately 0.3 x 108 to 1 x 109 cells, which were stored frozen at -135°C in 10% dimethyl sulfoxide FCS (Roche).

For culture experiments, cryopreserved stromal cells were thawed and washed in DMEM Glutamax medium (Gibco) supplemented with 10% FCS (Roche) and 1% PSN (Gibco). Viable cells were purified by Ficoll density-gradient centrifugation (MSL2000; Eurobio). Selective depletions were performed to eliminate contaminating thymic progenitors, together with immature and mature thymocytes. CD34+ cells were removed with immunomagnetic beads (Dynal) coupled to the 563-A2 mAb (Dynal); thymocytes were then removed with anti-CD7 (BD PharMingen), anti-CD3{epsilon} (clone SP34; BD PharMingen), and anti-CD3 (clone FN18; Biosource, Montrouge, France) mAbs and a commercial immunosorting system (MACS; Miltenyi Biotec). The negative fraction, depleted of CD34+, CD7+, and CD3+ cells, was resuspended at a concentration of 2.5 x 106 cells/mL in 100 µL DMEM Glutamax (Gibco) supplemented with 10% FCS (Roche) and 1% PSN (Roche), and cultured at 37°C in 96-well plates (Becton Dickinson, Erembodegem, Belgium) in a humidified atmosphere containing 5% CO2. On day 1, culture wells were washed with complete medium to remove nonadherent cells. On day 2, the culture medium was replaced with fresh medium supplemented with 5 µg/mL mycophenolic acid (MPA; Sigma Chemicals). MPA was maintained in the medium for 4 days to eliminate residual proliferating progenitors and thymocytes, as previously described.36 A confluent monolayer of thymic stromal cells was obtained after 8 to 10 days of culture. This cell monolayer was then used to study the differentiation of exogenous simian CD34+ progenitors into T cells. We validated this culture approach by checking that differentiated thymocytes were not generated by the replication of cell populations contaminating the purified CD34+ progenitor fraction. Simian BM mononuclear cell preparations depleted of CD2+ and CD3+ and enriched in CD34+ progenitors by means of an immunomagnetic method consistently displayed a high level of purity; the mean proportion of CD34+ cells obtained in 13 independent experiments was 97.52% ± 1.23%. Thus, 2 x 105 CD34+-enriched cells were seeded in each culture well, and approximately 400 CD34- BM cells contaminated each coculture. We therefore checked that cocultures containing 400 cells/well of the CD34-CD3-CD2- fraction after BM cell purification did not generate a significant proportion of thymocytes after 16 days of culture (0.50% ± 0.30 of CD3+ cells).

For coculture assays, highly purified CD34+ simian BM cells were resuspended at a concentration of 105 cells/mL in DMEM Glutamax (Gibco) supplemented with 10% FCS (Roche), 1% PSN (Roche), and growth factors supporting lymphopoiesis: 10 ng/mL interleukin 7 (IL-7; StemCell Technologies), 10 ng/mL stem cell factor (SCF; StemCell Technologies), and 10 ng/mL Flt3-L (StemCell Technologies). We added 200 µL (2 x 104 CD34+ cells) of this suspension to each of 72 wells of a 96-well plate containing a monolayer of thymic stromal cells at confluence. The remaining 24 wells were used as controls and contained stromal cells alone. We replaced half the culture medium each week, without shaking the culture. Every 4 days, we used the contents of 2 of the wells for the phenotyping of thymocyte populations. We harvested the nonadherent and adherent cell fractions. Adherent cells were detached with a commercial dissociation solution (Sigma).

Phenotype determination and characterization of apoptotic cells

The cells harvested from the coculture were washed twice, resuspended in 100 µL 1% FCS (Roche) in PBS (Gibco, France) and then incubated for 30 minutes at 4°C with 10 µL selected mAbs for 2- or 3-color membrane staining. The following antibodies were used: phycoerythrin (PE)–conjugated anti-IgG1 (clone 679.1Mc7, Beckman Coulter, Villepente, France), fluorescein isothiocyanate (FITC)–conjugated IgG1 (clone 679.1Mc7, Beckman Coulter), or allophycocyanin (APC)–conjugated total IgG (Beckman Coulter) as isotypic controls and PE-conjugated anti-CD2 (clone MT910; Dako), PE-conjugated anti-CD3{epsilon} (clone SP34; BD PharMingen), a simian-specific PE-conjugated anti-CD3 (FN18; Biosource), APC-conjugated anti-CD4 (clone MT310; Dako), FITC-conjugated anti-CD7 (clone 563-A2; PharMingen), FITC-anti-CD8 (clone DK25; Dako), APC-conjugated anti-CD4 (clone MT310; Dako), FITC-conjugated anti-CD8 (clone DK25; Dako), FITC-conjugated anti-CD11b (clone ICRF44; BD PharMingen), PE-conjugated anti-CD14 (clone M5E2; BD PharMingen), PE-conjugated anti-CD34 (clone 563-A2; BD PharMingen), FITC-conjugated anti-CD38 (clone OKT10; Ortho Diagnostic Systems, Raritan, NJ), FITC-conjugated anti-CD90 (Beckman Coulter, Hialeah, FL), anti-CD1a (MT102 clone; BD PharMingen), anti–HLA-DR (G46-6 clone; BD PharMingen), anti-CXCR4 (12G5 clone; BD PharMingen), and anti-CCR5 (3A9 clone; BD PharMingen). Cells were washed twice and fixed in CellFix solution (Becton Dickinson) for 3 days before analysis in a Becton Dickinson fluorescence-activated cell sorting (FACS) apparatus (Becton Dickinson), with CellQuest software (Becton Dickinson).

