Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 15 September 2005, Vol. 106, No. 6, pp. 1975-1981.
Prepublished online as a Blood First Edition Paper on June 7, 2005; DOI 10.1182/blood-2005-01-0440.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2005-01-0440v1
106/6/1975    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dai, K.
Right arrow Articles by Du, X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dai, K.
Right arrow Articles by Du, X.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Cell Adhesion and Motility
Right arrow Signal Transduction
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY

A critical role for 14-3-3{zeta} protein in regulating the VWF binding function of platelet glycoprotein Ib-IX and its therapeutic implications

Kesheng Dai, Richard Bodnar, Michael C. Berndt, and Xiaoping Du

From the Department of Pharmacology, University of Illinois College of Medicine, Chicago; and the Department of Biochemistry and Molecular Biology, Monash University, Clayton, Australia.


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The platelet receptor for von Willebrand factor (VWF), glycoprotein (GP) Ib-IX, mediates platelet adhesion and activation. The cytoplasmic domains of the GPIb {alpha} and {beta} subunits contain binding sites for the phosphorylation-dependent signaling molecule, 14-3-3{zeta}. Here we show that a novel membrane-permeable inhibitor of 14-3-3{zeta}-GPIb{alpha} interaction, MP{alpha}C, potently inhibited VWF binding to platelets and VWF-mediated platelet adhesion under flow conditions. MP{alpha}C also inhibited VWF-dependent platelet agglutination induced by ristocetin. Furthermore, activation of the VWF binding function of GPIb-IX induced by GPIb{beta} dephosphorylation is diminished by mutagenic disruption of the 14-3-3{zeta} binding site in the C-terminal domain of GPIb{alpha}, mimicking MP{alpha}C-induced inhibition, indicating that the inhibitory effect of MP{alpha}C is likely to be caused by disruption of 14-3-3{zeta} binding to GPIb{alpha}. These data suggest a novel 14-3-3{zeta}-dependent regulatory mechanism that controls the VWF binding function of GPIb-IX, and also suggest a new type of antiplatelet agent that may be potentially useful in preventing or treating thrombosis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Platelet adhesion plays an important role in hemostasis and thrombosis. Under high shear rate flow conditions such as in arteries and capillaries, platelet adhesion to the subendothelium is dependent on interaction between subendothelial-bound von Willebrand factor (VWF) and its receptor, the platelet glycoprotein Ib-IX-V complex (GPIb-IX-V).1 VWF-GPIb-IX-V interaction also mediates the formation of platelet microaggregates in patients with abnormally large VWF multimers,2 resulting in thrombotic thrombocytopenic purpura (TTP). Interaction of VWF with GPIb-IX-V triggers intracellular signaling events such as elevation of intracellular calcium3 and cyclic guanosine monophosphate (cGMP) levels,4 activation of phosphoinositide 3-kinase,5 and activation of multiple protein kinase pathways.4,6-8 These events lead to the activation of the ligand binding function of the integrin {alpha}IIb{beta}3,9-11, which mediates platelet spreading and aggregation.

GPIb-IX-V consists of 4 different transmembrane subunits. GPIb, which consists of disulfide-linked GPIb{alpha} and GPIb{beta} subunits, forms a 1:1 complex with GPIX. The GPIb-IX complex (GPIb-IX) is sufficient for ligand binding and signaling function.11,12 GPIb-IX forms a 2:1 complex with GPV.12 The N-terminal region of GPIb{alpha} contains binding sites for VWF and thrombin. Binding of VWF to GPIb-IX is tightly controlled, and normally occurs only at sites of vascular injury or under pathologically high shear stress. Shear stress may induce changes in both VWF and platelets. In vitro, ristocetin and botrocetin are used to induce VWF binding to GPIb-IX by mimicking the effects of the subendothelial matrix and shear stress on VWF and/or GPIb-IX. Increasing evidence indicates that VWF binding to GPIb-IX is regulated by intraplatelet signals such as cyclic adenosine monophosphate (cAMP) levels.13-15 Elevation of intracellular cAMP activates the cAMP-dependent protein kinase (PKA), which phosphorylates GPIb{beta} at Ser166.16,17 We recently showed that PKA-dependent phosphorylation of GPIb{beta} at Ser166 negatively regulates the VWF binding function of GPIb-IX.15

