Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
 Blood, 15 July 2005, Vol. 106, No. 2, pp. 477-484.
Prepublished online as a Blood First Edition Paper on April 5, 2005; DOI 10.1182/blood-2004-08-2989.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figures
Right arrow All Versions of this Article:
2004-08-2989v1
106/2/477    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rodrigues, N. P.
Right arrow Articles by Scadden, D. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rodrigues, N. P.
Right arrow Articles by Scadden, D. T.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Gene Expression
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

HEMATOPOIESIS

Haploinsufficiency of GATA-2 perturbs adult hematopoietic stem-cell homeostasis

Neil P. Rodrigues, Viktor Janzen, Randolf Forkert, David M. Dombkowski, Ashleigh S. Boyd, Stuart H. Orkin, Tariq Enver, Paresh Vyas, and David T. Scadden

From the Center for Regenerative Medicine and Technology, Massachusetts General Hospital, the Department of Pediatric Oncology, Children's Hospital and the Dana Farber Cancer Institute, Harvard Medical School, and the Howard Hughes Medical Institute, Boston, MA; Harvard Stem Cell Institute, Harvard University, Cambridge, MA; the Department of Haematology and the MRC Haematology Unit, Weatherall Institute of Molecular Medicine, the Nuffield Department of Surgery, John Radcliffe Hospital, University of Oxford, United Kingdom.


   Abstract
Top
 Abstract
Introduction
 Materials and methods
 Results
 Discussion
 References
 
The zinc finger transcription factor GATA-2 plays a fundamental role in generating hematopoietic stem-cells in mammalian development. Less well defined is whether GATA-2 participates in adult stem-cell regulation, an issue we addressed using GATA-2 heterozygote mice that express reduced levels of GATA-2 in hematopoietic cells. While GATA-2+/– mice demonstrated decreases in some colony-forming progenitors, the most prominent changes were observed within the stem-cell compartment. Heterozygote bone marrow had a lower abundance of Lin–c-kit+Sca-1+CD34– cells and performed poorly in competitive transplantation and quantitative week-5 cobblestone area–forming cell (CAFC) assays. Furthermore, a stem-cell–enriched population from GATA1+/– marrow was more quiescent and exhibited a greater frequency of apoptotic cells associated with decreased expression of the antiapoptotic gene Bcl-xL. Yet the self-renewal potential of the +/– stem-cell compartment, as judged by serial transplantations, was unchanged. These data indicate compromised primitive cell proliferation and survival in the setting of a lower GATA-2 gene dose without a change in the differentiation or self-renewal capacity of the stem-cells that remain. Thus, GATA-2 dose regulates adult stem-cell homeostasis by affecting select aspects of stem cell function.


   Introduction
Top
 Abstract
 Introduction
Materials and methods
 Results
 Discussion
 References
 
The zinc finger GATA family of transcription factors influences cell fate in multiple tissues through recognition of a GATA consensus sequence in target genes. Among these, GATA-1, -2, and -3 are primarily expressed in blood cells,1 and gene-targeting experiments have illustrated that each has a salient function in hematopoiesis.2-5 GATA-1 and -3 are widely acknowledged as lineage-specific transcription factors affecting erythroid cells,2,3,6 megakaryocytes,7,8 and eosinophils,9,10 and T cells,4 respectively. In contrast, GATA-2 is predominantly expressed within adult and developing stem-cells11,12 and mast cells13 and is a pivotal regulator of the stem-cell compartment during ontogeny.5 Mice engineered to be deficient in GATA-2 succumbed during gestation at embryonic day 10 to 11 (day e10-11) with severe hematopoietic defects. GATA-2 null/wild-type chimeric mice generated to define the function of GATA-2 in definitive hematopoiesis showed an absence of null myeloid cell output and Rag-2–/– adult chimeras produced only very low levels of null lymphoid cells. Additionally, in vitro culture of null embryonic stem (ES) cells and yolk-sac cells from E9.5 null embryos revealed pervasive defects in definitive hematopoiesis, including altered responsiveness to stem-cell factor (SCF) and decreased cell survival.5,14 Taken together, these findings imply a central function for GATA-2 in the proliferation and survival of the developing stem-cell pool.

Enforced expression experiments have been used to address the impact of GATA-2 level in adult stem-cells and has primarily been achieved using 2 systems: (1) GATA-2 internal ribosomal entry site (IRES)–murine stem-cell virus (MSCV) retrovirus,15 and (2) estrogen receptor inducible GATA-2/ER vector.16,17 The GATA-2/MSCV retroviral system demonstrated that a 2-fold increase in GATA-2 level in murine primitive cells (Sca1+Lin–) was sufficient to reduce their number by 40-fold and cause their failure to differentiate appropriately in vivo. Similar levels of enforced expression were achieved using GATA-2/ER into hematopoietic cell lines and primary adult hematopoietic cells and demonstrated that elevated levels of GATA-2 restricted primitive cell entry into the cycle.16 This change in cell cycling was associated with increasing levels of p21 and p27,17 cell-cycle inhibitors that have been shown to control the proliferation of the stem and progenitor cell pools, respectively.18,19 Although GATA-2/ER may not entirely reflect authentic GATA-2 effects,20 these experiments collectively suggest that the level of GATA-2 within a cell may be a critical determinant of cell function. Enforced expression, however, is a controversial model for evaluating the physiologic effects of a gene product.

In this study, we have analyzed hematopoiesis in GATA-2+/– and GATA-2+/+ adult animals. GATA-2+/– mice survive through adulthood without overt abnormalities and provide a tractable system to assess the impact of GATA-2 level on adult hematopoiesis. We showed a diminution in Lin–c-kit+Sca-1+CD34– (LK-SCD34–) frequency from GATA-2+/– marrow. Furthermore, GATA-2+/– marrow exhibited a reduced capacity to engraft an irradiated host and decreased week-5 cobblestone area–forming cell (CAFC) units, suggesting a decreased functional stem-cell pool in the GATA-2+/– animal. This was accompanied by changes in primitive cell apoptosis and cell cycling, but not the relative ability of primitive cells to form progenitors or to self-renew.


   Materials and methods
Top
 Abstract
 Introduction
 Materials and methods
Results
 Discussion
 References
 
Generation of GATA-2 heterozygote mice

We generated heterozygote 129/B6 GATA-2 mice as previously described,5 and maintained them under conditions ratified by the Subcommittee on Research Animal Care of the Massachusetts General Hospital (MGH) and the United Kingdom Home Office. The heterozygote mice (+/–) were backcrossed for 6 generations into the 129/SV strain and bred into a wild-type 129/SV background to produce heterozygote and wild-type offspring. Genotyping was achieved by isolating genomic DNA from tail biopsy and DNA polymerase chain reaction (PCR) as previously described.5 Gender-matched littermates were used in experiments.

Bone marrow sampling

Mouse bone marrow was obtained from 6- to 12-week-old animals. Marrow cells were obtained by flushing femurs and tibias with Iscove modified Dulbecco medium (IMDM) supplemented with 5 IU/mL penicillin, 5 µg/mL streptomycin, 2 mM L-glutamine, and 10% fetal calf serum (Mediatech, Herndon, VA). The marrow cell suspension was filtered with 30micron nylon mesh (Sefar America, Kansas City, MO), and stored on ice until use. A 10-µL aliquot of marrow cell suspension was diluted 20-fold with phosphate-buffered saline (PBS) solution (Mediatech) containing 3% acetic acid. After 3 minutes, the sample was vigorously mixed, loaded onto a hemocytometer, and the nucleated cells counted.

