|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, 1 May 2005, Vol. 105, No. 9, pp. 3686-3690. Prepublished online as a Blood First Edition Paper on December 30, 2004; DOI 10.1182/blood-2004-09-3782.
NEOPLASIA The promyelocytic leukemia protein PML regulates c-Jun function in response to DNA damageFrom the Cancer Biology and Genetics Program, Department of Pathology, Sloan-Kettering Institute, Weill Graduate School of Medical Sciences, Cornell University, New York, NY.
The promyelocytic leukemia (PML) gene, a tumor suppressor inactivated in acute promyelocytic leukemia (APL), regulates apoptosis induced by DNA damage. However, the molecular mechanisms by which PML modulates apoptosis following genotoxic stress are only partially elucidated. PML is essential for p53-dependent induction of programmed cell death upon  -irradiation through PML-nuclear body (NB)–mediated control of p53 acetylation. Here, we show that PML selectively regulates proapoptotic transcription factors upon different types of DNA damage. We find that Pml inactivation protects fibroblasts from UV-induced apoptosis in a p53-independent manner. We demonstrate that c-Jun is required for UV-induced apoptosis and that PML is essential for both c-Jun transcriptional activation and DNA binding upon UV radiation. We find that PML physically interacts with c-Jun and that upon UV radiation the PML-NBs reorganize into novel nuclear microspeckled structures (UV-NBs), where PML and c-Jun dynamically accumulate. These data identify a novel PML-dependent pathway for c-Jun transcriptional activation and induction of apoptosis in response to DNA damage and shed new light on the role of PML in tumor suppression.
The promyelocytic leukemia (Pml) gene encodes a tumor suppressor involved in the t(15:17) chromosomal translocation associated with acute promyelocytic leukemia (APL).1-5 PML is a Really Interesting New Gene (RING) finger protein found localized in subnuclear structures known as PML-nuclear bodies (PML-NBs), which have been implicated in transcriptional regulation.6,7 PML is essential for the proper formation and stability of these subnuclear structures, since in Pml-/- primary cells the PML-NBs are disrupted and their components acquire an aberrant nuclear localization pattern.7-9 Upon cellular stresses such as -irradiation and acute oncogene exposure, PML acts as a p53 transcriptional coactivator, at least in part through the recruitment of p53 into the PML-NB and its consequent CREB (cAMP [cyclic adenosine monophosphate] response element-binding protein)–binding protein (CBP)–mediated acetylation.5,10,11 As a consequence, Pml-/- thymocytes are resistant to -ray–induced apoptosis.10 Remarkably, Pml-/- mice and cells are also protected from several p53-independent apoptotic stimuli, although the molecular mechanisms underlying the role of PML in these pathways are currently unknown.12 The apoptotic response to short wavelength ultraviolet (UV) light is not mediated by p53 in primary fibroblasts, since both p53 and p21 null primary fibroblasts are more sensitive to UV-induced apoptosis.13-17 By contrast, primary embryonic fibroblasts devoid of c-Jun-N-terminal kinases (JNKs), the upstream activators of c-Jun, are resistant to UV-induced apoptosis.18 Phosphorylation of c-Jun was shown to be required for UV-triggered apoptosis.19 Nevertheless, the role of c-Jun in UV-induced cell death is still controversial and a matter of debate, because of conflicting reports.19-21 In this study, we demonstrate that c-Jun regulates UV-induced apoptosis in primary cells, and that PML controls c-Jun function specifically in response to UV irradiation. Remarkably, upon UV radiation, PML redistributes to multiple microspeckles where it colocalizes with c-Jun. On the contrary, in unirradiated cells, PML and c-Jun do not colocalize in the PML-NB, and this correlates with the inability of PML to regulate c-Jun function in the absence of cellular stress.
