|
|
Blood, 15 November 2005, Vol. 106, No. 10, pp. 3377-3379.
Prepublished online as a Blood First Edition Paper on August 4, 2005; DOI 10.1182/blood-2005-05-1898.
Previous Article | Table of Contents | Next Article 
CLINICAL TRIALS AND OBSERVATIONS Brief report
The JAK2V617F activating mutation occurs in chronic myelomonocytic leukemia and acute myeloid leukemia, but not in acute lymphoblastic leukemia or chronic lymphocytic leukemia
Ross L. Levine,
Marc Loriaux,
Brian J. P. Huntly,
Mignon L. Loh,
Miroslav Beran,
Eric Stoffregen,
Roland Berger,
Jennifer J. Clark,
Stephanie G. Willis,
Kim T. Nguyen,
Nikki J. Flores,
Elihu Estey,
Norbert Gattermann,
Scott Armstrong,
A. Thomas Look,
James D. Griffin,
Olivier A. Bernard,
Michael C. Heinrich,
D. Gary Gilliland,
Brian Druker, and
Michael W. N. Deininger
From the Brigham and Women's Hospital, Harvard Medical School, Boston, MA; the Oregon Health and Science University (OHSU), Cancer Institute, Portland, OR; OHSU Cancer Center, Howard Hughes Medical Institute, Portland, OR; the Department of Pediatrics, University of California, San Francisco (UCSF), CA; the Department of Leukemia, University of Texas M. D. Anderson Cancer Center, Houston, TX; Mayo Medical School, Rochester MN; Institut National de la Santé et de la Recherche Médicale (INSERM) E0210, Institut Fédératif de Recherche Necker Enfants-Malades (IRNEM), Hôpital Necker, Paris, France; the Department of Hematology, Oncology, and Clinical Immunology, Heinrich-Heine-University, Düsseldorf, Germany; and the Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA.
 |
Abstract
|
|---|
Activating mutations in tyrosine kinases have been identified in hematopoietic and nonhematopoietic malignancies. Recently, we and others identified a single recurrent somatic activating mutation (JAK2V617F) in the Janus kinase 2 (JAK2) tyrosine kinase in the myeloproliferative disorders (MPDs) polycythemia vera, essential thrombocythemia, and myeloid metaplasia with myelofibrosis. We used direct sequence analysis to determine if the JAK2V617F mutation was present in acute myeloid leukemia (AML), chronic myelomonocytic leukemia (CMML)/atypical chronic myelogenous leukemia (aCML), myelodysplastic syndrome (MDS), B-lineage acute lymphoblastic leukemia (ALL), T-cell ALL, and chronic lymphocytic leukemia (CLL). Analysis of 222 patients with AML identified JAK2V617F mutations in 4 patients with AML, 3 of whom had a preceding MPD. JAK2V617F mutations were identified in 9 (7.8%) of 116 CMML/a CML samples, and in 2 (4.2%) of 48 MDS samples. We did not identify the JAK2V617F disease allele in B-lineage ALL (n = 83), T-cell ALL (n = 93), or CLL (n = 45). These data indicate that the JAK2V617F allele is present in acute and chronic myeloid malignancies but not in lymphoid malignancies.
 |
Introduction
|
|---|
Constitutive activation of tyrosine kinases by chromosomal translocation,1 interstitial deletion,2 internal tandem duplication,3 and amino acid substitution4 have been observed in hematopoietic malignancies including acute myeloid leukemia (AML) and myeloproliferative disorders (MPDs). These mutant kinases are attractive therapeutic targets, as demonstrated by the efficacy of imatinib in BCR-ABLpositive chronic myelogenous leukemia (CML),5 as well as in MPD associated with activating alleles involving PDGFRA or PDGFRB.2,6,7 In addition, activating mutations in the FLT3 receptor tyrosine kinase are the most common genetic event in acute myeloid leukemia (AML), and specific inhibitors of the FMS-like tyrosine kinase 3 (FLT3) have entered late-stage clinical trials.8 Although mutations in tyrosine kinases and in other genes have been identified in a subset of MPD and AML, in many cases the genetic events that contribute to the molecular pathogenesis of these diseases remain unknown.