Real-time reverse-transcriptase PCR

RNA was prepared from bone marrow Sca-1+c-kit+Lin– cells using the Picopure Kit (Arcturus Bioscience, Mountain View, CA). The amount of RNA was quantified using RNA-specific fluorescent dye Ribogreen (Molecular Probes, Eugene, OR). cDNA was synthesized using the Promega ImProm II Reverse Transcription System (Promega, Madison, WI). Approximately 100 ng RNA was added to a reaction containing 1x ImProm-II reaction buffer, 0.5 mM deoxynucleoside triphosphate (dNTP), 0.5 µg random primers, 20 U recombinant RNasin ribonuclease inhibitor, and 1 µL ImProm-II reverse transcriptase. Reverse transcription was performed as follows: 5 minutes annealing at 25°C followed by incubation for 1 hour at 40°C, inactivation at 70°C for 15 minutes. The cDNA was used as a template for real-time PCR. The PCR reaction contained 1x SYBR green reaction mix (Applied Biosystems), 0.5 µM GATA-2 forward primer (GCACCTGTTGTGCAAATTGT) and GATA-2 reverse primer (GCCCCTTTCTTGCTCTTCTT) and 2 ng template in a 20 µL reaction volume. Amplification was performed on an ABI 7700 with incubation times of 50°C for 2 minutes, 95°C for 10 minutes, followed by 40 to 50 cycles of 95°C for 15 seconds, and 60°C for 1 minute. The mRNA content was measured relative to that of rodent glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (TaqMan Rodent GAPDH Control Reagents; Applied Biosystems).

Full blood count

Blood was sampled from a lateral tail vein and collected in a Microtainer Brand Tube with EDTA (ethylenediaminetetraacetic acid; Becton Dickinson Vacutainer Systems, Franklin Lakes, NJ). Samples were analyzed on a Hemavet 850 (Drew Scientific, Oxford, CT).

Colony-forming cell assay

This assay was used to measure the progenitor cell frequency as previously described,18,19 but with the following modifications. M3434 (Stem Cell Technologies, Vancouver, BC, Canada) was used to enumerate total colony-forming cells (CFCs). Granulocyte macrophage–CFCs (CFC-GMs), erythroid burst-forming units (BFU-Es), and pre–B-cell CFCs were scored after culture in M3534, M3334, and M3630 (Stem Cell Technologies), respectively. All colony assays were established in 6-well plates at cell densities recommended by the manufacturer.

Long-term culture with limiting dilution: CAFC and LTC-IC assay

To quantify primitive cells in vitro, we adapted the week-5 cobblestone area–forming cell (CAFC) and week-6 long-term culture-initiating cell (LTC-IC) assay as previously described.18,19 Briefly, stromal layers were prepared from the marrow of 129/SV mice and cultured at 33°C, 5% CO2 in 25 cm2 flasks in M5300 long-term culture medium (alpha-MEM with 12.5% horse serum, 12.5% fetal bovine serum, 0.2 mM I-inositol, 20 mM folic acid, 10–4 M 2-mercaptoethanol, 2 mM L-glutamine, and 10–6 M hydrocortisone; Stem Cell Technologies). After 2 to 3 weeks, confluent layers were trypsinized, irradiated at 15 Gy, and subcultured in 96-well flat-bottomed plates at a density of 2 x 104 cells per well. After 1 to 7 days, cultures were seeded at 2-fold dilutions (105-195 per well) of nucleated marrow cells from each genotype. CAFCs were scored at weeks 2, 3, and 5. For the LTC-IC assay, cultures were established as described for the CAFC assay. At week 5, M5300 medium was removed from cultures and replaced with M3434 (Stem Cell Technologies). Cultures were maintained at 37°C, 5% CO2 and LTC-ICs were analyzed at week 6.

5-Fluorouracil (5-FU) exposure in vivo and culture

To test hematopoietic cell cycling in vivo, a single 150 mg/kg dose 5-FU (Pharmacia and Upjohn, Peapack, MI) was administered intraperitoneally; mice were killed 24 hours later and nucleated marrow cells were prepared for long-term culture at limiting dilution.

Flow-cytometric analysis and cell sorting

Flow cytometry was used to quantify the cell-cycle status in the stem-cell compartment. Bone marrow nucleated cells were labeled with antilineage biotin antibodies (CD3, CD4, CD8, B220, Gr-1, Mac-1 [Caltag, Burlingame, CA]; TER-119 [Pharmingen, San Diego, CA]) and stem-cell marker (Sca-1, c-kit; Pharmingen). An enriched stem-cell phenotype (Lin–c-kit+Sca-++) was gated and a DNA dye, Hoechst 33 342 (Molecular Probes) was used to stain the antibody-bound cells simultaneously to measure the cycling cell percent in the populations. To measure stem-cell quiescence within a Lin–c-kit+Sca-1+ gate, Pyronin Y (Polysciences, Warrington, PA) and Hst dyes were used as described previously.18,19,21 To detect apoptotic cells, annexin-V (Caltag) in conjunction with the DNA dye, 4,6-diamidino-2-phenylindole (DAPI) (Molecular Probes), was used to stain Lin–c-kit+Sca-1+ cells, which was subsequently analyzed by flow cytometry. Cells excluding DAPI and binding annexin-V were considered apoptotic. To examine intracellular Bcl-xL expression within the stem-cell compartment, bone marrow cells were stained for Sca-1, c-kit, and lineage antibodies, treated with a Cytofix/Cytoperm kit (Pharmingen) according to manufacturer's instructions, and subsequently stained with Bcl-xl antibody (Santa Cruz Biotechnology, Santa Cruz, CA). For cell sorting experiments of Lin–c-kit+Sca-1+ and Lin–c-kit+Sca-1+CD34– cell populations, marrow cells were labeled with lineage antibodies as described and tagged with antibiotin microbeads (Miltenyi, Surrey, United Kingdom) before depletion on an AutoMacs column (Miltenyi). Lineage-depleted cells were stained with strepavidin–phycoerythrin (PE)–Cy5 (Pharmingen) for remaining lineage-positive cells, Sca-1 and c-kit (Lin–c-kit+Sca-1+ sorts) or strepavidin-PE-Cy5, Sca-1, c-kit, and CD34 (Pharmingen) (Lin-c-kit+Sca-1+CD34-sorts) and analyzed/sorted by flow cytometry.

Serial transplantation

Serial bone marrow transplantation was used to evaluate the ability of stem-cells to self-renew as described previously.18,19



View larger version (12K):
[in this window]
[in a new window]
  		Figure 1.. Reduced expression of GATA-2 within GATA-2+/– bone marrow. RNA prepared from the total bone marrow (A) and Lin–c-kit+Sca-1+ cells (B) of each genotype was subjected to reverse transcriptase reaction and real-time PCR for GATA-2 and normalized to GAPDH. For each Lin–c-kit+Sca-1+ experiment, marrow cells from 2 to 3 animals of each genotype were pooled for cell sorting. Triplicates were used for each PCR reaction and the figures represent n = 2 experiments plus or minus SEM.