Bcl-2 expression was studied by flow cytometry. CD34+ cells were fixed and permeabilized, using a commercial assay (Ortho Permeafix; Ortho Diagnostic Systems). Permeabilized cells were stained with a monoclonal FITC-conjugated anti–Bcl-2 antibody (clone 124; Dako Diagnostic, Zug, Switzerland). Annexin V conjugated to FITC and propidium iodide (PI)–conjugated PE (Annexin-V Kit, BD PharMingen) were used to quantify apoptotic CD34+ cells. A commercial PI-based assay (0.1% Triton X-100, 50 µg/mL PI; Sigma) was used for cell cycle analysis by flow cytometry (LSR; Becton Dickinson), using CellQuest Software (Becton Dickinson).

Detection of viral DNA in mononuclear cells

We extracted cellular DNA with the High Pure PCR Template Preparation Kit according to the manufacturer's instructions (Boehringer Mannheim). DNA was quantified by measuring optical density (Pharmacia Biotech, Science Park, Cambridge, United Kingdom). This method involved carrying out a primary polymerase chain reaction (PCR) amplification with primers specific for the gag gene (1386N 5': GAAACTATGCCAAAAACAAGT and 2129 5': TAATCTAGCCTTCTGTCCTGG). We used an automated thermocycler (Crocodile III, Appligene, Illkirch, France) and the following conditions: 3 minutes at 94°C, followed by 40 cycles of 45 seconds at 94°C, 2 minutes at 56°C and 1 minute 30 seconds at 72°C, and a final heating at 72°C for 10 minutes. The reaction mixture consisted of 1 µg test DNA, 1 U Taq polymerase (Appligene), 10 µl Taq polymerase buffer (10 mM Tris [tris(hydroxymethyl)aminomethane)–HCl, pH 8.3, 1.5 mM MgCl2, 50 mM KCl, 0.1% Triton X-100), 5 mM deoxyribonucleotides (dNTPs), and 30 pmol of each primer in a total volume of 100 µL. A second, nested PCR amplification was performed with 3 µL amplimer inner primers 1731N5': CCGTCAGGATCAGATATTGCAGGAA and 2042C; 3': CACTAGCTGCAATCTGGGTT, in the following conditions: denaturation for 3 minutes at 94°C, followed by 25 cycles of denaturation for 45 seconds at 94°C, annealing for 1 minute 30 seconds at 56°C and extension for 1 minute at 72°C, and a final heating at 72°C for 10 minutes. The PCR products were visualized by electrophoresis in a 1.5% agarose gel containing ethidium bromide. The complete PCR was run on limiting dilutions of the initial stock of DNA. Copy numbers were determined by comparison with a standard stock of DNA from CEMX174 cells containing a known number of copies of the integrated SIVmac251 DNA. The sensitivity of the method was estimated at one copy of viral DNA in 105 cells.

Plasma viral load

Plasma viral load was determined as we previously described.34 Briefly, viral RNA was extracted with a kit (High Pure Viral RNA Kit; Roche, Mannheim, Germany) from 200 µL plasma collected into EDTA (ethylenediaminetetraacetic acid), according to the manufacturer's instructions. The extracted RNA was stored frozen at -80°C. We subjected 10 µL of the extracted material to reverse transcription (RT) and PCR for amplification of a region of gag. The reaction mixture contained 25 IU MuLv reverse transcriptase, 0.2 mM each of deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), 0.19 mM dTTP, 0.01 mM digoxigenin-11-deoxyuridine triphosphate (dUTP) (PCR DIG labeling mix; Roche), 2 IU ribonuclease inhibitor (RNasin, Promega, Madison, WI), 0.5 IU Taq DNA polymerase (Roche), 20 nM of each primer (5'-GTGCTGTTGGTCTACTTGTTTTTG-3' and 5'-ATGTAGTATGGGCAAACGAAT-3'), with H2O making the final volume up to 50 µL. Amplification was performed in a Crocodile III thermocycler (Appligene): 42°C for 25 minutes, 94°C for 5 minute, 35 cycles of 94°C for 35 seconds, 60°C for 45 seconds and 72°C for 1 minute, then 5 minutes at 60°C, and a final 5 minutes at 72°C.

We used 10 µL of the amplification product for quantification by anti-DIG enzyme-linked immunosorbent assay (PCR ELISA DIG detection; Roche) according to the manufacturer's instructions, using the following probe, at a concentration of 20 nM: 5'-CATTTGGATTAGCAGAAAGCCTGTTGGAGAACAAAGAAGGATGTCAA-3'. Samples were tested in duplicate and two 10-fold dilutions were tested for each sample. Positive controls consisted of a plasma sample previously quantified by 2 different approaches (RT-PCR and bDNA; Bayer, Mannheim, Germany). In the standard was a culture supernatant containing free SIVmac251 that had been aliquoted and mixed with negative EDTA-plasma from macaques. Plasma virus concentration was estimated by 2 different approaches (quantitative RT-PCR with limiting dilutions and the bDNA assay; Bayer).