Several intracellular molecules are associated with the cytoplasmic domain of GPIb-IX. These include filamin, which interacts with the central region of the GPIb{alpha} cytoplasmic domain (residues 536-568, 570-590),18-20 calmodulin, which binds to the membrane proximal region of GPIb{beta},21 and 14-3-3{zeta},22 which is an important signaling molecule modulating intracellular proteins containing specific phosphoserine-centered binding motifs.23 Binding of 14-3-3{zeta} to GPIb-IX is regulated by phosphorylation at serine residues.24-26 Since we first discovered that 14-3-3{zeta} binds to GPIb-IX,22 several different binding sites have been reported in the cytoplasmic domain of GPIb{alpha} and GPIb{beta} for dimeric 14-3-3{zeta}: (1) the GPIb{alpha} C-terminal 14-3-3{zeta} binding site requires the RYSGHpS609L sequence in which phosphorylation of Ser609 plays a key role in high-affinity interaction with 14-3-3{zeta}26,27; (2) a 14-3-3{zeta} binding site in the cytoplasmic domain of GPIb{beta} contains an RLpS166LTDP sequence in which phosphoserine-166 plays a key role24,25; and (3) the region that is important in filamin binding to GPIb{alpha} cytoplasmic domain has also been shown to potentially interact with 14-3-3{zeta} (R557-G575 and L580-S590).25,28,29 The functional consequences of 14-3-3{zeta} binding to GPIb-IX, however, have been unclear. There have been apparently controversial data regarding whether deletion of the GPIb{alpha} C-terminal 14-3-3{zeta} binding site reduces GPIb-IX-mediated integrin activation and cell spreading,11,29 or enhances integrin-dependent cell spreading.30,31 In this study, we show that 14-3-3{zeta} plays an important role in the up-regulation of the VWF binding function of GPIb-IX induced by dephosphorylation of GPIb{beta} Ser166, and that a membrane-permeable inhibitor of 14-3-3{zeta}-GPIb-IX interaction, MP{alpha}C, diminishes VWF binding to platelets and VWF-mediated platelet adhesion. These data suggest a 14-3-3{zeta}-dependent regulatory mechanism for GPIb-IX and a novel inhibitor of platelet adhesion.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Reagents

Monoclonal antibodies against GPIb{alpha}, LJ-P3 (provided by Dr Zaverio Ruggeri, The Scripps Research Institute) and WM23, have been previously described.32,33 Monoclonal antibodies, SZ29 against VWF and SZ2 against GPIb{alpha}, were generous gifts from Dr Changgeng Ruan (Soochow University, Suzhou, China).34,35 cDNA clones encoding wild-type GPIb{alpha}, GPIb{beta}, and GPIX were generous gifts from Dr Jose Lopez (Baylor College of Medicine, Houston, TX).36,37 The membrane-permeable protein kinase A (PKA) inhibitor, myristoylated PKI, was purchased from Calbiochem (San Diego, CA). Myristoylated peptides MP{alpha}C (C13H27CONH-SIRYSGHpSL), M{alpha}C (C13H27CONH-SIRYSGHSL), M{alpha}Csc (C13H27CONH-LSISYGSHR), MP{alpha}Csc (C13H27CONH-LSIpSYGSHR), and nonmyristoylated peptides P{alpha}C (SIRYSGHpSL) and {alpha}C (SIRYSGHSL) were synthesized by the Protein Research Laboratory, University of Illinois at Chicago. The peptides were more than 95% pure. Myristoylated peptides were dissolved in dimethyl sulfoxide (DMSO).

