| |
|
|
|
|
|
|
|||
|
Blood, 1 August 2005, Vol. 106, No. 3, pp. 996-1002. Prepublished online as a Blood First Edition Paper on April 14, 2005; DOI 10.1182/blood-2005-02-0707.
IMMUNOBIOLOGY Crystal structure of the Jak3 kinase domain in complex with a staurosporine analogFrom the Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Dana-Farber Cancer Institute, Boston, MA; the Department of Cancer Biology, Dana-Farber Cancer Institute, Boston, MA; and the Novartis Institutes for Biomedical Research, CH-4002 Basel, Switzerland.
Jak (Janus kinase) family nonreceptor tyrosine kinases are central mediators of cytokine signaling. The Jak kinases exhibit distinct cytokine receptor association profiles and so transduce different signals. Jak3 expression is limited to the immune system, where it plays a key role in signal transduction from cytokine receptors containing the common gamma-chain, c. Patients unable to signal via c present with severe combined immunodeficiency (SCID). The finding that Jak3 mutations result in SCID has made it a target for development of lymphocyte-specific immunosuppressants. Here, we present the crystal structure of the Jak3 kinase domain in complex with staurosporine analog AFN941. The kinase domain is in the active conformation, with both activation loop tyrosine residues phosphorylated. The phosphate group on pTyr981 in the activation loop is in part coordinated by an arginine residue in the regulatory C-helix, suggesting a direct mechanism by which the active position of the C-helix is induced by phosphorylation of the activation loop. Such a direct coupling has not been previously observed in tyrosine kinases and may be unique to Jak kinases. The crystal structure provides a detailed view of the Jak3 active site and will facilitate computational and structure-directed approaches to development of Jak3-specific inhibitors.
The Janus kinase (Jak) family of cytoplasmic tyrosine kinases are essential for signal transduction from a wide variety of cell-surface receptors. There are 4 members of the family in vertebrates: Jak1, Jak2, Jak3, and tyrosine kinase 2 (Tyk2).1,2 Jak kinases share a characteristic domain architecture, which includes an amino-terminal FERM domain (Band 4.1, Ezrin, Radixin, Moesin homology domain), an src homology 2 (SH2)like region, a pseudokinase domain, and a carboxy-terminal kinase domain. Parts of these structural domains have historically been termed Jak homology (JH) domains 1 through 7, based on primary sequence alignments. The FERM domain mediates association with the cytoplasmic region of cytokine receptors and may also participate in catalytic regulation. The function and activity of the SH2-like region is unclear. The pseudokinase (or JH2) domain is unique to Jak kinases. This domain is thought to have a protein kinase fold but to lack catalytic activity, as residues critical for phosphotransfer are absent. The pseudokinase domain has been shown to be intrinsic to the autoregulation of Jak kinases via a direct interaction with the kinase domain.3 The JH1 kinase domain lies at the C-terminus and is a functional tyrosine kinase. To date, no 3-dimensional structure has been reported for any portion of any of the Jak kinases. A wide variety of cytokine receptor superfamily members signal via the Jak/Stat (signal transducer and activator of transcription) pathway, including granulocyte colony-stimulating factor (G-CSF), thrombopoietin, the interferons, erythropoietin, and the interleukins. The Jak/Stat pathway is consequently involved in regulation of diverse cell processes, including proliferation, differentiation, migration, and apoptosis.1,2
In a significant number of patients with severe combined immunodeficiency (SCID), the disease arises from mutations either in the cytokine receptor common gamma-chain, The profound immune-specific effects of disrupted Jak3 signaling highlight the possibility of therapeutic targeting of Jak3 as a highly specific mode of immune system suppression.9 Potentially, a Jak3-specific inhibitor would target the immune system by depleting natural killer and T cells through down-regulation of cell proliferation. Jak3-specific inhibitors are being studied as supplements to current organ transplant rejection therapies and to treat T-cellspecific autoimmune diseases, including psoriasis, multiple sclerosis, inflammatory bowel disease, and rheumatoid arthritis.10 Jak-specific inhibitors may also be useful for treatment of hematologic and other malignancies that involve pathologic Jak activation.11 Activated translocated ets leukemia (TEL) protein/Jak2 fusions are produced by chromosomal translocations in some human leukemias,12 and Jak activation has been shown to be transforming when activated by other tyrosine kinase oncogenes. For example v- and breakpoint cluster region-abelson (BCR-Abl) activate the Jak/Stat signaling pathway.13-15 Thus Jak-specific inhibitors may be useful to augment kinase-specific treatments such as imatinib mesylate (Novartis Pharma AG, Basel, Switzerland) for CML. A number of Jak-specific inhibitors are currently in clinical and preclinical trials,9 with CP-690550 (Pfizer, New York, NY) showing some selectivity for Jak3 (IC50 [inhibitory concentration 50%] Jak1, 112 nM; Jak2, 20 nM; Jak3, 1 nM) and demonstrating efficacy against organ allograft rejection.16 We describe here the crystal structure of the Jak3 kinase domain in complex with a staurosporine-based inhibitor. The kinase is in an active, doubly phosphorylated state. The structure provides mechanistic insights into Jak activation and provides a detailed view of the kinase that will facilitate development of Jak-specific inhibitors.