Recently, we and others identified a recurrent somatic activating mutation in the JAK2 tyrosine kinase in polycythemia vera (PV), essential thrombocythemia (ET), and myeloid metaplasia with myelofibrosis (MMM).9-13 This mutation results in a valine to phenylalanine substitution at codon 617 within the Jak homology domain 2 (JH2) pseudokinase domain of Janus kinase 2 (JAK2). Expression of the JAK2V617F kinase in vitro demonstrates constitutive activation and factor-independent growth,10,11 and expression of JAK2V617F in a murine bone marrow transplant model results in erythrocytosis in recipient mice.11 These data suggest that JAK2V617F is a constitutively active tyrosine kinase and that activation of the JAK2 tyrosine kinase by the V617F mutation is an important pathogenetic event in PV, ET, and MMM.
The identification of a single disease allele in 3 related myeloid diseases suggests that the JAK2V617F mutation may be important in the pathogenesis of additional hematopoietic malignancies. In addition, the TEL-JAK2 and PCM1-JAK2 fusions have been identified in patients with MPD, AML, and acute lymphoblastic leukemia (ALL),14-16 and activation of the JAKsignal transducer and activator of transcription (STAT) pathway is observed in hematopoietic and nonhematopoietic malignancies.17 This led us to search for JAK2V617F mutations in chronic myelomonocytic leukemia (CMML), atypical (BCR-ABL negative) CML (aCML), AML, myelodysplastic syndrome (MDS), ALL, and chronic lymphocytic leukemia (CLL). In this report, we identified JAK2V617F mutations in a subset of CMML/aCML, AML, and MDS but not in B-lineage ALL, T-cell ALL, or CLL. These results demonstrate that the JAK2V617F mutation contributes to the pathogenesis of a spectrum of myeloid diseases including MPD and AML but not to ALL.
 |
Study design
|
|---|
Patient samples and isolation of genomic DNA
All patients provided informed consent. DNA isolated from blood and bone marrow samples from 222 patients with AML, from 48 patients with MDS, from 83 patients with B-lineage ALL, from 93 patients with T-cell ALL, and from 45 patients with CLL were included in this study. DNA from 78 patients with CMML or aCML and RNA from 38 patients with CMML/aCML were included in this study. DNA was isolated from blood and bone marrow samples using the QIAamp DNA Blood Maxi Kit (Qiagen, Valencia, CA), and cDNA was synthesized from RNA using random hexamer priming.
JAK2V617F sequence analysis
Amplification and sequencing of JAK2 exon 14 was performed as previously described10 using primers exon 14F (5'GTAAAACGACGGCCAGTTGCTGAAAGTAGGAGAAAGTGCAT', forward) and exon 14R (5'CAGGAAACAGCTATGACCTCCTACAGTGTTTTCAGTTTCAAAAA3', reverse) and using a specific forward sequencing primer (5'AGTCTTTCTTTGAAGCAGCAA3') and M13 reverse primer. Amplification and sequence analysis of cDNA samples was performed using polymerase chain reaction (PCR) primers RT-F1 (5'CCTCAGTGGGACAAAGAAGAAC3', forward) and RT-R1 (5'CCCATGGTATTCTCTCCTGAAG3', reverse) and sequencing primers F2 5'ACATCAGCTTCATGCTAAAACG3' and RT-R1. Analysis of bidirectional sequence traces was performed using Mutation Surveyor version 2.28 (SoftGenetics, State College, PA). Candidate mutations were reamplified and sequenced from the original DNA sample. Sequence analysis of the entire open reading frame of JAK2 was performed using M13-tailed primers as previously described.10
 |
Results and discussion
|
|---|
Table 1 details the results of genotypic analysis for the JAK2V617F allele in 607 patients with hematopoietic malignancies. We identified heterozygous JAK2V617F mutations in 4 patients with AML, 3 of whom had clinicopathologic evidence of a pre-existing MPD. One patient presented at age 60 years with a chronic MPD most consistent with ET and secondary myelofibrosis and subsequently transformed to AML, which was associated with deletion 5q, monosomy 7, and trisomy 8. A second patient presented at age 81 years with CMML with normal cytogenetics, and subsequently transformed to AML. A third patient presented at age 57 years with PV with normal cytogenetics; the patient was treated with P32 2 years after being diagnosed with PV and transformed to AML 3 years later, which was associated with t(1;7)(cen;cen) at transformation. The remaining patient with AML and a JAK2V617F mutation presented at age 63 years with AML with morphologic evidence of granulocytic and megakaryocytic dysplasia but did not have evidence of a pre-existing chronic MPD. Given the possibility that there may be additional JAK2 mutations in AML, we resequenced all coding exons of JAK2 in 93 AML samples and did not identify additional JAK2 mutations. Although JAK2V617F mutations are rare in de novo AML ( 0.5%), activating KIT mutations are also rare (1.6%) in our AML series (data not shown). In addition, the observation that 3 patients with AML and JAK2V617F mutations initially presented with an MPD suggests that the JAK2V617F allele is most common in patients who transform to AML from a pre-existing MPD.