 
Competitive transplantation

Three 6- to 8-week-old GATA-2+/– and GATA-2+/+ mice were killed. Two million nucleated bone marrow cells from each genotype were admixed in a 1:1 ratio and transplanted into lethally irradiated 129/SV recipients. After 7 weeks, transplant recipients were killed and bone marrow was assayed in CFC and LTC-IC assays as described previously.19 The marrow of recipients was similarly evaluated in CFC assays after 4 and 8 months. After 11 months, peripheral blood obtained from recipients was sorted for granulocytes (Gr-1+), monocytes (Mac-1+), B lymphocytes (B-220+), and T lymphocytes (CD3+), and quantitative PCR was performed. Briefly, DNA was prepared using the QIAamp DNA Blood Kit (Qiagen, Valencia, CA). The amount of DNA was quantified and standardized using DNA-specific fluorescent dye Picogreen (Molecular Probes). The PCR reaction contained 1x SYBR green reaction mix (Stratagene, La Jolla, CA), 0.5 µM neomycin (NEO) forward primer (AGACAATCGGCTGCTCTGAT) and 0.5 µM of NEO reverse primer (CTCGTCCTGCAGTTCATTCA) and 10 ng of template in a 25 µL reaction volume. Amplification was performed on a Mx3000P real-time PCR system (Stratagene) with incubation times of 95°C for 10 minutes, followed by 35 cycles of 95°C for 30 seconds, 63°C for 1 minute, and 72°C for 1 minute.

Statistical analysis

All experiments were analyzed using a 2-tailed Student t test unless otherwise stated. Graphical data were expressed as mean plus or minus standard error of the mean (SEM).


   Results
Top
 Abstract
 Introduction
 Materials and methods
 Results
Discussion
 References
 
Level of GATA-2 mRNA in GATA-2+/– bone marrow

To evaluate whether GATA-2+/– mice may provide a model to study the effect of GATA-2 level on adult bone marrow hematopoiesis, we measured GATA-2 mRNA levels by real-time reverse transcriptase PCR in whole bone marrow from GATA-2+/– and GATA-2+/+ animals. GATA-2 expression was only reduced by approximately 20% in the GATA-2+/– genotype in whole marrow (Figure 1A). However, in the more stem-cell–enriched Lin–ckit+Sca-1+ (LKS) population, where GATA-2 is predominantly expressed, GATA-2 mRNA from GATA-2+/– animals was decreased to approximately 50% of the wild-type value (Figure 1B). The GATA-2+/– animal is therefore a valid model to assess reduced GATA-2 dose in adult hematopoiesis.

Altered hematopoietic potential of GATA-2+/– bone marrow

The hematopoietic potential of GATA-2+/– and GATA-2+/+ mice was examined under homeostatic conditions. Mature blood populations and overall bone marrow cellularity were comparable between the 2 genotypes (Table 1). Using the CFC assay to quantitate marrow progenitor populations, a decrease in total CFCs was observed in the GATA-2+/– mouse (Figure S1A, available on the Blood website; see the Supplemental Figures link at the top of the online article). By analyzing specific classes of lineage-committed progenitor cell in GATA-2+/– marrow, we noted a decrease of a similar magnitude in CFC-GMs (Figure S1B), but not in BFU-Es (Figure S1C) or CFC-Bs (data not shown), suggesting that the level of GATA-2 selectively affects GM colony formation.


View this table:
[in this window]
[in a new window]
  		Table 1.. Full blood counts and bone marrow cellularity are unchanged in GATA-2+/+ and GATA-2+/- mice

 
To evaluate if hematopoietic defects were evident in GATA-2+/– primitive cells, we performed limiting dilution CAFC assays22 and enumerated CAFCs appearing at 2, 3, or 5 weeks after plating. CAFC production from GATA-2+/– marrow was decreased at these respective time points (Figure 2A-C). Particularly noteworthy was the observed decrease in GATA-2+/– week-5 CAFCs; at this time point, the CAFC assay is thought to imperfectly correlate with stem-cell function.22 Further evaluation of primitive cells was performed by immunophenotyping. The CD34– subset of LKS cells (LKSCD34–) has been shown to be highly enriched for stem-cells and isolates a population capable of repopulating 21% of lethally irradiated hosts at the single cell level.23 Flow cytometry of bone marrow from GATA-2+/– animals revealed a lower frequency of LKSCD34– cells compared with wild-type controls (Figure 2D-E). Week-5 CAFC analysis of LKSCD34– demonstrated the reduced functional capacity of GATA-2+/– stem-cells (Figure 2F).

To more stringently evaluate stem-cell activity in vivo, competitive transplantation of a 1:1 admixture of GATA-2+/– to GATA-2+/+ nucleated cells into wild-type recipients was performed.24 To specifically examine the stem and progenitor cell contribution from the 2 genotypes in transplant recipients, bone marrow from individual recipients was analyzed in the LTC-IC and CFC assays, respectively. Single colonies emerging from each of these cultures were microisolated and underwent genotyping PCR. At 7 weeks, the proportion of GATA-2+/– stem-cells (LTC-ICs) and progenitor cells (CFCs) in recipients was lower than that of the GATA-2+/+ genotype (Figure 3B). Given the similar representation of GATA-2+/– stem-cells and GATA-2+/– progenitor cells in recipients at 7 weeks (Figure 3B), GATA-2+/– stem-cell output was analyzed by genotyping PCR of progenitor cells at longer time intervals. At 4 and 8 months after transplantation, pronounced reductions in GATA-2+/– progenitor cell contribution were noted, suggesting that the GATA-2+/– stem-cell compartment was impaired in competitive repopulating ability (Figure 3C). At 11 months after transplantation, peripheral blood chimerism in granulocytes, monocytes, T lymphocytes, and B lymphocytes was assessed using quantitative DNA PCR. In peripheral blood pooled from 4 animals that underwent transplantation, the contribution of the GATA-2+/– genotype to monocytes (Mac-1+), T cells (CD3+), and B cells (B-220+) was reduced compared to the GATA-2+/+ genotype (monocytes: GATA-2+/–, 27%; GATA-2+/+, 73%; T cells: GATA-2+/–, 39%; GATA-2+/+, 61%; B cells: GATA-2+/–, 36%; GATA-2+/+, 64%). Unexpectedly, the representation of GATA-2+/– and GATA-2+/+ genotype in granulocytes (Gr-1+) was similar (granulocytes: GATA-2+/–, 48%; GATA-2+/+, 52%). Blood cell counts from transplant recipients were normal (data not shown). Y chromosome analyses and genotyping PCR of colonies demonstrated 100% donor cell engraftment (data not shown). Taken together, these data indicate GATA-2+/– marrow stem-cells are compromised in their ability to contribute to select mature cell lineages in competitive transplantation.