Synthesis of AFN941 2,3,10,11,12,13,15,16,17,18-Decahydro-10-methoxy-9-methyl-11-(methylamino)-(9S,10R,11R,13R)-9,13-epoxy-1H,9H-di-indolo[1,2,3-gh:3',2',1'-lm]pyrrolo[3,4-j][1,7]benzodiazonin-1-one (5, 1,2,3,4-tetrahydrostaurosporin). A solution of staurosporine was incubated (20 g, 42.9 mmol) in Tetrahydrofuran (THF; 1 L) containing Pd/C (30 g of 10%) for 120 hours at 65°C and 30 bar H2; the mixture was filtered, and the residue was washed with THF. The combined filtrate and washings were evaporated to dryness under reduced pressure to give the crude product which was chromatographed (silica gel, eluent 5% MeOH, 95% CH2Cl2) and recrystallized from MeOH to give AFN941 as a white powder: melting point 252°C to 255°C (tartrate 238-245°C). Cloning, expression, and purification of Jak3 kinase A cDNA encoding the kinase domain (residues 811-1124) of human Jak317-19 was obtained from a human spleen-liver-placenta library (Stratagene, La Jolla, CA) using primers 5'-3' caagaccccacgatcttcgagg and 3'-5' tgaaaaggacagggagtggtgtttgccc. The cDNA was subcloned into transfer vector pAcG2T (Pharmingen, San Diego, CA) using BamHI (5') and EcoRI (3') restriction enzyme sites. Recombinant baculovirus was generated using the Baculogold expression system (Pharmingen). The kinase domain was expressed as a glutathione S transferase (GST) fusion protein in High 5 cells (Invitrogen, Carlsbad, CA).