Heterozygous JAK2V617F mutations were identified in 2 (4.2%) of 48 MDS cases. One patient presented at age 66 years with MDS with bone marrow dysplasia and 3% bone marrow blasts, and at the time his sample was obtained he had transformed to refractory anemia with excess of blasts in transformation (RAEB-t) with 25% bone marrow blasts; the second patient presented at age 74 years with refractory anemia and 7% bone marrow blasts. Sequence analysis of DNA samples from 78 patients with CMML/aCML samples identified heterozygous JAK2V617F mutations in 7 samples and a homozygous mutation in 1 sample. All CMML/aCML patients with JAK2V617F mutations had a normal diploid karyotype, and clinical characteristics are listed in Table 2. Sequence analysis of exons 12 to 19 (encoding the JH2 pseudokinase domain) and exon 22 (encoding the activation loop) in 32 CMML/aCML samples did not identify additional JAK2 mutations. Analysis of cDNA from an additional 38 patients with CMML/aCML identified a heterozygous mutation in one additional patient with aCML; in total, 9 (7.8%) of 116 patients with CMML/aCML had JAK2V617F mutations. Two patients with CMML and heterozygous JAK2V617F mutations also had KRAS or NRAS mutations. This observation suggests that activation of the JAK-STAT pathway and the RASmitogen-activated protein kinase (MAPK) pathway can cooperate in CMML, and suggests that the possibility that additional mutations in JAK2V617F mutant hematopoietic progenitors may direct the eventual disease phenotype in specific patients.
The identification of a single disease allele in 3 different MPDs prompted us to search for JAK2V617F mutations in CMML/aCML, AML, and MDS. The presence of JAK2V617F mutations in CMML/aCML, MDS, and AML demonstrates that the same genetic event can play a role in the pathogenesis of a wide spectrum of myeloid malignancies. We believe these observations warrant a comprehensive search for activated tyrosine kinases in MPD and AML, as there are likely additional unidentified genetic events with biologic and therapeutic significance. In contrast, we did not identify JAK2V617F mutations in B-lineage ALL (83 patients), T-cell ALL (93 patients), or CLL (45 patients). Additional in vitro and in vivo studies are needed to determine the cause of the specificity of JAK2V617F for myeloid diseases, as second mutations, host modifiers, differential cytokine receptor expression, and other factors may influence the ultimate phenotype of hematopoietic progenitors that acquire the JAK2V617F mutation. These data also suggest that different genetic events may lead to JAK-STAT pathway activation in different malignancies. Amplification of the JAK2 locus has been described in Hodgkin disease and mediastinal B-cell lymphoma,18,19 and biallelic inactivating mutations in suppressor of cytokine signaling-1 (SOCS-1), a negative regulator of JAK2, have been identified in mediastinal B-cell lymphoma.20 Genomic analysis of JAK2 and of other JAK-STAT pathway members may lead to the identification of mutations of the JAK-STAT pathway in lymphoid diseases and other malignancies.
 |
Acknowledgements
|
|---|
We are indebted to Alexis Bywater and Sarah Anderson for technical and administrative assistance. PCR and sequencing were performed through a contractual arrangement with Agencourt Bioscience.
 |
Footnotes
|
|---|
Submitted May 10, 2005;
accepted July 22, 2005.