Apoptosis analysis
Mouse embryo fibroblasts (MEFs) were fixed in acetone-methanol (1:4) and stained with propidium iodide (10 µg/mL). Subdiploid peak analysis was performed to evaluate the percentage of apoptotic cells. Alternatively, cell death was evaluated by trypan blue uptake. Mitochondrial transmembrane potential ( Western blotting and immunoprecipitation MEFs were lysed in buffer A (50 mM Tris (tris(hydroxymethyl)aminomethane), pH 7.6, 200 mM NaCl, 1 mM EDTA (ethylenediaminetetraacetic acid),10 mM MgCl2, 10 mM MnCl2, 1% Triton-X100, 50 mM NaF, 0.5 mM Na3VO4, 1 mM phenylmethylsulfonyl fluoride, and 10 µg/mL leupeptin, aprotinin, and pepstatin). Antibodies used were anti–c-Jun-Ser 63 or -Ser 73 (Cell Signaling Technology, Beverly, MA), anti–c-Jun (BD Transduction Laboratories, San Diego, CA), anti-actin (Sigma, St Louis, MO), anti-HSP90 (BD Transduction Laboratories), p53 (Oncogene Science, Cambridge, MA), p53 Ser 18 (Cell Signaling Technology), p21 (Santa Cruz Biotechnology, Santa Cruz, CA), Bax (Santa Cruz), and HSP90 (Transduction Laboratories). For immunoprecipitation, WI-38 cells were lysed in 10 mM Tris, pH 7.6, 150 mM NaCl, 0.2% Triton-X100, 1 mM EDTA, 50 mM NaF, 0.5 mM Na3VO4, 1 mM phenylmethylsulfonyl fluoride (PMSF) and 10 µg/mL leupeptin, aprotinin, and pepstatin. PML was immunoprecipitated by using anti–human PML (Santa Cruz Biotechnology). Purified glutathione S transferase (GST)–c-Jun was incubated with in vitro–translated 35S-PML and -PML mutants in binding buffer (20 mM Tris, pH 7.6, 150 mM NaCl, 1 mM EDTA, 1 mM DTT [dithiothreitol], 1 mM PMSF, 0.2% NP-40 [(Octylphenoxy)polyethoxyethanol]) for 1 hour. Beads were washed 5 times in binding buffer containing 200 mM NaCl. Cell infection Pml+/+ and Pml-/- MEFs were infected with high-titer pBabe or pBabe–c-Jun retroviral supernatants and selected in puromycin (Sigma) for 48 hours. Cells were then replated and UV-irradiated (60 J/m2). Transcriptional assay
MEFs were transfected by using Effectene (Qiagen, Valencia, CA). The following plasmids were used: galactosidase-4 (GAL4)–c-Jun and S63A/S73A GAL4–c-Jun (GAL4–c-JunAA) (kind gifts of Dr L. Zon, Harvard University), GAL4-Luc (Promega, Madison, WI), jun2CRE-Luc (4 jun2 CRE [cAMP-responsive element] elements from the c-jun promoter cloned upstream the SV40 [simian virus 40] minimal promoter), collTRE-Luc (5 TRE [12-O-tetradecanoyl-phorbol-13-acetate (TPA)–responsive element] elements from the collagenase promoter cloned upstream the SV40 minimal promoter), thymidine kinase (TK)–Renilla-Luc (Promega), pSG5 (Stratagene, La Jolla, CA), pSG5-PML3 and pSG5-PML-RAR Gel shift and chromatin immunoprecipitation Nuclear extracts from UV-treated MEFs were incubated with either 32P-labeled jun2 CRE element-like (AGCTCCCGTGACGTCACCCG) for 20 minutes at room temperature. For supershift analysis, extracts were preincubated with antibodies against c-Jun (Santa Cruz) or activating transcription factor-2 (ATF-2; Santa Cruz) for 30 minutes on ice before adding the labeled probe. DNA-protein complexes were resolved on a 4% polyacrilamide gel and exposed. For chromatin immunoprecipitation, we processed cells as previously described.22 After O/N immunoprecipitation, DNA-protein complexes were analyzed by polymerase chain reaction ATGTAAGCATGTTTACCTTC and CATGGTGCCCAGCAGTCC (collagenase TRE 5' and 3' primers, respectively), ACAAGCCGAAGCTGCGCGC and TTGGCTTGCGTCGTTCTCAG (c-jun jun2 5' and 3' primers, respectively), and AGCCTTCGCGGGCCCAG and CAACTCTGAGTCCTTATCCA (c-jun jun1 5' and 3' primers, respectively). Immunofluorescence and confocal microscopy Briefly, WI-38 cells or MEFs grown on glass coverslips were fixed and permeabilized. Cells were then incubated with combinations of the following antibodies: mouse anti–human PML (Santa Cruz), rabbit anti–mouse Pml (kind gift of Dr Freemont, Imperial College, London, United Kingdom), anti–small