High 5 cells infected with the recombinant baculovirus were grown in shaker flasks and Express 5 serum-free medium (Invitrogen). Cells were infected at a density of 1.6 x 106 cells/mL with 20 mL virus and harvested 72 hours after infection. The cells were resuspended in 20 mM Tris (tris(hydroxymethyl)aminomethane)HCl, pH 6.8, 150 mM NaCl, 5 mM DTT (dithiothreitol), 10% glycerol, supplemented with complete protease inhibitor mixture (Roche Diagnostics GmbH, Mannheim, Germany) and flash-frozen in liquid nitrogen and stored overnight at -80°C. On thawing the cells were disrupted by sonication. Cell debris was removed by centrifugation (45 000 g, 1 hour, 4°C) and the supernatant was incubated for 1 hour with glutathione Sepharose beads (Amersham Biosciences AB, Uppsala, Sweden). The beads were washed with Tris-buffered saline (TBS) supplemented with 5 mM DTT and 10% glycerol and then incubated overnight with 5 µL of 3 mg/mL human Crystallization and diffraction data collection Following incubation with inhibitor AFN941 for 1 hour on ice (5 µL protein at 5 mg/mL, 0.25 µL AFN941 at 50 mM, and 0.2 µL DTT at 1 M) and centrifugation at 16 000 g for 30 minutes, crystallization trays were set up. Crystallization trays were set up at 4°C using hanging-drop vapor diffusion methodology with reservoirs containing 50 mM Pipes (1,4-piperazinedi-ethanesulfonic acid) pH 6, 960 mM Na malonate pH 6, 1.6% glycerol, and 10 mM DTT. Crystallization drops contained 0.3 µL precipitant buffer and 0.5 µL protein solution. A crystal appeared after 2 weeks and grew to its final dimension (100 x 100 x 200 µm) in 4 weeks. The primitive orthorhombic cell had dimensions a = 46.3 Å, b = 54.2 Å, and c = 118.6 Å. For data collection the mother liquor in the drop was substituted with 2M Na malonate, pH 6. The crystal was flash frozen to 100K using an in-house cryostream. Data were collected at 100K in house on a Rigaku (The Woodlands, TX) RU300-RC rotating anode X-ray generator with Osmic Confocal Max-Flux (CMF12-38Cu6) optics and a Mar345dtb image plate area detector (Mar Research, Norderstedt, Germany). The data were processed in space group P212121 with DENZO and scaled using SCALE-PACK.20 Data are summarized in Table 1.
Structure determination and refinement Structure determination by molecular replacement was implemented with PHASER23,24 using the EGFR kinase domain (residues 672 to 960 of Protein Data Bank [PDB] submission code 1M17 [PDB] ; http://www.rscb.org/pdb/) as the search model. The correct solution yielded a log(likelihood) gain of 150 in the 25 to 2.55 Å resolution range. The program Arp-Warp was then used to build from the molecular replacement model in an automated fashion.25 Next, repeated rounds of manual refitting and crystallographic refinement were then performed in O v9.0.726 and CNS v1.1.21 Staurosporine analog AFN941 was modeled into a region of closely fitting positive Fobs - Fcalc electron density in the catalytic cleft of the crystal structure. Stereochemical parameter files for the ligand were generated using PRODRG.27 The final crystallographic model was evaluated using Procheck,22 and waters were added using the program O. The final crystallographic model has an R-factor of 20.4% and an R-free of 25.4%. Crystallographic data deposition Refined crystallographic coordinates for the kinase domain of Jak3 in complex with staurosporine analog AFN941 are deposited in the Protein Data Bank and are assigned an accession code 1YVJ [PDB] .
Structure determination
The crystal structure of the tyrosine kinase domain of human Jak3 has been determined at 2.55 Å resolution and refined to an R factor of 20.4% (Table 1; "Materials and methods"). The crystallographic model includes residues Pro814 to Arg1103 of Jak3, the tetrahydrostaurosporine inhibitor AFN941, 2 dithiothreitol molecules, and 166 water molecules (Figure 1). The first 5 and last 21 residues in the expressed protein are not visible, and the electron density is weak for 3 presumably flexible loops (those connecting Overall structure
The Jak3 kinase domain exhibits the classic bilobed architecture conserved among the catalytic domains of all protein kinases28 (Figure 1). The N-terminal lobe contains a 6-stranded antiparallel
Jak3 is crystallized in a catalytically active state and is tyrosine-phosphorylated on both of the autophosphorylation sites in the activation loop. The overall conformation of the kinase, including the position of the C-helix, the interlobe orientation, and the conformation of the activation loop, closely resembles that found in other active tyrosine kinases (Figure 1A-B). Among tyrosine kinases for which structures are available the present structure superimposes most closely with that of the Abl kinase domain in complex with inhibitor Pd17395529 (PDB entry 1M52
[PDB]
, Chain A). Corresponding residues from Jak3 and this Abl structure superimpose with an RMS deviation of 1.4 Å for 234 matching carbon-
The architecture of the Jak3 kinase domain diverges significantly in 2 respects from other tyrosine kinases studied to date. Jak3 contains an additional helix formed by residues 1029 through 1038, which is inserted between helices SCID-related Jak3 mutations The majority of Jak3 point mutations found in human SCIDs are either nonsense mutations or frameshift mutations that lead to truncation of the translated protein and hence loss of function. A single missense mutation has been documented in the fragment of Jak3 studied here; this mutation leads to substitution of Leu910 with serine. Examination of the structure reveals that Leu910 is located proximal to the catalytic site (Figure 2D), and is largely buried in a hydrophobic environment. Substitution of a hydrophobic leucine residue at this position with the polar serine residue would be expected to produce at least a local structural disruption and hence a loss of catalytic function.