Prepublished online as Blood First Edition Paper, August 4, 2005; DOI 10.1182/blood-2005-05-1898.
Supported in part by National Institutes of Health grants DK50654 and CA66996 to D.G.G., National Institutes of Health grants to B.D., National Institutes of Health grant 1P01-CA108631-01A1 to E.E., and by the Leukemia and Lymphoma Society. D.G.G. and B.D. are Doris Duke Foundation Distinguished Clinical Scientists; D.G.G. and B.D. are Investigators of the Howard Hughes Medical Institute. M.W.D. is a recipient of an American Society of Hematology Clinical/Translational Research Scholar Award.
R.L.L. contributed to the sequence analysis and study design and drafted the paper; M.L. contributed to sequence analysis; B.J.P.H. contributed to sequence analysis and to drafting the paper; M.L.L. organized the collection of samples and sequence analysis at UCSF; M.B. helped to organize the collection of samples at the M. D. Anderson Cancer Center; E.S. helped with sequence analysis; R.B. organized the collection of samples in Paris and clinical information; J.J.C. helped with collection and processing of samples and clinical information; S.G.W. helped with sequence analysis; K.T.N. contributed to sequence analysis and sample processing at UCSF; N.J.F. contributed to sequence analysis and sample processing at UCSF; E.E. helped to organize the collection of samples at the M. D. Anderson Cancer Center; N.G. organized the collection of samples in Düsseldorf; S.A. organized the collection of samples at Dana-Farber Cancer Institute; A.T.L. organized the collection of samples at Dana-Farber Cancer Institute; J.D.G. contributed to the design of the study; O.A.B. helped with sample collection in Paris; D.G.G. helped to design the study; B.D. helped to design the study; and M.W.D. contributed to sample collection, sequence analysis, and writing the paper.
An Inside Blood analysis of this article appears at the front of this issue.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Note added in proof. While this article was in preparation, two reports described infrequent JAK2V617F mutations in CMML/aCML and MDS21 and 20% of patients with unclassified MPD.22
Reprints: Michael W. N. Deininger, Oregon Health and Science University, BMT/Leukemia Center, L592, 3181 SW Sam Jackson Park Rd, Portland, OR 97239; e-mail: deininge{at}ohsu.edu.
 |
References
|
|---|
- Bartram CR, de Klein A, Hagemeijer A, et al. Translocation of c-ab1 oncogene correlates with the presence of a Philadelphia chromosome in chronic myelocytic leukaemia. Nature. 1983;306: 277-280.[CrossRef][Medline]
[Order article via Infotrieve]
- Cools J, DeAngelo DJ, Gotlib J, et al. A tyrosine kinase created by fusion of the PDGFRA and FIP1L1 genes as a therapeutic target of imatinib in idiopathic hypereosinophilic syndrome. N Engl J Med. 2003;348: 1201-1214.[Abstract/Free Full Text]
- Nakao M, Yokota S, Iwai T, et al. Internal tandem duplication of the flt3 gene found in acute myeloid leukemia. Leukemia. 1996;10: 1911-1918.[Medline]
[Order article via Infotrieve]
- Furitsu T, Tsujimura T, Tono T, et al. Identification of mutations in the coding sequence of the protooncogene c-kit in a human mast cell leukemia cell line causing ligand-independent activation of c-kit product. J Clin Invest. 1993;92: 1736-1744.[Medline]
[Order article via Infotrieve]
- Druker BJ, Talpaz M, Resta DJ, et al. Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia. N Engl J Med. 2001;344: 1031-1037.[Abstract/Free Full Text]
- Golub TR, Barker GF, Lovett M, Gilliland DG. Fusion of PDGF receptor beta to a novel ets-like gene, tel, in chronic myelomonocytic leukemia with t(5;12) chromosomal translocation. Cell. 1994;77: 307-316.[CrossRef][Medline]
[Order article via Infotrieve]