View larger version (18K):
[in this window]
[in a new window]
  		Figure 2.. Reduced numbers of primitive hematopoietic cells within GATA-2+/– bone marrow. Bone marrow nucleated cells from each genotype were assessed for CAFC ability using limiting dilution long-term culture assays. Five to 6 dilutions were employed for each genotype in individual experiments. The absolute number of CAFCs per harvest was measured at week 2 (A) (P = .019, n = 5), week 3 (B) (P = .001, n = 6), and week 5 (C) (P = .001, n = 6). Horizontal bars depict the mean of cumulative data. GATA-2+/– bone marrow displays a decrease in Lin–c-kit+Sca-1+CD34– hematopoietic stem-cells. Using flow cytometry, a 2-fold reduction of LKSCD34– cells in GATA-2+/– marrow compared with wild-type marrow is evident in the single experiment shown here (D). Numbers in R3 gates indicate % of LKS34– cells in marrow. The cumulative data of multiple independent experiments are depicted in panel E (P < .001, n = 8). To enumerate the size of the GATA-2+/– functional stem-cell pool in Lin–c-kit+Sca-1+ or Lin–c-kit+Sca-1+CD34– cells, each primitive cell population was sorted and cultured in limiting dilution long-term culture assays and CAFCs were scored at week 5. The cumulative data of multiple experiments are depicted in panel F (LKS: P = .003, n = 7; LKSCD34–: P = .005, n = 7). Error bars indicate the standard error of the mean. Statistical analysis was performed using the Student t test.

 



View larger version (11K):
[in this window]
[in a new window]
  		Figure 3.. Competitive transplantation reveals diminished hematopoietic repopulating ability of GATA-2+/– bone marrow. Male bone marrow nucleated cells from each genotype were admixed in a 1:1 ratio and injected into the lateral veins of warmed female wild-type recipients that had received 10 Gy whole body irradiation. After 7 weeks, nucleated marrow cells from recipients were analyzed in long-term culture initiating cell (LTC-IC) and CFC assays. Discrete colonies derived from week-6 LTC-IC (stem-cells) and day-10 CFC (progenitor) assays were microisolated, lysed, and analyzed by genotyping PCR for the GATA-2 mutant and GATA-2 wild-type alleles. Nucleated marrow cells from recipients were similarly analyzed by CFC assays at 4 and 8 months after transplantation. There were 10 to 15 LTC-IC or CFC colonies screened per transplant recipient. Representative GATA-2 mutant allele PCR from cell lysates of LTC-ICs and CFCs from one recipient animal is shown (A). The mean percentage distribution of stem-cells (LTC-ICs) and progenitor cells (CFCs) from each genotype at 7 weeks after transplantation (LTC-ICs: P < .05, SEM = ± 9.3% for each genotype, n = 6 recipients; CFCs: P < .05, SEM = ± 10.5% for each genotype, n = 6 recipients) (B) and of progenitor cells at 4 and 8 months after transplantation (4 months: P < .05, SEM = ± 4.9% for each genotype, n = 6 recipients; 8 months: P < .05, SEM = ± 5.6% for each genotype n = 6 recipients) (C) are shown, with {square} representing wild-type and {blacksquare} the GATA-2+/– genotypes, respectively. Statistical analysis was performed using the Student t test.

 



View larger version (20K):
[in this window]
[in a new window]
  		Figure 4.. Altered proportion of quiescent primitive cells in GATA-2+/– bone marrow. Bone marrow cells were stained with stem-cell markers (Sca-1 and c-kit) and lineage antibodies to separate stem-cells. Simultaneous staining with the DNA dye Hoechst 33 342 (Hst) was used to determine the percentage of S/G2/M in the Lin– c-kit+Sca-1+ compartment. Data from multiple experiments are summarized in panel A (P = .931; n = 6). To determine the fraction of G0 cells in the stem-cell compartment, the RNA dye Pyronin Y (PY) and Hst were used to stain Lin–c-kit+Sca-1+ cells and flow cytometry performed to determine the percentage of G0 (PYlo) in the G0/G1 fraction (Hstlow). Representative flow cytometry plots are shown (B) and data from multiple experiments are summarized in panel C (P = .004; n = 7). To functionally corroborate altered quiescence from GATA-2+/– animals, mice from GATA-2+/– and GATA-2+/+ groups were treated with 5-FU in vivo. One day after a single intraperitoneal injection of 5-FU at a dose of 150 mg/kg, nucleated cells were obtained and plated in limiting dilution long-term culture and CAFCs were scored at week 5 (D) (P = .048; n = 5). Error bars depict the standard error of the mean. All statistical analyses were performed using the Student t test.

 
Alteration of cell-cycle status of GATA-2+/– primitive marrow cells

Postulating that the observed GATA-2+/– stem-cell phenotype may be due to the reduced capacity of primitive cells to proliferate, we assessed the cell-cycle status of an enriched stem-cell pool from the 2 genotypes using the DNA dye Hoechst 33342 (Hst).25 The proportion of cells in S/G2/M within LKS cells was unchanged between GATA-2+/– and GATA-2+/+ genotypes (Figure 4A). We next used the RNA dye Pyronin Y (PY) to measure cell dormancy within Hstlow cells21 and noted a significant increase in the PYlow Hstlow staining LKS cells in the GATA-2+/– genotype (Figure 4B-C). The mitochondrial dye rhodamine (Rho) was used in conjunction with Hst, as a further assessment of primitive cell quiescence.26 In agreement with the results of PY/Hst analysis, an increased proportion of GATA-2+/– LKS Rholow Hstlow cells was observed (data not shown). These data indicate a higher fraction of quiescent cells within the primitive cell compartment of GATA-2+/– mice.

To define whether this functionally corresponded to alterations in in vivo cell cycling, we challenged GATA-2+/– and GATA-2+/+ mice with the antimetabolite 5-fluorouracil (5-FU), which selectively depletes cycling hematopoietic cells due to cell-cycle–dependent killing.27,28 Marrow was harvested from GATA-2+/– and GATA-2+/+ animals 1 day after 5-FU injection and limiting dilution CAFC assay was performed. After 5-FU challenge, a substantially greater proportion of week-5 CAFCs was scored in the GATA-2+/– group (Figure 4D). These data provide functional validation that GATA-2+/– primitive cells cycle less actively than wild-type controls.

The observed increase in quiescence could render GATA-2+/– primitive cells insensitive to cytokine stimulation, thereby altering their capacity to differentiate into progenitor cells. To address this possibility, we sorted LKS cells from GATA-2+/– and GATA-2+/+ marrow, plated them into methylcellulose medium supplemented with prodifferentiative cytokines, and scored CFC and CFC-GM frequency. There was relative parity in total CFC and GM colony frequency between each genotype (data not shown), suggesting that GATA-2+/– primitive cells retain the ability to differentiate to progenitor cells.

Increased apoptosis of GATA-2+/– primitive marrow cells

Next we assessed whether the smaller GATA-2+/– primitive cell pool may also be caused by augmented cell death and evaluated apoptosis on LKS cells using the annexin-V assay.29 The LKS compartment of GATA-2+/– freshly isolated marrow had a consistently higher proportion of cells in the annexin high/DAPI low population compared with GATA-2+/+ marrow, indicating that GATA-2+/– primitive cells had an increased propensity to undergo apoptosis (Figure 5A). To explore potential molecular mechanisms underlying enhanced apoptosis in GATA-2+/– primitive cells, we surveyed the expression of molecules associated with apoptosis. Of the molecules examined, intracellular flow cytometric analyses revealed attenuated expression of the antiapoptotic protein Bcl-xL in GATA-2+/– LKS cells (Figure 5B-C). Together, these data imply that altered cell survival contributes to the reduced size of the GATA-2+/– functional stem-cell pool and suggest that the increased predisposition of GATA-2+/– primitive cells to undergo apoptosis may be related to decreased Bcl-xL expression.