Statistical analysis

Paired and unpaired comparisons were made, using the nonparametric Wilcoxon rank test and the Mann-Whitney test, respectively, both of which are suitable for the analysis of small samples. Correlations were analyzed with the Spearman rank correlation test. All statistical analyses were carried out with StatView software (SAS Institute, Cary, NC).


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Defective de novo generation of CD4+ T cells from CD34+ BM progenitors from SIV-infected macaques

We demonstrate here, for the first time, that the clonogenic potential of BM hematopoietic progenitors to develop into mature CD4+ T lymphocytes is affected during lentiviral infection in primates. We developed an in vitro model of thymocyte differentiation from fractions of cynomolgus macaque BM enriched in CD34+ cells cocultured with thymic stromal cells of human origin. This system can be used for the qualitative and quantitative follow-up of thymocyte differentiation in vitro, which is more difficult to achieve with organ culture-based techniques. In our study, cultures of progenitors from healthy, uninfected macaques (Figure 1A) generated few double-positive CD4+CD8+ cells (0.53% ± 0.26%). However, significant numbers of CD3+ and CD3+CD4+CD8- T lymphocytes were obtained (40.64% ± 6.99% and 31.46% ± 3.56%, respectively) at the end of the coculture period (Figure 1A-Bii). Concomitantly, seeded BM CD34+ cells (Figure 1Bi) rapidly disappeared and were only barely detectable after day 16 (mean ± SD: 5.31% ± 0.81% to 0.66% ± 0.83%). These results are consistent with previously reported data obtained in similar culture systems.37 We compared the differentiation patterns of BM CD34+ cells obtained from 6 uninfected macaques with those obtained from 8 SIVmac251-infected macaques. As expected, SIV infection in these animals resulted in significant lymphopenia (1482 ± 662 cells/µL versus 3281 ± 845 before infection; P = .0003) and a decrease in the number of circulating CD4+ T lymphocytes (197 ± 158 cells/µL versus 564 ± 299 before infection; P = .0013) as early as 4 months after infection.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 1.. Changes in thymocyte populations in cocultures of CD34+ simian BM cells from healthy and uninfected macaques and human thymic stromal cells. (A) Flow cytometry diagrams of a representative coculture for CD34 or CD4 and CD8 expression. On day 0 of coculture, 2 x 104 purified BM CD34+ cells were seeded on a stromal monolayer. At each time point, all of the cells present in the culture well were used for flow cytometry. (Bi) Changes in CD34+ ({bullet}), CD34+CD7+ ({square}), or CD3+CD4+CD8+ ({circ}) populations in 4 independent experiments using BM CD34+ cells obtained from 4 different cynomolgus macaques. (ii) Changes in CD3+ ({circ}) or CD3+CD4+CD8- ({bullet}) in the same 4 cultures; simian BM CD34+ cells were seeded on day 0.

 

At 6 months after infection, levels of production of CD3+CD7+ cells (P = .0126) and single-positive (SP) CD3+CD4+CD8- mature thymocytes (P = .0015) were significantly lower in cultures seeded with progenitor cells from SIV-infected macaques than in those seeded with progenitor cells from uninfected macaques (Figure 2A). This decrease in lymphocyte production was associated with a slower decrease in the number of CD34+ cells in culture (P = .014), which may be attributed to a significant delay in BM progenitor differentiation. Indeed, after 1 week of coculture, larger than normal numbers of undifferentiated CD34+CD7+ cells (P = .0209), which have been considered to be potential T-cell precursors,35 mature CD34+CD38+ progenitors (P = .0209) or the most immature BM CD34+CD90+ (P = 0.0357) cells persisted in cocultures seeded with BM CD34+ cells from SIV-infected macaques (Figure 2B). Although the decrease in SP CD4+ T-cell production was associated with the infection of macaques, no correlation was found with plasma viral load (294 195 ± 586 415 copies of viral RNA/mL; P = .82) or cell-associated viral load (1344 ± 1994 copies of viral DNA/106 PBMCs; P = .13).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 2.. Generation of T cells from BM CD34+ cells obtained from SIV-infected macaques. (A) Differentiation of simian CD34+ BM after 16 days of coculture with human thymic stromal cells; {circ}, mean value (± SD) of cells from 6 uninfected cynomolgus macaques; {bullet}, mean values (± SD) of cells of 8 macaques infected with the primary SIVmac251 isolate. BM cells were obtained 6 months after infection. (B) Proportion of BM progenitors of various phenotypes after 8 days of coculture with human thymic stromal cells; {square}, mean ± SD of cells from 6 uninfected cynomolgus macaques; {blacksquare}, mean ± SD of cells of 8 cynomolgus macaques infected with SIV-mac251, 6 months after intravenous inoculation. (C) Changes in the T-cell differentiation potential of CD34+ BM cells obtained from 3 cynomolgus macaques (mean ± SD) at various time points after the infection of macaques with SIVmac251.