- Apperley JF, Gardembas M, Melo JV, et al. Response to imatinib mesylate in patients with chronic myeloproliferative diseases with rearrangements of the platelet-derived growth factor receptor beta. N Engl J Med. 2002;347: 481-487.[Abstract/Free Full Text]
- Gilliland DG, Griffin JD. The roles of FLT3 in hematopoiesis and leukemia. Blood. 2002;100: 1532-1542.[Abstract/Free Full Text]
- Baxter EJ, Scott LM, Campbell PJ, et al. Acquired mutation of the tyrosine kinase JAK2 in human myeloproliferative disorders. Lancet. 2005;365: 1054-1061.[Medline]
[Order article via Infotrieve]
- Levine RL, Wadleigh M, Cools J, et al. Activating mutation in the tyrosine kinase JAK2 in polycythemia vera, essential thrombocythemia, and myeloid metaplasia with myelofibrosis. Cancer Cell. 2005;7: 387-397.[CrossRef][Medline]
[Order article via Infotrieve]
- James C, Ugo V, Le Couedic JP, et al. A unique clonal JAK2 mutation leading to constitutive signalling causes polycythaemia vera. Nature. 2005; 434: 1144-1148.[CrossRef][Medline]
[Order article via Infotrieve]
- Kralovics R, Passamonti F, Buser AS, et al. A gain-of-function mutation of JAK2 in myeloproliferative disorders. N Engl J Med. 2005;352: 1779-1790.[Abstract/Free Full Text]
- Zhao R, Xing S, Li Z, et al. Identification of an acquired JAK2 mutation in polycythemia vera. J Biol Chem. 2005;280: 22788-22792.[Abstract/Free Full Text]
- Reiter A, Walz C, Watmore A, et al. The t(8;9) (p22;p24) is a recurrent abnormality in chronic and acute leukemia that fuses PCM1 to JAK2. Cancer Res. 2005;65: 2662-2667.[Abstract/Free Full Text]
- Lacronique V, Boureux A, Valle VD, et al. A TEL-JAK2 fusion protein with constitutive kinase activity in human leukemia. Science. 1997;278: 1309-1312.[Abstract/Free Full Text]
- Peeters P, Raynaud SD, Cools J, et al. Fusion of TEL, the ETS-variant gene 6 (ETV6), to the receptor-associated kinase JAK2 as a result of t(9; 12) in a lymphoid and t(9;15;12) in a myeloid leukemia. Blood. 1997;90: 2535-2540.[Abstract/Free Full Text]
- Boudny V, Kovarik J. JAK/STAT signaling pathways and cancer: Janus kinases/signal transducers and activators of transcription. Neoplasma. 2002;49: 349-355.[Medline]
[Order article via Infotrieve]
- Joos S, Kupper M, Ohl S, et al. Genomic imbalances including amplification of the tyrosine kinase gene JAK2 in CD30+ Hodgkin cells. Cancer Res. 2000;60: 549-552.[Abstract/Free Full Text]
- Guiter C, Dusanter-Fourt I, Copie-Bergman C, et al. Constitutive STAT6 activation in primary mediastinal large B-cell lymphoma. Blood. 2004;104: 543-549.[Abstract/Free Full Text]
- Melzner I, Bucur AJ, Bruderlein S, et al. Biallelic mutation of SOCS-1 impairs JAK2 degradation and sustains phospho-JAK2 action in the MedB-1 mediastinal lymphoma line. Blood. 2005;105: 2535-2542.[Abstract/Free Full Text]
- Steensma DP, Dewald GW, Lasho TL, et al. The JAK2 V617F activating tyrosine kinase mutation is an infrequent event in both "atypical" myeloproliferative disorders and the myelodysplastic syndrome. Blood. 2005;106: 1207-1209.[Abstract/Free Full Text]
- Jones AV, Kreil S, Zoi K, et al. Widespread occurrence of the JAK2 V617F mutation in chronic myeloproliferative disorders. Blood. 2005;106: 2162-2168.[Abstract/Free Full Text]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
Related Article in Blood Online:
-
V617F "JAKs" up myeloproliferative signal
- Ayalew Tefferi
Blood 2005 106: 3335-3336.
[Full Text]
[PDF]
Related Letter in Blood Online:
-
Rare occurrence of the JAK2 V617F mutation in AML subtypes M5, M6, and M7
- Stefan Fröhling, Daniel B. Lipka, Sabine Kayser, Claudia Scholl, Richard F. Schlenk, Hartmut Döhner, D. Gary Gilliland, Ross L. Levine, and Konstanze Döhner
Blood 2006 107: 1242-1243.