Normal self-renewal ability of GATA-2+/– marrow stem-cells

To assess if functional changes within the heterozygous stem-cell compartment cause alteration of self-renewal potential in vivo, we performed serial transplantation experiments.30,31 Minimal differences were observed in the survival of animals from both genotypes after 4 sequential transplantations. After the fifth transplantation, however, differences were noted in mortality between the 2 genotypes (Figure 6A). This result could be due to either altered stem-cell self-renewal in GATA-2+/– mice or the paucity of stem-cell number initially transplanted from GATA-2+/– mice. To discern between these 2 possibilities, limiting dilution week-5 CAFC assays were performed. Despite a lower abundance of stem-cells transplanted initially (BMT 0) in the heterozygous group, the 2 genotypes display similar kinetics of week-5 CAFCs during the course of sequential transplantations (Figure 6B). Y-chromosome analysis of recipient marrow at the fourth serial transplantation demonstrated the presence of donor genotype (data not shown). Furthermore, low cell dose transplantation (2 x 105 cells/recipient) in the fourth serial transplantation resulted in uniform fatality in both genotypic groups, arguing against significant host cell contribution to hematopoiesis (data not shown). From these data we infer that the self-renewal capacity of heterozygous stem-cells remains intact.


   Discussion
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
References
 
In this report we used GATA-2+/– mice to examine the effect of GATA-2 level on the stem-cell compartment and to broadly probe the function of GATA-2 in adult mammalian hematopoiesis. Our data show that heterozygosity of GATA-2 has an impact on stem and progenitor cell homeostasis. The most notable phenotype was observed within the primitive cell compartment, where LKSCD34– frequency was reduced, and week-5 CAFC assays and competitive transplantation revealed attenuation in the size of the GATA-2+/– functional stem-cell pool. Of particular note, there was a striking reduction in GATA-2+/– genotype contribution to the marrow of long-term recipients of competitively transplantations. These data jointly support the conclusion that adult stem-cells are compromised in the setting of reduced GATA-2 level.



View larger version (21K):
[in this window]
[in a new window]
  		Figure 5.. Freshly isolated primitive cells from GATA-2+/– bone marrow have an increased susceptibility for apoptosis. Bone marrow nucleated cells were stained with annexin-V, DNA dye DAPI, Sca-1, c-kit, and lineage antibodies, and Sca1+ckit+Lin– cells were analyzed for annexin-V/DAPI activity by flow cytometry. Cells excluding DAPI and binding annexin-V were considered apoptotic (A) (P = .011; n = 6). To examine intracellular Bcl-xL expression, bone marrow nucleated cells were stained with Sca-1, c-kit, and lineage antibodies, and Bcl-xL and the Lin–c-kit+Sca-1+ population was analyzed by flow cytometry. Representative flow cytometry plots for Bcl-xL expression are depicted in panel B; the Bcl-xL–positive fraction was defined relative to the isotype control staining (data not shown). M2 represents the % of Bcl-xL–positive cells. Multiple experiments are summarized in panel C (P = .050; n = 5). Error bars depict the standard error of the mean. All statistical analyses were performed using the Student t test.

 
Less marked reductions were also noted in GATA-2+/– contribution to monocytes, T cells, and B cells in the peripheral blood of transplant recipients. Unexpectedly, GATA-2+/– representation to the mature granulocytic lineage was comparable to that of the GATA-2+/+ genotype. Why GATA-2 expression in stem-cells should affect distinct mature cell lineages in the setting of transplantation is unclear but such an effect is consistent with studies demonstrating that manipulating GATA-2 level in stem-cells alters outgrowth of their lineage-specific progeny in transplantation.15,32



View larger version (12K):
[in this window]
[in a new window]
  		Figure 6.. Bone marrow stem-cells from GATA-2+/+ and GATA-2+/– animals display similar self-renewal potential. Two million bone marrow nucleated cells from male mice of each genotype were injected into female wild-type recipient mice that had been subjected to lethal whole body irradiation. Recipient mice were monitored daily for survival for 2 months. Y-chromosome PCR was used to assess donor contribution in transplantations (data not shown). Irradiated mice injected with PBS alone died within 10 to 14 days of irradiation (data not shown). After 2 months, marrow suspensions were prepared and 2 million nucleated cells were injected into new female irradiated animals. Another 3 transplantations were performed sequentially at 2-month intervals. For each serial transplantation, 10 recipients were injected with each genotypic group. The cumulative survival from the tertiary transplantation onwards is displayed (A). Limiting dilution long-term culture was performed on donor cells prior to transplantation (BMT 0) and after each cycle of transplantation (B) (n = 3 for each transplant, P > .05 for each transplantation cycle). The BMT 0 sample was prepared by pooling cells from the 3 donor mice that initially underwent transplantation. Error bars depict the standard error of the mean. Statistical analysis was performed using the Student t test.

 
Progenitor cells from GATA-2+/– animals, particularly those yielding CFC-GMs, were also decreased, an observation that parallels previous results suggesting that GATA-2 affects the GM pathway.16 Yet the capacity of primitive cells to form CFC-GMs was unimpaired, raising the possibility that the GATA-2+/– genotype may perturb the maintenance and propagation of GM-committed progenitors (N.P.R., P.V., and T.E., unpublished observations, 2004). The normal abundance of granulocytes and monocytes in the peripheral blood of GATA-2+/– animals, however, implies the presence of GATA-2 independent compensatory mechanisms in vivo.

Decreased primitive cell numbers in GATA-2+/– mice was associated with evidence for several potentially contributing mechanisms. Cell cycling of the primitive cell compartment was reduced in the GATA-2+/– animals. Although other studies have suggested that GATA-2 may restrict stem-cell entry into the cycle,14-17 our experiments define that GATA-2 regulates primitive cell quiescence. It was, however, unanticipated that GATA-2+/– mice would have a larger fraction of quiescent primitive cells. Higher levels of GATA-2 cause failure of stem-cell proliferation and the relatively high levels of GATA-2 observed in wild-type bone marrow have been hypothesized to sustain stem-cell dormancy.15 It was therefore expected that lower levels of GATA-2 would abate primitive cell quiescence. Yet we observed that the primitive cell compartment of GATA-2+/– marrow was less proliferative than that of GATA-2+/+ marrow. Cell cycling therefore appears to be sensitive to the level of GATA-2 in either direction. The basis for such effects in GATA-2+/– stem-cells were not addressed here, but may involve modulation of p21 and p27, cell-cycle inhibitors that have been shown to be responsive to alterations in GATA-2 level.17

In addition to altering the prevalence of actively cycling cells, the GATA-2+/– primitive cell pool was more prone to apoptosis than its wild-type counterpart. Furthermore, depressed cell survival from GATA-2+/– stem-cells was marked by alteration in the antiapoptotic gene Bcl-xL expression. Parenthetically, we have noted activation of Bcl-xL after enforced expression of GATA-2 in Paterson factor-dependent cell (FDCP)–mix cells (T.E., unpublished observations, 2004). Relatively high levels of Bcl-xL have been observed within the primitive cell pool,33 yet the function of Bcl-xL in regulating this compartment is unclear. Our data suggest that GATA-2 and Bcl-xL act in concert to modulate stem-cell pool size. It is possible that GATA-2 directly affects Bcl-xL expression as GATA sites are present on the promoter regions of Bcl-xL; however, we did not assess binding of GATA-2 to the Bcl-xL promoter in this study.34 Alternatively, GATA-2 may secondarily affect Bcl-xL levels through effects on other gene products. Whether the changes in cell cycling and apoptosis are related is at present unclear, but a number of other studies have indicated a link between these processes in other cell types.35-38 For example, Bcl-2 family members have been implicated in both apoptotic and cell-cycle regulation.39-42 Future studies will be of interest to determine whether the effects of GATA-2 on quiescence and apoptosis are based on a shared biochemical mechanism.