 

In 3 of these animals, we characterized the T-cell differentiation potential of BM CD34+ cells at various time points after infection. Decreases in CD4+ T-lymphocyte production were demonstrated as early as 3 weeks after the intravenous infection of macaques with pathogenic SIVmac251. At 6 months after infection, the production of CD3+CD4+CD8- T cells had decreased by 43% (Figure 2C). This decrease in the production of T lymphocytes was not associated with the infection of early progenitors. Indeed, viral DNA was not detected by PCR in highly purified BM CD34+ cells obtained from SIV-infected macaques (data not shown). However, despite the absence of detectable infection in purified CD34+ cells seeded in the cocultures, we also checked that SIV gag-nested PCR performed on DNA extracted from cultured cells at the end of the culture period was negative (data not shown). We were therefore unable to attribute the decrease in lymphocyte numbers to an increase in viral replication from a minority of contaminating infected cells.

Altered de novo T-cell generation is associated with BM hematopoiesis failure in macaques infected with SIV

We demonstrated that generation of T cells from BM precursors is affected in macaques infected with SIVmac251 and that seems to result from altered differentiation potential of CD34+ precursors. To better understand mechanisms involved, we tried to further characterized BM hematopoiesis in theses animals. The total number of CFUs had already decreased by 21 days after infection (Figure 3), and this decrease became significant 4 months after infection (P = .0048). At 6 months after infection (day 208), total CFUs were more than 40% lower than that before infection (P = .0020). This early and persistent decrease in the number of CFUs was accompanied by decrease in the numbers of GM-CFUs (59% on day 208 after infection; P = .0003) and BFU-Es (43% on day 208 after infection; P = .0052; Figure 3). However, as we previously reported in the SHIV model,38 no significant changes were observed in the number of M-CFUs (P = .7345 on day 208 after infection). In the meantime, the number of BM-derived immature cells detected by LTC-IC also decreased in all animals, by a mean of 71% with respect to preinfection values (P = .020; Figure 3). Thus, BM myelopoiesis is also affected in SIVmac251-infected macaques and, therefore, altered generation of CD4+ T cells may be related to a more general deregulation of BM hematopoiesis rather than a specific failure of lymphoid precursors.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 3.. Myeloid differentiation of CD34+ BM. Number of colonies obtained after 14 days of culture in semisolid methyl cellulose medium (mean ± SD of measures for the cultures of cells from 8 macaques). (Ai) Total number of CFUs; (ii) GM-CFUs; (iii) M-CFUs; (iv) BFU-Es. (B) LTC-ICs identified after 5 weeks of coculture with the MS-5 stromal cell line, followed by 14 days of culture in semisolid medium (mean ± SD of measures for cultures of cells from 4 macaques).

 

Phenotypic characterization of BM CD34+ cells in SIV-infected macaques

Changes in the distribution of the BM CD34+ subpopulation may account for the observed changes in hematopoiesis in SIV-infected macaques. However, in our study, the characterization of BM CD34+ cell differentiation markers expression revealed no significant difference that could be used to distinguish cells from uninfected and SIVmac251-infected monkeys (Figure 4). In particular, no difference was observed in the expression of CD4 and CXCR-4. The proportions of cells expressing HLD-DR and CD38 seemed to be slightly higher in infected monkeys. Although this difference did not reach statistical significance, this may reflect the tendency of SIV-infected macaques to accumulate mature progenitors in vivo that may be blocked during differentiation. No differences in the most immature CD34+CD90+ BM cells were observed between infected and uninfected macaques.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 4.. Phenotype and apoptosis markers of CD34+ BM cells. {square} indicates mean ± SD for 6 uninfected cynomolgus macaques; {blacksquare} indicates mean ± SD for 9 cynomolgus macaques infected with SIVmac251, 6 months after intravenous inoculation.

 

Apoptosis and cell cycle arrest at the G0/G1 stage have been suggested as possible mechanisms underlying the failure of CD34+ BM hemopoietic cells to differentiate during HIV infection.19 We therefore evaluated the level of apoptosis in BM cells from infected macaques by flow cytometry, using annexin V to stain the cell surface membrane phosphatidyl serine.39 The proportion of annexin V-binding cells was significantly lower (P = .0066) in CD34+ cells purified from the BM of SIVmac251-infected macaques than in cells from uninfected macaques (Figures 4, 5). Bcl-2 is known to increase the survival of progenitor cells.40 We therefore investigated Bcl-2 levels by immunohistochemical staining. There is a clear tendency to lower percentage of Bcl-2+ CD34+ cells or in the levels of Bcl-2 expression in BM of infected macaques although this not reach statistical significance (P = .20, P = .08 for mean fluorescence intensity, respectively; Figures 4, 5), Thus, apoptosis may play a role in the impaired differentiation of myeloid and lymphoid lineages we observed during SIV infection.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 5.. Apoptosis in CD34+ BM cells obtained from SIV infected macaques. (A) Representative flow cytometry diagrams for annexin V staining of BM CD34+ cells obtained from healthy (left panel) and SIV-infected (right panel) macaques. (B) Representative flow cytometry diagrams of intracellular BcL2 staining of BM CD34+ cells obtained from healthy (left panel) and SIV-infected (right panel) macaques. (C) Representative flow cytometry diagrams of intracellular cell cycle analysis (PI staining) of BM CD34+ cells obtained from healthy (left panel) and SIV-infected (right panel) macaques. (D) Percentages of cells in G0/G1 in healthy macaques ({square}) or SIV-infected macaques ({blacksquare}).