ubiquitin-related modifier 1 (SUMO1; Santa Cruz), anti-DAXX (Santa Cruz), anti-CBP (Santa Cruz), and anti–phosphorylated Ser 63–c-Jun (Cell Signaling Technology). Fluorescein isothiocyanate (FITC)- and phycoerythrin (PE)-onjugated secondary antibodies were purchased from Molecular Probes. The imaging medium was Prolong Antifade kit (Molecular Probes). Images were taken with 40x/1.3 numerical aperture Plan NeoFluor or 63x/1.2 numerical aperture Plan Apochromat lenses. A Zeiss Axiovert 100 M, PMT detector, and LSM 510 acquisition software (all from Carl Zeiss, Thornwood, NY).
PML is required for UV-induced apoptosis Since PML has been involved in several apoptotic pathways elicited by different cellular stresses,12 we set to determine whether PML also regulates apoptosis induced by UV irradiation. To this end, we exposed Pml+/+ and Pml-/- MEFs to 60 J/m2 UV light and found that the percentage of sub-G1 hypodiploid cells was markedly impaired in Pml-/- MEFs (Figure 1A) and was dependent on neosynthesis (not shown). Reduction of apoptosis in Pml-/- cells was accompanied by a decrease in mitochondrial membrane potential depolarization (not shown). By contrast, similarly to previous reports,16,17 p53-/- cells were not protected from UV-induced apoptosis at 60 J/m2 (not shown), but they were more susceptible to UV-induced cell death at lower doses (not shown). Since p53 induction and activation by UV radiation trigger cell growth arrest through the up-regulation of p21,21 we analyzed the UV-induced cell cycle arrest in Pml-/- cells. Pml-/- MEFs properly underwent cell cycle arrest (24 hours after 20 J/m2; not shown). Furthermore, Pml inactivation did not affect p53 induction or p53 Ser 18 phosphorylation (Figure 1B). p53 Target genes such as p21 and Bax were also normally induced at both mRNA and protein levels in Pml-/- cells (Figure 1B-C). Taken together these data demonstrate that PML regulates apoptosis upon UV radiation in a p53-independent manner.
Apoptosis triggered by cisplatin (cis-pt), a chemotherapy agent that, similarly to UV radiation, induces the formation of DNAcross-links and can cause cell death in a p53-independent manner,23 was also impaired in Pml-/- MEFs at all doses tested, although at a milder extent (Supplemental Figure S1, available at the Blood website; see the Supplemental Figures link at the top of the online article). These results indicate that PML can also regulate p53-independent apoptotic pathways induced by both UV radiation and cis-pt. Functional cross-talk between PML and c-Jun upon UV radiation The c-Jun/JNK pathway has been involved in the regulation of UV-induced apoptosis.18,19,21 To better clarify the role of c-Jun in UV-induced cell death and to test whether PML and c-jun would cooperate in this function, we, at first, used a dominant-negative mutant of c-Jun (DN–c-Jun), which inhibits c-Jun transcriptional activity.24 Fibroblasts infected with a DN–c-Jun retroviral vector displayed reduction in cell death upon UV radiation (Figure 2A). Importantly, the dominant-negative effect of DN–c-Jun on UV-induced cell death was significantly reduced in Pml-/- cells, suggesting a possible functional cooperation between PML and c-Jun (Figure 2A). Thus, UV-induced apoptosis requires intact PML and c-Jun functions. In this respect, it is worth noting that cis-pt–induced apoptosis also depends on functional c-Jun.25