Recombinant GPIb-IX and mutants

Chinese hamster ovary (CHO) cells expressing recombinant wild-type GPIb-IX, a GPIb-IX mutant with a serine-to-alanine point mutation at Ser166 in GPIb{beta} (S166A), and GPIb-IX mutants with truncations at residues 591 and 605 in the cytoplasmic domain of GPIb{alpha}, have been described previously.15,27 Site-directed mutagenesis replacing Ser609 of GPIb{alpha} with alanine (S609A) was performed using a polymerase chain reaction (PCR) method with the forward primer as AGAAGAATTCGCTGCTCTGACCACA and the reverse primer as TAAGTCTAGATCAGAGGGCGTGGCCAGAGT. The PCR product was cloned into wild-type GPIb{alpha} in pGEM3Z(+) vector after digestion with the restriction enzymes SmaI and BamHI. The resulting S609A mutant was then subcloned into pCDNA3.1(-) vector after digestion with EcoRI. Correct mutation was verified by DNA sequencing. Transfection of cDNA into CHO cells was performed using LipofectAMINE Plus (Invitrogen, Carlsbad, CA). Stable cell lines were selected using selection media containing 0.5 mg/mL G418 and further selected by cell sorting using the anti-GPIb{alpha} monoclonal antibody, SZ2. Expression of GPIb-IX in different cell lines was adjusted by cell sorting to comparable levels before experiments.

Coimmunoprecipitation of GPIb-IX with 14-3-3{zeta}

CHO cells expressing wild-type and mutant GPIb-IX were resuspended to a concentration of 1.0 x 108 cells/mL, and solubilized in Triton X-100 containing buffer as described previously.15,27 In platelet experiments, MP{alpha}C or control peptides were preincubated with 300 µL washed platelets (5 x 108/mL). Platelets were then solubilized as previously described.27 The samples were centrifuged at 100 000g at 4°C for 30 minutes to remove the Triton X-100-insoluble material. The lysates (150 µL) were incubated with the anti-GPIb{alpha} monoclonal antibody LJ-P3 for 1 hour, and then with protein G-conjugated Sepharose 4B beads for 1 hour at 4°C. The beads were then washed 3 times. Bound proteins were extracted by the addition of sodium dodecyl sulfate (SDS) sample buffer, analyzed by SDS-polyacrylamide gel electrophoresis (PAGE), and immunoblotted with an anti-14-3-3{zeta} antibody.38

Platelet preparation and aggregation

For studies involving human subjects, approval was obtained from the University of Illinois at Chicago institutional review board. Informed consent was provided according to the Declaration of Helsinki. Blood collection from healthy donors and preparation of platelet-rich plasma (PRP) and washed platelets were performed as previously described.27 Platelet aggregation was measured using a turbidometric platelet aggregometer at 37°C with a stirring speed of 1000 rpm.

Flow cytometric analysis of VWF binding to GPIb-IX-expressing cells and platelets

Flow cytometric analysis of VWF binding to platelets and CHO cells expressing recombinant GPIb-IX was performed as described previously.14,15 Briefly, ristocetin (Sigma, St Louis, MO; 1.25 mg/mL) and purified VWF (35 µg/mL) were added to CHO cells expressing wild-type (1b9) and mutant GPIb-IX suspended (2.25 x 106 cells/mL) in modified Tyrode buffer,27 and incubated at 22°C for 30 minutes. Washed platelets (1.0 x 107/mL) in phosphate-buffered saline (PBS; 0.01 M NaH2PO4, 0.15 M NaCl, pH 7.4) containing 10 mM EDTA (ethylenediaminetetraacetic acid) and 1% bovine serum albumin (BSA) were preincubated with inhibitors or control peptides at 22°C for 10 minutes, and then incubated with purified VWF (35 µg/mL) and ristocetin (1.0 mg/mL) at 22°C for 30 minutes. After washing once, the cells or platelets were further incubated with 10 µg/mL fluorescein isothiocyanate (FITC)-labeled anti-VWF antibody SZ-29 at 22°C for 30 minutes and then analyzed by flow cytometry. As negative controls, cells or platelets were incubated with ristocetin in the absence of VWF. To examine the effects of myristoylated PKI, cells were preincubated with or without 100 µM PKI for 15 minutes at 22°C, prior to analysis for VWF binding.