 

Finally, because we observed that undifferentiated cells my accumulate during differentiation of BM progenitors in T cells (Figure 2B), we investigated cell cycle in CD34+ BM cells freshly isolated from infected macaques. As previously reported for normal human hematopoietic cells exposed to HIV-1 virions or gp12019 in vitro, the proportion of cells in the G0/G1 stage was significantly higher (P = .0066) among CD34+ BM cells obtained from SIV-infected macaques (81% ± 4%) than among those obtained from uninfected macaques (67% ± 7%), as shown by PI staining (Figure 5C-D).


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
To conclude, this study demonstrates that the infection of primates with pathogenic lentiviruses such as SIVmac251 results in rapid and major changes in BM hematopoiesis that affect both myeloid and lymphoid lineages. Changes in the potential of BM cells to differentiate into cells of the lymphoid lineage may be a key element in the disruption of T-lymphocyte homeostasis typical of HIV/SIV infections.

As we and others previously reported, impaired hematopoiesis does not appear to be associated with infection of CD34+ hematopoietic cells, although we cannot exclude that a minority of early precursors are directly affected by the virus.21,23,34,38,41 We recently reported that the infection of cynomolgus macaques with a pathogenic chimeric HIV/SIV (SHIV) expressing the envelope of the 89.6 HIV-1 primary isolate (SHIV 89.6P) results in a 50% decrease in the number of colony-forming cell progenitors and a more than 70% decrease in the clonogenic potential of the most primitive BM CD34+ LTC-ICs. This reduction was not associated with BM CD34+ cell infection and was not correlated with classical parameters of infection such as plasma viremia and peripheral CD4+ T-cell counts.34 However, SHIV 89.6P is a dual tropic virus, with CXCR-4 as its principal coreceptor, and the infection of macaques with SHIV 89.6P results in an atypical pathogenic profile, with rapid and persistent depletion of circulating CD4+ T cells. This may render the study of BM hematopoiesis in this model irrelevant to the situation in humans. The infection of macaques with a primary isolate of SIVmac251 induces a pathogenic profile much more similar to that observed in human HIV-1 infection. Like primary HIV isolates and as in early infection stages, SIV uses CCR5 as the coreceptor for entry into target cells. Interestingly, in this study SIVmac251 affects BM myelopoiesis to a similar extent than we previously observed in SHIV-infected animals. The effects of lentiviral infection on macaque hematopoiesis, therefore, do not depend on the viral strain used, the acute pathogenic profile of SHIV89.6P, or the use of CXCR4 or CCR5 as a coreceptor.

The characterization of BM CD34+ cell differentiation marker expression did not reveal dramatic changes in cells from SIV-mac251-infected monkeys except a reduced expression of apoptosis marker, suggesting a role for apoptosis in the T-cell homeostasis and an increased proportion of cells in cell cycle arrest. This observation is consistent with the persistence of undifferentiated CD34+ cells we observed in thymic stromal layers seeded with BM progenitors from SIV-infected macaques. The increase in the proportion of cells in the G0/G1 phase of the cell cycle, in the absence of an increase in the expression of apoptosis markers, suggests the involvement of soluble factors, including viral proteins or cytokines (or both) released in the medullar microenvironment of infected macaques and which are known to inhibit hematopoiesis. Recombinant viral Tat protein has been reported to induce the production, in normal BM macrophages from enriched preparations, of factors inhibiting the growth of immature hematopoietic progenitors in vitro. Transforming growth factor {beta}1 (TGF-{beta}1) is thought to be the main factor responsible for this inhibition.42 This observation may have relevance to the situation in vivo because TGF-{beta}1 levels are known to be high in individuals with HIV-1 infection43 and in culture supernatants of PBMCs from HIV-infected donors.

However, other factors, the production of which is also dysregulated by HIV infection, must also be considered. The chemokine macrophage inflammatory protein 1{alpha} (MIP-1{alpha}) has been reported to inhibit erythropoiesis specifically44,45 and several of the cytokines overproduced during the course of HIV infection (IL-1, interferons [IFNs] including IFN-{alpha},46 tumor necrosis factor {alpha} [TNF-{alpha}]) may adversely affect hematopoiesis. Consistent with our observation that hematopoiesis is affected early in SIV infection, the inhibitory effect of soluble factors may occur very early on, during primary infection. Indeed, studies in primate models of AIDS have shown that the early phase of pathogenic SIV infection is associated with major inflammation, resulting in the overproduction of cytokines such as TNF-{alpha} and IFN-{alpha}.47-49

Characterization of molecular events that result in cell cycle arrest of BM hematopoietic cells and identification of factors affecting hematopoiesis in the BM microenvironment are therefore of key importance if we are to understand the pathogenesis of HIV infection and to develop therapeutic interventions that may improve the reconstitution of normal immune functions.


    Acknowledgements
 
We would like to thank B. Delache, C. Aubenque, P. Brochard, D. Couraud, V. Cordette, D. Renault, P. Pochard, J. C. Wilk, and R. Rioux for excellent technical assistance.