The activation loop (and active site) Activation of Jak kinases involves phosphorylation of 2 tyrosines within the activation loop, Tyrosines 980 and 981 in Jak3. Although the structures of many tyrosine kinases have been determined in "active" conformations, surprisingly few have been studied with the activation loop actually phosphorylated. To date, only lymphocyte-specific kinase (Lck),30 the insulin receptor tyrosine kinase (IRTK),31 and insulin-like growth factor receptor-1 (IGFR-1)32 (which is very closely related to the IRTK) have been studied in the phosphorylated state (vascular endothelial growth factor 2 [VEGF2] is phosphorylated on the activation loop but is not in an active conformation33). Analysis of the Jak3 activation loop reveals features in common with these kinases but also important differences which suggest a unique mechanism by which phosphorylation promotes coalescence of the active site in Jak kinases.
The Jak activation loop adopts an extended conformation with 2
The second phosphorylated tyrosine in the Jak3 activation loop, pTyr980, is in an equivalent position to pTyr1162 in IRTK. This phosphotyrosine points outward, away from the protein core toward the solvent, and it appears to play a lesser role in stabilizing the active conformation of the activation loop. Its phosphate group contacts Lys978 and 3 ordered water molecules. Interestingly, in a study of Jak3 regulation phosphorylation of Tyr980 was observed to play a positive role in activation and phosphorylation of Tyr981 a negative regulatory role.36 The structural basis for these findings is unclear. It is possible that phosphorylation at the 2 sites differently affects binding of peptide substrates, or that the substitution of these tyrosines with phenylalanine,36 does not accurately mimic the nonphosphorylated tyrosine. Such a confounding effect would not be unexpected if Tyr981 plays a key role in maintaining an autoinhibited conformation in Jak3, as the corresponding Tyr1163 does in IRTK.37 Structural analysis of Jak3 in complex with substrate peptides and in the inactive state may further address these issues.
AFN941 binding mode and the active site cleft Ligand AFN941 binds Jak3 in the catalytic cleft between the N- and C-lobes of the kinase. The inhibitor sits in a pocket bounded by the glycine-rich P-loop, the hinge segment, and the extreme N-terminus of the activation-loop (Figure 2B). The N-terminal portion of the activation loop, which bears the highly conserved sequence Asp-Phe-Gly (DFG), adopts the "inward" conformation characteristic of active kinases. The electron density for the ligand is well defined (Figure 2C), and it refines with an overall B-factor of 22.6 Å2, comparable to that of the structure as a whole. The ligand binds in approximately the position occupied by the adenine ring of ATP in previously solved kinase crystal structures, and in a fashion analogous to that seen in previously reported kinase-staurosporine complexes. AFN941 is derived from staurosporine and differs only in that one indole ring system has been hydrogenated to break its planarity, thereby increasing the solubility of the compound (Figure 2A). The deepest part of the binding pocket is defined by residue Met902, the so-called gate-keeper residue, with 2 atoms of the indole ring of AFN941 abutting this residue (Figure 2B). The ligand binding pocket is bounded in the back by hinge region residues Met902 through Cys909. Two hydrogen bonding interactions take place between the lactam ring of the staurosporine analog and backbone atoms of the hinge. The carbonyl oxygen of residue Glu903 interacts with the lactam ring amide with a distance of 2.9 Å, and the backbone nitrogen of Leu905 bonds to the keto-oxygen of the lactam ring with distance of 2.9 Å. The tetrahydro-indole ring adopts a chair conformation and sits in the region of the catalytic cleft termed the "lipophilic plug" (Figure 2A). The glycosidic group of AFN941 is in a boat conformation and is perpendicular to the plane of the indolocarbazole ring system. A hydrogen bond is formed between the carbonyl oxygen of residue Arg953 and the methylamino nitrogen of the glycosidic ring of AFN941 with a distance of 2.9 Å. The methylamino nitrogen also makes a hydrogen bond to a water molecule. The ligand is also in van der Waals contact with a number of side chains, including between Leu828, Val836, and Ala853 in the roof of the binding cleft and between Leu956 and Gly908 in the floor of the cleft.