Although select features of GATA-2+/– stem-cell pool homeostasis were altered, no difference was noted in self-renewal potential between the 2 genotypes after serial transplantation. Diminished survival of GATA-2+/– transplant recipients was apparent after 5 serial transplantations. However, we interpret this as reflective of the lower fraction of GATA-2+/– functional stem-cells transplanted initially. The fact that the change in survival in GATA-2+/– group was observed after 5 transplantations, and not at an earlier stage, further suggests that the GATA-2+/– stem-cell self-renewal remains largely intact during transplantation.

The data presented here were obtained within the context of a single deleted GATA-2 allele. It is largely presumed that in diploid organisms genetic information is expressed from both alleles and that if loss of a single allele were to arise, there would be compensation from the intact allele. However, single allele mutations have previously been shown to induce haploinsufficiency syndromes in both mouse models and human disease.43 Although it is not known how this occurs in the GATA-2 heterozygote mouse, various mechanisms have been proposed to account for the occurrence of haploinsufficiency. Mathematical analyses of gene expression have suggested that haploinsufficiency may relate to stochastic gene initiation and regulation.44 Alternatively, it is possible that GATA-2 may be subject to monoallelic regulation, a controversial phenomenon documented for Toll-like receptor-4.45

How altered expression of a single transcription factor itself can affect cell phenotype is not entirely clear, though precedent for this is well established with other transcription factors in hematopoiesis.46-48 Possible mechanisms include altered stochiometry of interactions with associated transcription factors, competition for target sites, and/or multiprotein complex production/stability. Defining GATA-2 partner proteins and target genes in stem-cells should afford insights into the process.

In addition to the role ascribed to GATA-2 during hematopoietic stem-cell development,5,14 the data here implicate GATA-2 as a critical regulator of the adult stem-cell pool. While other transcription factors such as SCL and AML-1 have been shown to be essential for hematopoietic specification during ontogeny, they appear to be expendable for maintenance of the adult stem-cell compartment.49-53 In marked contrast, GATA-2 has both a critical role in hematopoietic stem-cell development and the maintenance of normal adult stem-cell homeostasis.


   Acknowledgements
 
The authors wish to thank Drs Louise Purton, Heather Fleming (Scadden laboratory), Boris Guyot (Vyas laboratory), Gill May, Alex Tipping (Enver laboratory), and Yuko Fujiwara (Orkin laboratory) for helpful discussions and technical assistance.


   Footnotes
 
Submitted August 2, 2004; accepted December 22, 2004.

Prepublished online as Blood First Edition Paper, April 5, 2005; DOI 10.1182/blood-2004-08-2989.

Supported by the American Society of Hematology (N.P.R.), Lady Tata Memorial Trust (N.P.R.), Dr Mildred Scheel Stiftung für Krebsforschung (V.J.), the National Institutes of Health (D.T.S. and S.H.O.), Burroughs-Wellcome Trust (D.T.S.), the Leukaemia Research Fund UK (T.E.), the Medical Research Council UK (A.S.B and T.E.), and the Wellcome Trust (P.V.).

The online version of the article contains a data supplement.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: David T. Scadden, Center for Regenerative Medicine and Technology, Massachusetts General Hospital-East, Rm 5212D, Bldg 149, 13th St, Boston, MA 02129; e-mail: scadden.david{at}mgh.harvard.edu, or Paresh Vyas, Department of Haematology, Weatherall Institute of Molecular Medicine, Oxford, OX3 9DS, United Kingdom; e-mail: paresh.vyas{at}imm.ox.ac.uk.


   References
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Orkin SH. Diversification of haematopoietic stem cells to specific lineages. Nat Rev Genet. 2000;1: 57-64.[Medline] [Order article via Infotrieve]

  2. Pevny L, Simon MC, Robertson E, et al. Erythroid differentiation in chimaeric mice blocked by a targeted mutation in the gene for transcription factor GATA-1. Nature. 1991;349: 257-260.[CrossRef][Medline] [Order article via Infotrieve]

  3. Simon MC, Pevny L, Wiles MV, Keller G, Costantini F, Orkin SH. Rescue of erythroid development in gene targeted GATA-1-mouse embryonic stem cells. Nat Genet. 1992;1: 92-98.[CrossRef][Medline] [Order article via Infotrieve]

  4. Pandolfi PP, Roth ME, Karis A, et al. Targeted disruption of the GATA3 gene causes severe abnormalities in the nervous system and in fetal liver haematopoiesis. Nat Genet. 1995;11: 40-44.[CrossRef][Medline] [Order article via Infotrieve]

  5. Tsai FY, Keller G, Kuo FC, et al. An early haematopoietic defect in mice lacking the transcription factor GATA-2. Nature. 1994;371: 221-226.[CrossRef][Medline] [Order article via Infotrieve]

  6. Simon MC. Transcription factor GATA-1 and erythroid development. Proc Soc Exp Biol Med. 1993;202: 115-121.[CrossRef][Medline] [Order article via Infotrieve]

  7. Shivdasani RA, Fujiwara Y, McDevitt MA, Orkin SH. A lineage-selective knockout establishes the critical role of transcription factor GATA-1 in megakaryocyte growth and platelet development. EMBO J. 1997;16: 3965-3973.[CrossRef][Medline] [Order article via Infotrieve]

  8. Vyas P, Ault K, Jackson CW, Orkin SH, Shivdasani RA. Consequences of GATA-1 deficiency in megakaryocytes and platelets. Blood. 1999;93: 2867-2875.[Abstract/Free Full Text]

  9. Hirasawa R, Shimizu R, Takahashi S, et al. Essential and instructive roles of GATA factors in eosinophil development. J Exp Med. 2002;195: 1379-1386.[Abstract/Free Full Text]

  10. Yu C, Cantor AB, Yang H, et al. Targeted deletion of a high-affinity GATA-binding site in the GATA-1 promoter leads to selective loss of the eosinophil lineage in vivo. J Exp Med. 2002;195: 1387-1395.[Abstract/Free Full Text]

  11. Orlic D, Anderson S, Biesecker LG, Sorrentino BP, Bodine DM. Pluripotent hematopoietic stem cells contain high levels of mRNA for c-kit, GATA-2, p45 NF-E2, and c-myb and low levels or no mRNA for c-fms and the receptors for granulocyte colony-stimulating factor and interleukins 5 and 7. Proc Natl Acad Sci U S A. 1995;92: 4601-4605.[Abstract/Free Full Text]

  12. Minegishi N, Ohta J, Yamagiwa H, et al. The mouse GATA-2 gene is expressed in the paraaortic splanchnopleura and aorta-gonads and mesonephros region. Blood. 1999;93: 4196-4207.[Abstract/Free Full Text]

  13. Jippo T, Mizuno H, Xu Z, Nomura S, Yamamoto M, Kitamura Y. Abundant expression of transcription factor GATA-2 in proliferating but not in differentiated mast cells in tissues of mice: demonstration by in situ hybridization. Blood. 1996;87: 993-998.[Abstract/Free Full Text]