    Footnotes
 
Submitted January 13, 2004; accepted September 3, 2004.

Prepublished online as Blood First Edition Paper, September 23, 2004; DOI 10.1182/blood-2004-01-0025.

Supported by the Agence Nationale de Recherches sur le SIDA (ANRS), Paris, France; Centre de Recherches du Service de Santé des Armées Emile Pardé (CRSSA), La Tronche, France; and Conseil Régional de Basse Normandie, and the Commissariat à l'Energie Atomique (CEA), Fontenay aux Roses, France.

Dominique Dormont died on November 17, 2003, during the preparation of this manuscript.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Roger Le Grand, Service de Neurovirologie, Commissariat à l'Energie Atomique, DSV/DRM, 18 route du Panorama, 92265 Fontenay-aux-Roses Cedex, France; e-mail: roger.le-grand{at}cea.fr.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Ho DD, Neumann AU, Perelson AS, Chen W, Leonard JM, Markowitz M. Rapid turnover of plasma virions and CD4 lymphocytes in HIV-1 infection. Nature. 1995;373: 123-126.[CrossRef][Medline] [Order article via Infotrieve]

  2. Perelson AS, Neumann AU, Markowitz M, Leonard JM, Ho DD. HIV-1 dynamics in vivo: virion clearance rate, infected cell life-span, and viral generation time. Science. 1996;271: 1582-1586.[Abstract]

  3. Hellerstein M, Hanley MB, Cesar D, et al. Directly measured kinetics of circulating T lymphocytes in normal and HIV-1-infected humans. Nat Med. 1999;5: 83-89.[CrossRef][Medline] [Order article via Infotrieve]

  4. Kong F, Chen CH, Cooper MD. Thymic function can be accurately monitored by the level of recent T cell emigrants in the circulation. Immunity. 1998;8: 97-104.[CrossRef][Medline] [Order article via Infotrieve]

  5. Ye P, Kirschner DE. Reevaluation of T cell receptor excision circles as a measure of human recent thymic emigrants. J Immunol. 2002;168: 4968-4979.[Abstract/Free Full Text]

  6. Hazenberg MD, Otto SA, Cohen Stuart JW, et al. Increased cell division but not thymic dysfunction rapidly affects the T-cell receptor excision circle content of the naive T cell population in HIV-1 infection. Nat Med. 2000;6: 1036-1042.[CrossRef][Medline] [Order article via Infotrieve]

  7. Autran B, Carcelain G, Li TS, et al. Positive effects of combined antiretroviral therapy on CD4+ T cell homeostasis and function in advanced HIV disease. Science. 1997;277: 112-116.[Abstract/Free Full Text]

  8. Pakker NG, Notermans DW, de Boer RJ, et al. Biphasic kinetics of peripheral blood T cells after triple combination therapy in HIV-1 infection: a composite of redistribution and proliferation. Nat Med. 1998;4: 208-214.[CrossRef][Medline] [Order article via Infotrieve]

  9. Bucy RP, Hockett RD, Derdeyn CA, et al. Initial increase in blood CD4(+) lymphocytes after HIV antiretroviral therapy reflects redistribution from lymphoid tissues. J Clin Invest. 1999;103: 1391-1398.[Medline] [Order article via Infotrieve]

  10. Douek DC, McFarland RD, Keiser PH, et al. Changes in thymic function with age and during the treatment of HIV infection. Nature. 1998;396: 690-695.[CrossRef][Medline] [Order article via Infotrieve]

  11. Franco JM, Rubio A, Martinez-Moya M, et al. T-cell repopulation and thymic volume in HIV-1-infected adult patients after highly active antiretroviral therapy. Blood. 2002;99: 3702-3706.[Abstract/Free Full Text]

  12. Su L, Kaneshima H, Bonyhadi M, et al. HIV-1-induced thymocyte depletion is associated with indirect cytopathogenicity and infection of progenitor cells in vivo. Immunity. 1995;2: 25-36.[CrossRef][Medline] [Order article via Infotrieve]

  13. Schnittman SM, Denning SM, Greenhouse JJ, et al. Evidence for susceptibility of intrathymic T-cell precursors and their progeny carrying T-cell antigen receptor phenotypes TCR alpha beta + and TCR gamma delta + to human immunodeficiency virus infection: a mechanism for CD4+ (T4) lymphocyte depletion. Proc Natl Acad Sci U S A. 1990;87: 7727-7731.[Abstract/Free Full Text]

  14. Chene L, Nugeyre MT, Guillemard E, Moulian N, Barre-Sinoussi F, Israel N. Thymocyte-thymic epithelial cell interaction leads to high-level replication of human immunodeficiency virus exclusively in mature CD4(+) CD8(-) CD3(+) thymocytes: a critical role for tumor necrosis factor and interleukin-7. J Virol. 1999;73: 7533-7542.[Abstract/Free Full Text]

  15. Jenkins M, Hanley MB, Moreno MB, Wieder E, McCune JM. Human immunodeficiency virus-1 infection interrupts thymopoiesis and multilineage hematopoiesis in vivo. Blood. 1998;91: 2672-2678.[Abstract/Free Full Text]

  16. Knutsen AP, Roodman ST, Freeman JJ, Mueller KR, Bouhasin JD. Inhibition of thymopoiesis of CD34+ cell maturation by HIV-1 in an in vitro CD34+ cell and thymic epithelial organ culture model. Stem Cells. 1999;17: 327-338.[Medline] [Order article via Infotrieve]

  17. Levine AM, Scadden DT, Zaia JA, Krishnan A. Hematologic Aspects of HIV/AIDS. Hematology (Am Soc Hematol Educ Program). 2001: 463-478.