Comparison of the Jak3/AFN941 complex with available tyrosine kinase/staurosporine complexes reveals that the closest similarity is with Lck bound to staurosporine38 (PDB entry 1QPJ
[PDB]
, with 229 carbon- In addition to the clear density for AFN941, additional electron density is visible for 2 similarly shaped nonwater ligands. One is in a solvent channel proximal to residues Leu973, Ala877, Leu878, and Arg943; the second is seen in the triphosphate region of the active site cleft, abutting the staurosporine analog. The electron density for both of these ligands is well-fit by DTT, which was a component of the crystallization buffer. Neither appears to be covalently coordinated to the protein. The putative DTT molecule in the active site region is proximal to residues Gly831 through Gly834 of the P-loop, and to Asp967, Gln988, Lys855, and Leu970. The interactions made by this moiety in the active site cleft may be exploited in structure-directed design of Jak3 inhibitors. Insights for inhibitor development Inhibitor specificity is a particularly critical issue for development of therapeutically useful inhibitors of Jak3 for use in transplantation. For this indication, treatment is typically long term, and inhibition of the very closely related Jak2 is undesirable. Jak2 activity is required for erythropoietin, thrombopoietin, and G-CSF signaling, so cross-inhibition of Jak2 might be expected to result in therapeutic side effects, including anemia, thrombocytopenia, and generalized leukopenia. Jak3 shares sequence identity of 62% with Jak2, and almost all residues in the inhibitor binding cleft are conserved (Figure 1C). Sequence differences between Jak3 and Jak2 that are proximal to the catalytic cleft are illustrated in Figure 2C. Two notable differences in residues abutting the staurosporine analog are at residues Cys909 and Ala966, which in Jak2 are replaced by serine and glycine, respectively. Thiol-based interactions with the cysteine in Jak3 might be exploited to achieve specificity for Jak3 over Jak2 and many other tyrosine kinases that do not have a cysteine at this position. Similarly, steric clash with the methyl side chain of Ala966 in Jak3 might be used as a design strategy in development of compounds with enhanced selectivity for Jak2 over Jak3. A Jak2-specific inhibitor could be useful for treatment of leukemias that result from translocations that fuse the dimerization domain of the Tel transcription factor with the Jak2 kinase.11,12 Although staurosporine and its analogues are not therapeutically useful because of their pan-specificity and toxicity, the present structure provides the first view of the Jak3 kinase domain and will be useful for computational chemistry approaches to inhibitor discovery and optimization. Furthermore, we expect that the Jak3 expression, purification, and crystallization procedures described here will be useful for cocrystallization of Jak3 with specific inhibitors as they are discovered and developed.
We thank Florence Poy and Yingwu Xu for help designing cloning and purification protocols.
Submitted February 22, 2005; accepted April 5, 2005.
Prepublished online as Blood First Edition Paper, April 14, 2005; DOI 10.1182/blood-2005-02-0707.
Supported by an American Society of Hematology Basic Research Scholar Award (T.J.B.), by the National Institutes of Health (NIH; grant CA080942) (M.J.E.), and by a Scholar Award from the Leukemia and Lymphoma Society (M.J.E.).
An Inside Blood analysis of this article appears in the front of this issue.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Michael J. Eck, Rm SM 10-36, Dana-Farber Cancer Institute, 44 Binney St, Boston, MA 02115; e-mail: eck{at}red.dfci.harvard.edu.
Related Article in Blood Online:
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||