|
|
Blood, 1 September 2005, Vol. 106, No. 5, pp. 1887-1888.
Previous Article | Table of Contents
CORRESPONDENCE
To the editor:
Independent clones at separable stages of differentiation, bearing different GATA1 mutations, in the same TMD patient with Down syndrome
Somatic mutations of the megakaryocytic and erythroid differentiation factor GATA1 in transient myeloproliferative disorder (TMD) of Down syndrome (DS) occur in utero,1-5 and are detectable in fetal liver.1 Multiple GATA1 mutations can occur in the same DS-TMD patient.5 The exact cell type and developmental time-frame in which these mutations occur have not yet been identified. If the acquisition of such mutations occurs within a very limited time frame at a specific stage of differentiation, one would expect individual clones from a case of DS-TMD with multiple independent clones to be arrested at a similar stage of differentiation. We present data which argue against this hypothesis, and demonstrate for the first time that multiple independent GATA1 mutations in the same individual can be found in clones physically separable from each other by surface maturation markers (Figure 1A).
A female DS neonate (patient TMD2 in a previous report2) presented with typical symptoms of TMD; 2 days after birth, a peripheral-blood (PB) sample was taken from which an aliquot was sorted for CD34+ and CD34- blast-cell populations. Reverse transcriptase-polymerase chain reaction (RT-PCR) analysis (Figure 1B) detected the full-length GATA1 transcript as well as a shorter transcript lacking exon 2 (splice -exon 2) in the patient's presentation sample and the CD34- cells, whereas her CD34+ cells lacked the full-length product. Sequencing of the RT-PCR product from the unsorted presentation sample2 revealed a 34-base pair (bp) duplication in GATA1 exon 2. However, cloning of the RT-PCR products revealed additional mutations, each causing translation of a typically truncated6 GATA1 protein. Unsorted and CD34- cells were found to carry 3 different mutations (dup34, ins8, and dup4; Figure 1Ci-iii), which were present on different chromosomes and represent independent clonal proliferations (not shown). CD34+ cells carried splice -exon 2 as the sole form of GATA1 transcript (Figure 1Civ). Genomic DNA cloning and sequencing from these CD34+ cells revealed the ins8 and dup4 mutations, but not the dup34 mutation (not shown). This was confirmed by PCR amplification from genomic DNA using dup34-allele-specific primers (Figure 1D), which amplified the specific product in the presentation sample but not in CD34+ cells. Therefore, the dup34 of exon 2, a predominant change in the RNA of the presentation sample,2 could only have been contributed by the CD34-, and not CD34+, GATA1-expressing cells.
In summary, we have demonstrated the presence of several independent clonal expansions at different stages of megakaryocytic differentiation in a single case of DS-TMD. As all of the observed GATA1 mutations result in the same truncated protein,6,7 it is unlikely that individual mutations could determine the degree of differentiation arrest or the propensity for proliferation. Therefore, the observation that proliferating blasts bearing different GATA1 mutations are detected at different stages of megakaryocytic differentiation may possibly be explained by independent clones that vary in their stage of differentiation at the time of acquisition of their respective mutations, or by further differentiation of the proliferating clone occurring despite these mutations, which occurred at some distance apart during fetal development. Alternatively, the dup34 clone could have acquired an additional mutation, causing the loss of CD34 expression. Hypothetical additional TMD-triggering mutations might explain why trisomy-21 fetuses can show GATA1 mutations early in gestation without overt fetal leukemia.1 The first explanation is compatible with the predictions reached through mouse models: that GATA1 mutations may occur at various time points in hematopoietic ontogeny, but confer a proliferative advantage only to early, time-limited fetal progenitors.8

View larger version (45K):
[in this window]
[in a new window]
|
Figure 1.. Analysis of GATA1 mutations within the subpopulations of blasts in a patient (TMD2) with Down syndrome. All patient samples were used with consent obtained by the Italian Association for Paediatric Oncology (AIEOP), and the study was approved by the North East London Health Authority's ethics committee. Peripheral-blood samples were taken 2 days after birth, with clinical signs of myeloproliferative disorder (a white blood cell count of 175 x 103; morphology AML-M7; 50% blasts; karyotype 47XX+21). All other patients (TMD "n"), shown as amplification controls, were described for their GATA1 mutations in a previous report.2 The immunophenotyping study of patient-TMD2 blasts demonstrated that approximately 60% were CD34+, and most blasts also stained positive for CD7, CD33, CD61, CD41 and CD42a. Cells were sorted (> 98% pure, tested in an EpicsXL [Beckman-Coulter, High Wycombe, Bucks, United Kingdom]) using monoclonal antibody CD34 fluorescein isothiocyanate (FITC) and FACSVantage SE (Becton Dickinson, Plymouth, Devon, United Kingdom). RNA (RNABee; Biogenesis, Poole, Dorset, United Kingdom) and DNA were isolated using standard protocols. RT-PCR analysis was performed using GATA1 primers E1F (GATCACACTGAGCTTGCCAC) and