  18. Brogan KL, Zell SC. Hematologic toxicity of zidovudine in HIV-infected patients. Am Fam Physician. 1990;41: 1521-1528.[Medline] [Order article via Infotrieve]

  19. Zauli G, Vitale M, Gibellini D, Capitani S. Inhibition of purified CD34+ hematopoietic progenitor cells by human immunodeficiency virus 1 or gp120 mediated by endogenous transforming growth factor beta 1. J Exp Med. 1996;183: 99-108.[Abstract/Free Full Text]

  20. Moses A, Nelson J, Bagby G. The influence of human immunodeficiency virus-1 on hematopoiesis. Blood. 1998;91: 1479-1495.[Free Full Text]

  21. Neal TF, Holland HK, Baum CM, et al. CD34+ progenitor cells from asymptomatic patients are not a major reservoir for human immunodeficiency virus-1. Blood. 1995;86: 1749-1756.[Abstract/Free Full Text]

  22. Marandin A, Katz A, Oksenhendler E, et al. Loss of primitive hematopoietic progenitors in patients with human immunodeficiency virus infection. Blood. 1996;88: 4568-4578.[Abstract/Free Full Text]

  23. Koka PS, Jamieson BD, Brooks DG, Zack JA. Human immunodeficiency virus type 1-induced hematopoietic inhibition is independent of productive infection of progenitor cells in vivo. J Virol. 1999;73: 9089-9097.[Abstract/Free Full Text]

  24. Withers-Ward ES, Amado RG, Koka PS, et al. Transient renewal of thymopoiesis in HIV-infected human thymic implants following antiviral therapy. Nat Med. 1997;3: 1102-1109.[CrossRef][Medline] [Order article via Infotrieve]

  25. Amado RG, Jamieson BD, Cortado R, Cole SW, Zack JA. Reconstitution of human thymic implants is limited by human immunodeficiency virus breakthrough during antiretroviral therapy. J Virol. 1999;73: 6361-6369.[Abstract/Free Full Text]

  26. Clark DR, Repping S, Pakker NG, et al. T-cell progenitor function during progressive human immunodeficiency virus-1 infection and after antiretroviral therapy. Blood. 2000;96: 242-249.[Abstract/Free Full Text]

  27. Hirsch VM, Lifson JD. Simian immunodeficiency virus infection of monkeys as a model system for the study of AIDS pathogenesis, treatment, and prevention. Adv Pharmacol. 2000;49: 437-477.

  28. Hillyer CD, Lackey Dd, Villinger F, Winton EF, McClure HM, Ansari AA. CD34+ and CFU-GM progenitors are significantly decreased in SIVsmm9 infected rhesus macaques with minimal evidence of direct viral infection by polymerase chain reaction. Am J Hematol. 1993;43: 274-278.[Medline] [Order article via Infotrieve]

  29. Hillyer CD, Klumpp SA, Hall JM, Lackey DA III, Ansari AA, McClure HM. Multifactorial etiology of anemia in SIV-infected rhesus macaques: decreased BFU-E formation, serologic evidence of autoimmune hemolysis, and an exuberant erythropoietin response. J Med Primatol. 1993;22: 253-256.[Medline] [Order article via Infotrieve]

  30. Mohri H, Bonhoeffer S, Monard S, Perelson AS, Ho DD. Rapid turnover of T lymphocytes in SIV-infected rhesus macaques. Science. 1998;279: 1223-1227.[Abstract/Free Full Text]

  31. Muller JG, Krenn V, Schindler C, et al. Alterations of thymus cortical epithelium and interdigitating dendritic cells but no increase of thymocyte cell death in the early course of simian immunodeficiency virus infection. Am J Pathol. 1993;143: 699-713.[Abstract]

  32. Wykrzykowska JJ, Rosenzweig M, Veazey RS, et al. Early regeneration of thymic progenitors in rhesus macaques infected with simian immunodeficiency virus. J Exp Med. 1998;187: 1767-1778.[Abstract/Free Full Text]

  33. Neben K, Heidbreder M, Muller J, et al. Impaired thymopoietic potential of immature CD3(-)CD4(+)CD8(-) T cell precursors from SIV-infected rhesus monkeys. Int Immunol. 1999;11: 1509-1518.[Abstract/Free Full Text]

  34. Thiebot H, Louache F, Vaslin B, et al. Early and persistent bone marrow hematopoiesis defect in simian/human immunodeficiency virus-infected macaques despite efficient reduction of viremia by highly active antiretroviral therapy during primary infection. J Virol. 2001;75: 11594-11602.[Abstract/Free Full Text]

  35. Tjonnfjord GE, Veiby OP, Steen R, Egeland T. T lymphocyte differentiation in vitro from adult human prethymic CD34+ bone marrow cells. J Exp Med. 1993;177: 1531-1539.[Abstract/Free Full Text]