  14. Tsai FY, Orkin SH. Transcription factor GATA-2 is required for proliferation/survival of early hematopoietic cells and mast cell formation, but not for erythroid and myeloid terminal differentiation. Blood. 1997;89: 3636-3643.[Abstract/Free Full Text]

  15. Persons DA, Allay JA, Allay ER, et al. Enforced expression of the GATA-2 transcription factor blocks normal hematopoiesis. Blood. 1999;93: 488-499.[Abstract/Free Full Text]

  16. Heyworth C, Gale K, Dexter M, May G, Enver T. A GATA-2/estrogen receptor chimera functions as a ligand-dependent negative regulator of self-renewal. Genes Dev. 1999;13: 1847-1860.[Abstract/Free Full Text]

  17. Ezoe S, Matsumura I, Nakata S, et al. GATA-2/estrogen receptor chimera regulates cytokine-dependent growth of hematopoietic cells through accumulation of p21(WAF1) and p27(Kip1) proteins. Blood. 2002;100: 3512-3520.[Abstract/Free Full Text]

  18. Cheng T, Rodrigues N, Dombkowski D, Stier S, Scadden DT. Stem cell repopulation efficiency but not pool size is governed by p27kip1. Nat Med. 2000;6: 1235-1240.[CrossRef][Medline] [Order article via Infotrieve]

  19. Cheng T, Rodrigues N, Shen H, et al. Hematopoietic stem cell quiescence maintained by p21cip1/waf1. Science. 2000;287: 1804-1808.[Abstract/Free Full Text]

  20. Kitajima K, Masuhara M, Era T, Enver T, Nakano T. GATA-2 and GATA-2/ER display opposing activities in the development and differentiation of blood progenitors. EMBO J. 2002;21: 3060-3069.[CrossRef][Medline] [Order article via Infotrieve]

  21. Shapiro HM. Flow cytometric estimation of DNA and RNA content in intact cells stained with Hoechst 33342 and pyronin Y. Cytometry. 1981;2: 143-150.[CrossRef][Medline] [Order article via Infotrieve]

  22. Ploemacher RE, van der Sluijs JP, Voerman JS, Brons NH. An in vitro limiting-dilution assay of long-term repopulating hematopoietic stem cells in the mouse. Blood. 1989;74: 2755-2763.[Abstract/Free Full Text]

  23. Osawa M, Hanada K, Hamada H, Nakauchi H. Long-term lymphohematopoietic reconstitution by a single CD34-low/negative hematopoietic stem cell. Science. 1996;273: 242-245.[Abstract]

  24. Harrison DE. Competitive repopulation: a new assay for long-term stem cell functional capacity. Blood. 1980;55: 77-81.[Abstract/Free Full Text]

  25. Taylor IW. A rapid single step staining technique for DNA analysis by flow microfluorimetry. J Histochem Cytochem. 1980;28: 1021-1024.[Abstract]

  26. Wolf NS, Kone A, Priestley GV, Bartelmez SH. In vivo and in vitro characterization of long-term repopulating primitive hematopoietic cells isolated by sequential Hoechst 33342-rhodamine 123 FACS selection. Exp Hematol. 1993;21: 614-622.[Medline] [Order article via Infotrieve]

  27. Hodgson GS, Bradley TR. Properties of haematopoietic stem cells surviving 5-fluorouracil treatment: evidence for a pre-CFU-S cell? Nature. 1979;281: 381-382.[Medline] [Order article via Infotrieve]

  28. Lerner C, Harrison DE. 5-Fluorouracil spares hemopoietic stem cells responsible for long-term repopulation. Exp Hematol. 1990;18: 114-118.[Medline] [Order article via Infotrieve]

  29. Vermes I, Haanen C, Steffens-Nakken H, Reutelingsperger C. A novel assay for apoptosis: flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled annexin V. J Immunol Methods. 1995; 184: 39-51.[CrossRef][Medline] [Order article via Infotrieve]

  30. Harrison DE, Astle CM, Delaittre JA. Loss of proliferative capacity in immunohemopoietic stem cells caused by serial transplantation rather than aging. J Exp Med. 1978;147: 1526-1531.[Abstract/Free Full Text]

  31. Harrison DE, Astle CM. Loss of stem cell repopulating ability upon transplantation. Effects of donor age, cell number, and transplantation procedure. J Exp Med. 1982;156: 1767-1779.[Abstract/Free Full Text]

  32. Throm S, Persons D. Regulation of primitive hematopoietic cell growth and differentiation by the Gata-2 transcription factor [abstract]. Blood. 2004;104: 2779.

  33. Domen J. The role of apoptosis in regulating hematopoietic stem cell numbers. Apoptosis. 2001; 6: 239-252.[CrossRef][Medline] [Order article via Infotrieve]

  34. Aries A, Paradis P, Lefebvre C, Schwartz RJ, Nemer M. Essential role of GATA-4 in cell survival and drug-induced cardiotoxicity. Proc Natl Acad Sci U S A. 2004;101: 6975-6980.[Abstract/Free Full Text]

  35. Brady HJ, Gil-Gomez G, Kirberg J, Berns AJ. Bax alpha perturbs T cell development and affects cell cycle entry of T cells. EMBO J. 1996;15: 6991-7001.[Medline] [Order article via Infotrieve]

  36. Gil-Gomez G, Berns A, Brady HJ. A link between cell cycle and cell death: Bax and Bcl-2 modulate Cdk2 activation during thymocyte apoptosis. EMBO J. 1998;17: 7209-7218.[CrossRef][Medline] [Order article via Infotrieve]

  37. Uren AG, Beilharz T, O'Connell MJ, et al. Role for yeast inhibitor of apoptosis (IAP)-like proteins in cell division. Proc Natl Acad Sci U S A. 1999;96: 10170-10175.[Abstract/Free Full Text]

  38. Li F, Flanary PL, Altieri DC, Dohlman HG. Cell division regulation by BIR1, a member of the inhibitor of apoptosis family in yeast. J Biol Chem. 2000;275: 6707-6711.[Abstract/Free Full Text]

  39. Mazel S, Burtrum D, Petrie HT. Regulation of cell division cycle progression by bcl-2 expression: a potential mechanism for inhibition of programmed cell death. J Exp Med. 1996;183: 2219-2226.[Abstract/Free Full Text]

  40. Linette GP, Li Y, Roth K, Korsmeyer SJ. Cross talk between cell death and cell cycle progression: BCL-2 regulates NFAT-mediated activation. Proc Natl Acad Sci U S A. 1996;93: 9545-9552.[Abstract/Free Full Text]

  41. O'Reilly LA, Huang DC, Strasser A. The cell death inhibitor Bcl-2 and its homologues influence control of cell cycle entry. EMBO J. 1996;15: 6979-6990.[Medline] [Order article via Infotrieve]

  42. Janumyan YM, Sansam CG, Chattopadhyay A, et al. Bcl-xL/Bcl-2 coordinately regulates apoptosis, cell cycle arrest and cell cycle entry. EMBO J. 2003;22: 5459-5470.[CrossRef][Medline] [Order article via Infotrieve]

  43. Seidman JG, Seidman C. Transcription factor haploinsufficiency: when half a loaf is not enough. J Clin Invest. 2002;109: 451-455.[CrossRef][Medline] [Order article via Infotrieve]