Because DN–c-Jun can in principle inhibit the transcriptional activity of other c-Jun family members, we analyzed whether c-Jun itself could potentiate UV-induced cell death. In unirradiated cells, c-Jun overexpression caused increased proliferation and reduced basal cell death in both wild-type and Pml-/- MEFs (not shown). By contrast, UV-induced cell death was further increased by c-Jun in wild-type MEFs, while c-Jun was ineffective in Pml-/- cells (Figure 2B). Taken together, these data demonstrate that c-Jun exerts a proapoptotic function upon UV radiation and that PML plays an important role in executing this function. c-Jun transcriptional activity is impaired by Pml inactivation We then studied the molecular mechanisms by which PML regulates this pathway. c-Jun transcriptional activity is enhanced following UV exposure.25 Therefore, we tested the effect of PML overexpression on c-Jun transcriptional activity in MEFs upon UV radiation. Upon UV irradiation, transactivation by a GAL4–c-Jun construct was induced in MEFs (Figure 3A). Overexpression of PML strongly potentiated UV-triggered c-Jun transcriptional activation (Figure 3A) in a dosedependent manner (not shown). Importantly, coactivation of c-Jun by PML was only observed in irradiated cells, thus demonstrating that PML-mediated regulation of c-Jun transcriptional activity is UV radiation dependent (Figure 3A). We next compared GAL4–c-Jun activity in Pml+/+ and Pml-/- MEFs and found that the UV-dependent transcriptional activation of c-Jun was significantly impaired in the absence of PML (Figure 3B). This defect was directly due to the absence of PML, since reintroduction of PML into Pml-/- MEFs almost completely rescued c-Jun–regulated transcription (Figure 3B) in a dose-dependent fashion (not shown). We next studied the transcriptional activity of endogenous c-Jun upon UV radiation. To this end, we tested 2 types of c-Jun responsive elements: multimerized TPA-responsive elements (TREs), which bind c-Jun/c-Fos heterodimers, and CRE-like sequences, which bind c-Jun/ATF-2 dimers.26,27 TRE activity was not significantly induced upon UV radiation in both wild-type and Pml-/- MEFs (not shown). By contrast, CRE basal activity was clearly enhanced in Pml+/+ MEFs upon UV radiation, while, once again, in Pml-/- MEFs its transactivation was completely impaired (Figure 3C).
We next investigated whether PML influences c-Jun transcriptional activity by regulating its DNA binding ability and found that, upon UV irradiation, the c-Jun/ATF-2 binding activity was clearly induced in wild-type MEFs, while, remarkably, it was impaired in Pml-/- cells (Figure S2). Supershift analysis using anti–c-Jun and anti–ATF-2 antibodies confirmed the presence of both c-Jun and ATF-2 in the CRE complex (Figure S2). Similar results were obtained in UV radiation cross-linking experiments (not shown). We next set to determine whether c-Jun DNA binding activity was influenced by Pml inactivation in vivo by chromatin immunoprecipitation experiments (ChIP) using an anti–c-Jun antibody. We studied the binding of c-Jun to its own promoter, which contains 2 CRE sequences, termed jun1 and jun2.27 The binding of c-jun to both jun1 and jun2 promoter regions was induced by UV radiation in Pml+/+ cells (Figure 3D). By contrast, we observed a reproducible and consistent reduction of c-Jun binding to both the jun1 and jun2 in Pml-/- cells (Figure 3D). ChIP pull-downs from untreated or UV-treated Pml+/+ cells contained almost undetectable amounts of collagenase promoter fragments containing a TRE site (Figure 3D). All together these data demonstrate that PML is important for c-Jun transcriptional activity and in vivo DNA binding upon UV irradiation. PML localization is disrupted upon UV irradiation
We then analyzed the effects of UV irradiation on the PML-NB. In unirradiated MEFs, PML was found typically concentrated in 10 to 15 PML-NBs/nucleus (Figure 4A). Strikingly, PML relocalized into multiple microspeckles upon UV radiation in both MEFs and primary human fibroblasts (Figure 4A, and not shown). This phenomenon affected more than 60% of cells. By contrast, treatment of MEFs with
PML and UV-activated c-Jun colocalize and physically interact
As PML regulates p53 function in the PML-NBs upon