[Full Text]
[PDF]
This article has been cited by other articles:

|
 |

|
 |
 
M. Cankovic, L. Whiteley, R. C. Hawley, R. J. Zarbo, and D. Chitale
Clinical Performance of JAK2 V617F Mutation Detection Assays in a Molecular Diagnostics Laboratory: Evaluation of Screening and Quantitation Methods
Am J Clin Pathol,
November 1, 2009;
132(5):
713 - 721.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A Pich, L Riera, F Sismondi, L Godio, L D. Bonino, F Marmont, and P F. di Celle
JAK2V617F activating mutation is associated with the myeloproliferative type of chronic myelomonocytic leukaemia
J. Clin. Pathol.,
September 1, 2009;
62(9):
798 - 801.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. W. Vardiman, J. Thiele, D. A. Arber, R. D. Brunning, M. J. Borowitz, A. Porwit, N. L. Harris, M. M. Le Beau, E. Hellstrom-Lindberg, A. Tefferi, et al.
The 2008 revision of the World Health Organization (WHO) classification of myeloid neoplasms and acute leukemia: rationale and important changes
Blood,
July 30, 2009;
114(5):
937 - 951.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Abdel-Wahab, A. Mullally, C. Hedvat, G. Garcia-Manero, J. Patel, M. Wadleigh, S. Malinge, J. Yao, O. Kilpivaara, R. Bhat, et al.
Genetic characterization of TET1, TET2, and TET3 alterations in myeloid malignancies
Blood,
July 2, 2009;
114(1):
144 - 147.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. J. Campbell, D. Bareford, W. N. Erber, B. S. Wilkins, P. Wright, G. Buck, K. Wheatley, C. N. Harrison, and A. R. Green
Reticulin Accumulation in Essential Thrombocythemia: Prognostic Significance and Relationship to Therapy
J. Clin. Oncol.,
June 20, 2009;
27(18):
2991 - 2999.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. W. Tyner, M. W. Deininger, M. M. Loriaux, B. H. Chang, J. R. Gotlib, S. G. Willis, H. Erickson, T. Kovacsovics, T. O'Hare, M. C. Heinrich, et al.
RNAi screen for rapid therapeutic target identification in leukemia patients
PNAS,
May 26, 2009;
106(21):
8695 - 8700.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Vannucchi, P. Guglielmelli, and A. Tefferi
Advances in Understanding and Management of Myeloproliferative Neoplasms
CA Cancer J Clin,
May 1, 2009;
59(3):
171 - 191.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. L. Levine and D. G. Gilliland
Myeloproliferative disorders
Blood,
September 15, 2008;
112(6):
2190 - 2198.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Xing, T. H. Wanting, W. Zhao, J. Ma, S. Wang, X. Xu, Q. Li, X. Fu, M. Xu, and Z. J. Zhao
Transgenic expression of JAK2V617F causes myeloproliferative disorders in mice
Blood,
May 15, 2008;
111(10):
5109 - 5117.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. M. Loriaux, R. L. Levine, J. W. Tyner, S. Frohling, C. Scholl, E. P. Stoffregen, G. Wernig, H. Erickson, C. A. Eide, R. Berger, et al.
High-throughput sequence analysis of the tyrosine kinome in acute myeloid leukemia
Blood,
May 1, 2008;
111(9):
4788 - 4796.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Flex, V. Petrangeli, L. Stella, S. Chiaretti, T. Hornakova, L. Knoops, C. Ariola, V. Fodale, E. Clappier, F. Paoloni, et al.
Somatically acquired JAK1 mutations in adult acute lymphoblastic leukemia
J. Exp. Med.,
April 14, 2008;
205(4):
751 - 758.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Lu, L. J.-S. Huang, and H. F. Lodish
Dimerization by a Cytokine Receptor Is Necessary for Constitutive Activation of JAK2V617F
J. Biol. Chem.,
February 29, 2008;
283(9):
5258 - 5266.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. W. Tyner, D. K. Walters, S. G. Willis, M. Luttropp, J. Oost, M. Loriaux, H. Erickson, A. S. Corbin, T. O'Hare, M. C. Heinrich, et al.