  44. Cook DL, Gerber AN, Tapscott SJ. Modeling stochastic gene expression: implications for haploinsufficiency. Proc Natl Acad Sci U S A. 1998;95: 15641-15646.[Abstract/Free Full Text]

  45. Pereira JP, Girard R, Chaby R, Cumano A, Vieira P. Monoallelic expression of the murine gene encoding Toll-like receptor 4. Nat Immunol. 2003;4: 464-470.[CrossRef][Medline] [Order article via Infotrieve]

  46. Emambokus N, Vegiopoulos A, Harman B, Jenkinson E, Anderson G, Frampton J. Progression through key stages of haemopoiesis is dependent on distinct threshold levels of c-Myb. EMBO J. 2003;22: 4478-4488.[CrossRef][Medline] [Order article via Infotrieve]

  47. DeKoter RP, Singh H. Regulation of B lymphocyte and macrophage development by graded expression of PU.1. Science. 2000;288: 1439-1441.[Abstract/Free Full Text]

  48. McDevitt MA, Shivdasani RA, Fujiwara Y, Yang H, Orkin SH. A "knockdown" mutation created by cis-element gene targeting reveals the dependence of erythroid cell maturation on the level of transcription factor GATA-1. Proc Natl Acad Sci U S A. 1997;94: 6781-6785.[Abstract/Free Full Text]

  49. Ichikawa M, Asai T, Saito T, et al. AML-1 is required for megakaryocytic maturation and lymphocytic differentiation, but not for maintenance of hematopoietic stem cells in adult hematopoiesis. Nat Med. 2004;10: 299-304.[CrossRef][Medline] [Order article via Infotrieve]

  50. Okuda T, van Deursen J, Hiebert SW, Grosveld G, Downing JR. AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis. Cell. 1996;84: 321-330.[CrossRef][Medline] [Order article via Infotrieve]

  51. Porcher C, Swat W, Rockwell K, Fujiwara Y, Alt FW, Orkin SH. The T cell leukemia oncoprotein SCL/tal-1 is essential for development of all hematopoietic lineages. Cell. 1996;86: 47-57.[CrossRef][Medline] [Order article via Infotrieve]

  52. Shivdasani RA, Mayer EL, Orkin SH. Absence of blood formation in mice lacking the T-cell leukaemia oncoprotein tal-1/SCL. Nature. 1995;373: 432-434.[CrossRef][Medline] [Order article via Infotrieve]

  53. Mikkola HK, Klintman J, Yang H, et al. Haematopoietic stem cells retain long-term repopulating activity and multipotency in the absence of stem-cell leukaemia SCL/tal-1 gene. Nature. 2003;421: 547-551.[CrossRef][Medline] [Order article via Infotrieve]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 BloodHome page
A. J. Tipping, C. Pina, A. Castor, D. Hong, N. P. Rodrigues, L. Lazzari, G. E. May, S. E. W. Jacobsen, and T. Enver
High GATA-2 expression inhibits human hematopoietic stem and progenitor cell function by effects on cell cycle
Blood, March 19, 2009; 113(12): 2661 - 2672.
[Abstract] [Full Text] [PDF]

Home page
 Cold Spring Harb Symp Quant BiolHome page
B.P. Levi and S.J. Morrison
Stem Cells Use Distinct Self-renewal Programs at Different Ages
Cold Spring Harb Symp Quant Biol, January 15, 2009; (2009) sqb.2008.73.049v1.
[Abstract] [PDF]

Home page
 BloodHome page
N. P. Rodrigues, A. S. Boyd, C. Fugazza, G. E. May, Y. Guo, A. J. Tipping, D. T. Scadden, P. Vyas, and T. Enver
GATA-2 regulates granulocyte-macrophage progenitor cell function
Blood, December 15, 2008; 112(13): 4862 - 4873.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
A. R. Soliera, M. R. Lidonnici, G. Ferrari-Amorotti, M. Prisco, Y. Zhang, R. V. Martinez, N. J. Donato, and B. Calabretta
Transcriptional repression of c-Myb and GATA-2 is involved in the biologic effects of C/EBP{alpha} in p210BCR/ABL-expressing cells
Blood, September 1, 2008; 112(5): 1942 - 1950.
[Abstract] [Full Text] [PDF]

Home page
 Stem CellsHome page
P. Brunet de la Grange, E. Zink, F. Armstrong, M.-C. Rouyez, and F. Pflumio
Impairment of Granulo-Monocytic Development of Human Common Myeloid Progenitors but Not of Granulo-Monocytic Progenitors by Decreasing Stem Cell Leukemia/T-Cell Acute Leukemia 1 Expression
Stem Cells, June 1, 2008; 26(6): 1658 - 1662.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
S. L. McKinney-Freeman, C. Lengerke, I.-H. Jang, S. Schmitt, Y. Wang, M. Philitas, J. Shea, and G. Q. Daley
Modulation of murine embryonic stem cell-derived CD41+c-kit+ hematopoietic progenitors by ectopic expression of Cdx genes
Blood, May 15, 2008; 111(10): 4944 - 4953.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
S. Koga, N. Yamaguchi, T. Abe, M. Minegishi, S. Tsuchiya, M. Yamamoto, and N. Minegishi
Cell-cycle-dependent oscillation of GATA2 expression in hematopoietic cells
Blood, May 15, 2007; 109(10): 4200 - 4208.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
M. A. Dao and J. A. Nolta
Cytokine and integrin stimulation synergize to promote higher levels of GATA-2, c-myb, and CD34 protein in primary human hematopoietic progenitors from bone marrow
Blood, March 15, 2007; 109(6): 2373 - 2379.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
V. Jankovic, A. Ciarrocchi, P. Boccuni, T. DeBlasio, R. Benezra, and S. D. Nimer
Id1 restrains myeloid commitment, maintaining the self-renewal capacity of hematopoietic stem cells
PNAS, January 23, 2007; 104(4): 1260 - 1265.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. L. Martowicz, J. A. Grass, and E. H. Bresnick
GATA-1-mediated Transcriptional Repression Yields Persistent Transcription Factor IIB-Chromatin Complexes
J. Biol. Chem., December 8, 2006; 281(49): 37345 - 37352.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
P. B. de la Grange, F. Armstrong, V. Duval, M.-C. Rouyez, N. Goardon, P.-H. Romeo, and F. Pflumio
Low SCL/TAL1 expression reveals its major role in adult hematopoietic myeloid progenitors and stem cells
Blood, November 1, 2006; 108(9): 2998 - 3004.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
R. F. de Pooter, T. M. Schmitt, J. L. de la Pompa, Y. Fujiwara, S. H. Orkin, and J. C. Zuniga-Pflucker
Notch Signaling Requires GATA-2 to Inhibit Myelopoiesis from Embryonic Stem Cells and Primary Hemopoietic Progenitors
J. Immunol., May 1, 2006; 176(9): 5267 - 5275.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
G. V. Priestley, L. M. Scott, T. Ulyanova, and T. Papayannopoulou
Lack of {alpha}4 integrin expression in stem cells restricts competitive function and self-renewal activity
Blood, April 1, 2006; 107(7): 2959 - 2967.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figures
Right arrow All Versions of this Article:
2004-08-2989v1
106/2/477    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rodrigues, N. P.
Right arrow Articles by Scadden, D. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rodrigues, N. P.
Right arrow Articles by Scadden, D. T.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Gene Expression
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2005 by American Society of Hematology         Online ISSN: 1528-0020