E3R (TCCCCTCCATACAGTTGAGC). PCR from genomic DNA was performed with primers I1F (GGATTTCTGTGTCTGAGGAC) and I2R (CCAACAGCACTCAGCCAATG). PCR products were cloned using the TA cloning kit from Invitrogen (Paisley, Glasgow, United Kingdom), and sequencing was carried out with reagents from Applied Biosystems (Warrington, Cheshire, United Kingdom) on an ABI 3100 Genetic Analyzer. (A) Summary of different GATA1 mutations in patient TMD2. *Completely negative in genomic DNA by allele-specific PCR (see panel D). **Only detectable in genomic DNA. (B) Agarose-gel electrophoresis of RT-PCR products from the following samples: (1) TMD2 presentation, (2) TMD2 CD34-,(3) TMD2 CD34+, (4) TMD7 presentation, (5) TMD3 CD34-, (6) TMD3 CD34+, (7) non-leukemic DS cord blood CD34-, (8) non-leukemic DS cord blood CD34+, (9) normal cord blood CD34-, (10) normal cord blood CD34+, (11) minus RT, (12) H2O. A short, 99-bp PCR product lacking exon 2 (splice -exon 2) can be seen in all samples. This product is physiologically present.4 Full-length GATA1 transcripts were present in the presentation of patient TMD2 and that patient's CD34- cells. CD34+ cells from patient TMD2 lacked the full-length product. Another patient, TMD7, also demonstrated splice -exon 2 as the only transcript. The complete absence of exon-2-containing transcripts is not a CD34+-cell-specific phenomenon or sorting artifact, as CD34+ cells sorted by the same lab from patient TMD3 and cord-blood samples contained a full-length transcript (lanes 5-10). No splice-defect-causing mutations were detected in genomic DNA sequences from CD34+ cells from the middle of exon 1 through the entire length of intron 1-exon 2-intron 2-exon 3 (a total of 5630 bp). (C) Cloning and sequencing of PCR products and examples of mutations that were detected. The insertions are underlined. Only part of dup34 is displayed. The positions of the mutations are according to accession number NM_002049
[GenBank]
. (Ci-iii): RT-PCR from patient-TMD2 CD34- cells. (iv) RT-PCR from patient-TMD2 CD34+ cells. (D) Mutation dup34 allele-specific PCR from genomic DNA of the following samples: lanes 1, 5: patient-TMD2 presentation; lanes 2, 6: patient-TMD2 CD34+ cells; lanes 3, 7: patient TMD1; lanes 4, 8: H2O. For lanes 1-4, primers used were GATA1-dup34 (AGCTTCCTCCACTGCCTGAG) and I2R. Lanes 5-8 show control PCR for an unrelated gene with primers SAMSN1F (AGGCAAACCGAAGGAGTAAC) and 1R (TCGGTGTTTCCATTTACATGC). Underlined is the dup34 of exon 2 of GATA1. The arrow indicates the allele-discriminating primer. All PCR reactions had 40 cycles.
|
|
Jürgen Groet,
Claire Mulligan,
Monica Spinelli,
Anna Serra,
Suzanne McElwaine,
Finbarr E. Cotter,
Franca Dagna-Bricarelli,
Giuseppe Saglio,
Giuseppe Basso, and
Dean Nizetic
Correspondence: Dean Nizetic, Centre for Haematology, Bart's & The London, Queen Mary's School of Medicine, University of London, Institute of Cell and Molecular Science, 4 Newark Street, London E1 2AT United Kingdom; e-mail: d.nizetic{at}qmul.ac.uk.
Supported by the Leukaemia Research Fund-UK (grant 03/56), Special Trustees of Barts and The London Hospital (grant RAC405), Consiglio Nazionale delle Ricerche-Ministero dell'Istruzione, dell'Università e della Ricerca (CNR-MIUR) MIUR ex 40%, The Phylis and Sidney Goldberg Medical Trust, and The Fondation Jerome Lejeune. The Galliera Genetic Bank (GGB) is supported by the Italian Telethon grant C51. We also thank Centro Italiano Down-CEPIM (Genoa, Italy) and Fondazione "Citta della Speranza" (Malo, Italy) for help.
References
- Taub JW, Mundschau G, Ge Y et al. Prenatal origin of GATA1 mutations may be an initiating step in the development of megakaryocytic leukemia in Down syndrome. Blood. 2004;104: 1588-1589.[Free Full Text]
- Groet J, McElwaine S, Spinelli M et al. Acquired mutations in GATA1 in neonates with Down's syndrome with transient myeloid disorder. Lancet. 2003;361: 1617-1620.[CrossRef][Medline]
[Order article via Infotrieve]
- Shimada A, Xu G, Toki T, Kimura H, Hayashi Y, Ito E. Fetal origin of the GATA1 mutation in identical twins with transient myeloproliferative disorder and acute megakaryoblastic leukemia accompanying Down syndrome. Blood. 2004;103: 366.[Free Full Text]
- Rainis L, Bercovich D, Strehl S et al. Mutations in exon 2 of GATA1 are early events in megakaryocytic malignancies associated with trisomy 21. Blood. 2003;102: 981-986.[Abstract/Free Full Text]
- Ahmed M, Sternberg A, Hall G et al. Natural history of GATA1 mutations in Down syndrome. Blood. 2004;103: 2480-2489.[Abstract/Free Full Text]
- Wechsler J, Greene M, McDevitt MA et al. Acquired mutations in GATA1 in the megakaryoblastic leukemia of Down syndrome. Nat Genet. 2002;32: 148-152.[CrossRef][Medline]
[Order article via Infotrieve]
- Hitzler JK and Zipursky A. Origins of leukaemia in children with Down syndrome. Nat Rev Cancer. 2005;5: 11-20.[CrossRef][Medline]
[Order article via Infotrieve]
- Li Z, Godhino F, Klusmann J-H et al. Developmental stage-selective effect of somatically mutated leukemogenic transcription factor GATA1. Nat Genet. 2005;37: 613-619.[CrossRef][Medline]
[Order article via Infotrieve]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. R. Pine, Q. Guo, C. Yin, S. Jayabose, C. M. Druschel, and C. Sandoval
Incidence and clinical implications of GATA1 mutations in newborns with Down syndrome
Blood,
September 15, 2007;
110(6):
2128 - 2131.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|