Accumulating evidence indicates that PML exerts its tumor suppressive function by regulating cellular senescence and promoting apoptosis.5 PML is part of a p53-controlled tumor suppressive pathway for the induction of senescence upon oncogenic transformation.5 Furthermore, PML and p53 functionally interact during apoptosis induced by -irradiation in thymocytes.10 However, PML also controls apoptotic pathways that do not rely on p53.5 The mechanisms regulating the induction of apoptosis upon UV irradiation has been the object of intense research efforts in the past 2 decades. Several cellular pathways can modulate this process. The p53 tumor suppressor has been shown to mainly modulate cell cycle arrest in UV-irradiated primary cells, while its role in apoptosis is unclear.13-17 Disruption of the c-Jun/JNK pathway results in alteration of apoptosis upon UV radiation.18,21 However, although the c-Jun/JNK pathway has been implicated in the regulation of apoptosis upon UV radiation,18,19,21 the precise molecular mechanisms underlying its activation upon cellular stress remain largely unknown. In the present report, we proved that c-Jun indeed mediates UV-triggered cell death and provide direct evidence that PML selectively regulates distinct transcription factors upon different DNA-damaging agents: p53 upon -irradiation and c-Jun upon UV irradiation (Figure 5D). Importantly, we demonstrate that PML modulates the proapoptotic function of c-Jun upon UV radiation by potentiating its transcriptional activity.
Strikingly, UV light induces the disruption of the PML-NB and the formation of novel microspeckled structures, the UV-NB, in which PML and phosphorylated c-Jun dynamically accumulate. The formation of these structures does not rely on p53, since it normally occurs in UV-irradiated p53-/- MEFs (not shown). By contrast, upon
Interestingly, while the PML tumor suppressor regulates c-Jun activity in a strict UV-dependent fashion, we find that the PML-RAR
We thank Maria Barna, Francesca Bernassola, Davide Ruggero, Stefano Cairo, Len Zon, Jennifer Best, and John Petrini for useful discussion. We also thank Scott Lowe for mouse anti-PML antibodies and Katia Manova for confocal studies.
Submitted September 30, 2004; accepted December 13, 2004.
Prepublished online as Blood First Edition Paper, December 30, 2004; DOI 10.1182/blood-2004-09-3782.
Supported by the National Institutes of Health (NIH) (CA-71692 to P.P.P.). R.B. was the recipient of an NIH T32 Training Grant.
The online version of the article contains a data supplement.
An Inside Blood analysis of this article appears in the front of this issue.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Pier Paolo Pandolfi, Memorial Sloan-Kettering Cancer Center, 1275 York Ave, New York, NY; e-mail: p-pandolfi{at}ski.mskcc.org.
  CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
Related Article in Blood Online:
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2005 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
m) was measured by JC-1 staining following manufacture's instruction (Molecular Probes, Eugene, OR). 
(retinoic acid receptor 
) and Pml-/- (
) MEFs were UV-irradiated with 60 J/m2, and apoptosis was measured at 0, 12, and 24 hours by propidium iodide staining and subdiploid peak analysis. Average of 3 independent experiments ± standard deviation (SD) is shown. (B) p53 Function upon UV radiation is unaltered in Pml-/- MEFs. Pml+/+ and Pml-/- MEFs were UV-treated (60 J/m2) and lysed at 0, 1, 3, 6, 12, and 24 hours. Total extracts were probed with antibodies against p53, phospho (P)–p53 (Ser 18), p21, and Bax. HSP90 levels were measured as loading control. Levels of p53 expression and phosphorylation are represented as fold of induction over untreated controls. (C) Bax and p21 mRNA levels in Pml+/+ and Pml-/- MEFs were analyzed by Northern blot at 0, 6, 12, and 18 hours upon UV irradiation (60 J/m2). Ethidium bromide staining of 28S rRNA is shown as loading control.