RNAi screening of the tyrosine kinome identifies therapeutic targets in acute myeloid leukemia
Blood,
February 15, 2008;
111(4):
2238 - 2245.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. P. Steensma and A. Tefferi
JAK2 V617F and ringed sideroblasts: not necessarily RARS-T
Blood,
February 1, 2008;
111(3):
1748 - 1748.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Kawamata, S. Ogawa, M. Zimmermann, M. Kato, M. Sanada, K. Hemminki, G. Yamatomo, Y. Nannya, R. Koehler, T. Flohr, et al.
Molecular allelokaryotyping of pediatric acute lymphoblastic leukemias by high-resolution single nucleotide polymorphism oligonucleotide genomic microarray
Blood,
January 15, 2008;
111(2):
776 - 784.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. S. Wilkins, W. N. Erber, D. Bareford, G. Buck, K. Wheatley, C. L. East, B. Paul, C. N. Harrison, A. R. Green, and P. J. Campbell
Bone marrow pathology in essential thrombocythemia: interobserver reliability and utility for identifying disease subtypes
Blood,
January 1, 2008;
111(1):
60 - 70.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Pradhan, Q. T. Lambert, and G. W. Reuther
Transformation of hematopoietic cells and activation of JAK2-V617F by IL-27R, a component of a heterodimeric type I cytokine receptor
PNAS,
November 20, 2007;
104(47):
18502 - 18507.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Duan, J. Bradner, E. Greenberg, R. Mazitschek, R. Foster, J. Mahoney, and M. V. Seiden
8-Benzyl-4-oxo-8-azabicyclo[3.2.1]oct-2-ene-6,7-dicarboxylic Acid (SD-1008), a Novel Janus Kinase 2 Inhibitor, Increases Chemotherapy Sensitivity in Human Ovarian Cancer Cells
Mol. Pharmacol.,
November 1, 2007;
72(5):
1137 - 1145.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Colaizzo, L. Amitrano, G. L. Tiscia, E. Grandone, M. A. Guardascione, and M. Margaglione
A new JAK2 gene mutation in patients with polycythemia vera and splanchnic vein thrombosis
Blood,
October 1, 2007;
110(7):
2768 - 2768.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Theocharides, M. Boissinot, F. Girodon, R. Garand, S.-S. Teo, E. Lippert, P. Talmant, A. Tichelli, S. Hermouet, and R. C. Skoda
Leukemic blasts in transformed JAK2-V617F-positive myeloproliferative disorders are frequently negative for the JAK2-V617F mutation.
Blood,
July 1, 2007;
110(1):
375 - 379.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Colaizzo, L. Amitrano, L. Iannaccone, P. Vergura, F. Cappucci, E. Grandone, M. A. Guardascione, and M. Margaglione
Gain-of-function gene mutations and venous thromboembolism: distinct roles in different clinical settings
J. Med. Genet.,
June 1, 2007;
44(6):
412 - 416.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Tefferi and A. Pardanani
Evaluation of 'Increased' Hemoglobin in the JAK2 Mutations Era: A Diagnostic Algorithm Based on Genetic Tests
Mayo Clin. Proc.,
May 1, 2007;
82(5):
599 - 604.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Malinge, R. Ben-Abdelali, C. Settegrana, I. Radford-Weiss, M. Debre, K. Beldjord, E. A. Macintyre, J.-L. Villeval, W. Vainchenker, R. Berger, et al.
Novel activating JAK2 mutation in a patient with Down syndrome and B-cell precursor acute lymphoblastic leukemia
Blood,
March 1, 2007;
109(5):
2202 - 2204.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Li, M. Xu, S. Xing, W. T. Ho, T. Ishii, Q. Li, X. Fu, and Z. J. Zhao
Erlotinib Effectively Inhibits JAK2V617F Activity and Polycythemia Vera Cell Growth
J. Biol. Chem.,
February 9, 2007;
282(6):
3428 - 3432.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. M. Scott, W. Tong, R. L. Levine, M. A. Scott, P. A. Beer, M. R. Stratton, P. A. Futreal, W. N. Erber, M. F. McMullin, C. N. Harrison, et al.