  36. Dorshkind K, Johnson A, Collins L, Keller GM, Phillips RA. Generation of purified stromal cell cultures that support lymphoid and myeloid precursors. J Immunol Methods. 1986;89: 37-47.[CrossRef][Medline] [Order article via Infotrieve]

  37. Rosenzweig M, Marks DF, Hempel D, Johnson RP. In vitro T lymphopoiesis: a model system for stem cell gene therapy for AIDS. J Med Primatol. 1996;25: 192-200.[Medline] [Order article via Infotrieve]

  38. Davis BR, Schwartz DH, Marx JC, et al. Absent or rare human immunodeficiency virus infection of bone marrow stem/progenitor cells in vivo. J Virol. 1991;65: 1985-1990.[Abstract/Free Full Text]

  39. Shounan Y, Feng X, O'Connell PJ. Apoptosis detection by annexin V binding: a novel method for the quantitation of cell-mediated cytotoxicity. J Immunol Methods. 1998;217: 61-70.[CrossRef][Medline] [Order article via Infotrieve]

  40. Ogilvy S, Metcalf D, Print CG, Bath ML, Harris AW, Adams JM. Constitutive Bcl-2 expression throughout the hematopoietic compartment affects multiple lineages and enhances progenitor cell survival. Proc Natl Acad Sci U S A. 1999;96: 14943-14948.[Abstract/Free Full Text]

  41. von Laer D, Hufert FT, Fenner TE, et al. CD34+ hematopoietic progenitor cells are not a major reservoir of the human immunodeficiency virus. Blood. 1990;76: 1281-1286.[Abstract/Free Full Text]

  42. Zauli G, Davis BR, Re MC, Visani G, Furlini G, La Placa M. tat protein stimulates production of transforming growth factor-beta 1 by marrow macrophages: a potential mechanism for human immunodeficiency virus-1-induced hematopoietic suppression. Blood. 1992;80: 3036-3043.[Abstract/Free Full Text]

  43. Navikas V, Link J, Wahren B, Persson C, Link H. Increased levels of interferon-gamma (IFN-gamma), IL-4 and transforming growth factor-beta (TGF-beta) mRNA expressing blood mononuclear cells in human HIV infection. Clin Exp Immunol. 1994;96: 59-63.[Medline] [Order article via Infotrieve]

  44. Broxmeyer HE, Sherry B, Cooper S, et al. Comparative analysis of the human macrophage inflammatory protein family of cytokines (chemokines) on proliferation of human myeloid progenitor cells. Interacting effects involving suppression, synergistic suppression, and blocking of suppression. J Immunol. 1993;150: 3448-3458.[Abstract]

  45. Lu L, Xiao M, Grigsby S, et al. Comparative effects of suppressive cytokines on isolated single CD34(3+) stem/progenitor cells from human bone marrow and umbilical cord blood plated with and without serum. Exp Hematol. 1993;21: 1442-1446.[Medline] [Order article via Infotrieve]

  46. Ganser A, Carlo-Stella C, Greher J, Volkers B, Hoelzer D. Effect of recombinant interferons alpha and gamma on human bone marrow-derived megakaryocytic progenitor cells. Blood. 1987;70: 1173-1179.[Abstract/Free Full Text]

  47. Cheret A, Caufour P, Le Grand R, et al. Macrophage inflammatory protein-1 alpha mRNA expression in mononuclear cells from different tissues during acute simian immunodeficiency virus strain mac251 infection of macaques. AIDS. 1997;11: 257-258.[Medline] [Order article via Infotrieve]

  48. Cheret A, Le Grand R, Caufour P, et al. Chemoattractant factors (IP-10, MIP-1alpha, IL-16) mRNA expression in mononuclear cells from different tissues during acute SIVmac251 infection of macaques. J Med Primatol. 1997;26: 19-26.[Medline] [Order article via Infotrieve]

  49. Khatissian E, Tovey MG, Cumont MC, et al. The relationship between the interferon alpha response and viral burden in primary SIV infection. AIDS Res Hum Retroviruses. 1996;12: 1273-1278.[Medline] [Order article via Infotrieve]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Virol.Home page
O. M. Diop, M. J.-Y. Ploquin, L. Mortara, A. Faye, B. Jacquelin, D. Kunkel, P. Lebon, C. Butor, A. Hosmalin, F. Barre-Sinoussi, et al.
Plasmacytoid Dendritic Cell Dynamics and Alpha Interferon Production during Simian Immunodeficiency Virus Infection with a Nonpathogenic Outcome
J. Virol., June 1, 2008; 82(11): 5145 - 5152.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Muthukumar, D. Zhou, M. Paiardini, A. P. Barry, K. S. Cole, H. M. McClure, S. I. Staprans, G. Silvestri, and D. L. Sodora
Timely triggering of homeostatic mechanisms involved in the regulation of T-cell levels in SIVsm-infected sooty mangabeys
Blood, December 1, 2005; 106(12): 3839 - 3845.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-01-0025v1
105/6/2403    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thiebot, H.
Right arrow Articles by Le Grand, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thiebot, H.
Right arrow Articles by Le Grand, R.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Immunobiology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2005 by American Society of Hematology         Online ISSN: 1528-0020