JAK2 Exon 12 Mutations in Polycythemia Vera and Idiopathic Erythrocytosis
N. Engl. J. Med.,
February 1, 2007;
356(5):
459 - 468.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Xu, Q. Zhang, J. Luo, S. Xing, Q. Li, S. B. Krantz, X. Fu, and Z. J. Zhao
JAK2V617F: prevalence in a large Chinese hospital population
Blood,
January 1, 2007;
109(1):
339 - 342.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. J. Campbell and A. R. Green
The Myeloproliferative Disorders
N. Engl. J. Med.,
December 7, 2006;
355(23):
2452 - 2466.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. G.P. Bumm, C. Elsea, A. S. Corbin, M. Loriaux, D. Sherbenou, L. Wood, J. Deininger, R. T. Silver, B. J. Druker, and M. W.N. Deininger
Characterization of Murine JAK2V617F-Positive Myeloproliferative Disease
Cancer Res.,
December 1, 2006;
66(23):
11156 - 11165.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Duan, J. E. Bradner, E. Greenberg, R. Levine, R. Foster, J. Mahoney, and M. V. Seiden
SD-1029 Inhibits Signal Transducer and Activator of Transcription 3 Nuclear Translocation.
Clin. Cancer Res.,
November 15, 2006;
12(22):
6844 - 6852.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Szpurka, R. Tiu, G. Murugesan, S. Aboudola, E. D. Hsi, K. S. Theil, M. A. Sekeres, and J. P. Maciejewski
Refractory anemia with ringed sideroblasts associated with marked thrombocytosis (RARS-T), another myeloproliferative condition characterized by JAK2 V617F mutation
Blood,
October 1, 2006;
108(7):
2173 - 2181.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. P. Steensma
JAK2 V617F in Myeloid Disorders: Molecular Diagnostic Techniques and Their Clinical Utility: A Paper from the 2005 William Beaumont Hospital Symposium on Molecular Pathology
J. Mol. Diagn.,
September 1, 2006;
8(4):
397 - 411.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Horn, M. Kremer, T. Dechow, W. M. Pfeifer, B. Geist, M. Perker, J. Duyster, L. Quintanilla-Martinez, and F. Fend
Detection of the Activating JAK2 V617F Mutation in Paraffin-Embedded Trephine Bone Marrow Biopsies of Patients with Chronic Myeloproliferative Diseases
J. Mol. Diagn.,
July 1, 2006;
8(3):
299 - 304.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Lay, R. Mariappan, J. Gotlib, L. Dietz, S. Sebastian, I. Schrijver, and J. L. Zehnder
Detection of the JAK2 V617F Mutation by LightCycler PCR and Probe Dissociation Analysis
J. Mol. Diagn.,
July 1, 2006;
8(3):
330 - 334.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Bellanne-Chantelot, I. Chaumarel, M. Labopin, F. Bellanger, V. Barbu, C. De Toma, F. Delhommeau, N. Casadevall, W. Vainchenker, G. Thomas, et al.
Genetic and clinical implications of the Val617Phe JAK2 mutation in 72 families with myeloproliferative disorders
Blood,
July 1, 2006;
108(1):
346 - 352.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Frohling, D. B. Lipka, S. Kayser, C. Scholl, R. F. Schlenk, H. Dohner, D. G. Gilliland, R. L. Levine, and K. Dohner
Rare occurrence of the JAK2 V617F mutation in AML subtypes M5, M6, and M7
Blood,
February 1, 2006;
107(3):
1242 - 1243.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. L. Levine and G. Wernig
Role of JAK-STAT Signaling in the Pathogenesis of Myeloproliferative Disorders
Hematology,
January 1, 2006;
2006(1):
233 - 239.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Lu, R. Levine, W. Tong, G. Wernig, Y. Pikman, S. Zarnegar, D. G. Gilliland, and H. Lodish
Expression of a homodimeric type I cytokine receptor is required for JAK2V617F-mediated transformation
PNAS,
December 27, 2005;
102(52):
18962 - 18967.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|