Cell adhesion under flow conditions

Purified human VWF was diluted to 30 µg/mL with 0.1 M NaHCO3, pH 8.3, and coated onto glass capillary tubes (inner diameter 0.58 mm; Harvard Apparatus, Holliston, MA) overnight in a humid environment at 4°C. The capillaries were washed with PBS, blocked with 5% BSA in PBS at 22°C for 2 hours, and then installed on the stage of an inverted microscope. Washed platelets (3 x 108/mL) or cells (5 x 106 cells/mL) in modified Tyrode buffer containing 0.5% BSA were perfused by using a syringe pump (PhD; Harvard Apparatus) into the glass capillary at defined shear rates for 2.5 minutes. Shear rate was calculated as described by Slack and Turitto.39 Transient adhesion (rolling) of cells or platelets on the VWF-coated surface was recorded using a video cassette recorder. Rolling cells or platelets were counted in 10 randomly selected fields of 0.25 mm2 within a 10-second time period.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Disruption of 14-3-3{zeta} interaction with GPIb-IX with a novel membrane-permeable inhibitor and by mutagenesis

Phosphoserine-609 of GPIb{alpha} and phosphoserine-166 of GPIb{beta} are key residues in the 14-3-3{zeta} binding sites in GPIb{alpha} and GPIb{beta}, respectively (Figure 1A). To investigate the role of 14-3-3{zeta} in regulating GPIb-IX function, cell lines were established that express the following mutants of GPIb-IX: (1) wild-type GPIb{beta} and GPIX complexed with a GPIb{alpha} mutant bearing a conservative mutation of Ser609 to an alanine (S609A); (2) wild-type GPIb{alpha} and GPIX complexed with a mutant of GPIb{beta} in which Ser166 is mutated to alanine (S166A); and (3) wild-type GPIX complexed with both the GPIb{alpha} S609A and GPIb{beta} S166A mutants (S166A/S609A). By repeated cell sorting using anti-GPIb antibodies, cell lines were obtained in which the expression levels of these different mutants were comparable to a wild-type GPIb-IX cell line (1b9). These cells were analyzed for coimmunoprecipitation of 14-3-3{zeta} with GPIb-IX. 14-3-3{zeta} coimmunoprecipiated with wild-type GPIb-IX and also with the S166A mutant (Figure 1B), suggesting that the S166A mutation alone is not sufficient to reduce 14-3-3{zeta} binding. In contrast, 14-3-3{zeta} failed to coimmunoprecipitate with either the S609A mutant or the S609A/S166A mutant. Thus, although there are several different 14-3-3{zeta} binding sites in the cytoplasmic domain of the GPIb-IX complex, the site containing the phosphoserine-609 is required for high-affinity interaction between GPIb-IX and endogenous 14-3-3{zeta} under these conditions. These data also suggest that the 14-3-3{zeta} binding site in the cytoplasmic domain of GPIb{beta} or other potential 14-3-3{zeta} binding sites in GPIb{alpha}, by themselves, are not sufficient to support a high-affinity interaction between GPIb-IX and 14-3-3{zeta}. Hence, anchoring 14-3-3{zeta} to the C-terminal domain of GPIb{alpha} may facilitate a potential interaction between dimeric 14-3-3{zeta} and GPIb{beta} or other sites within the cytoplasmic domains of GPIb-IX. Thus, in order to inhibit 14-3-3{zeta} binding to GPIb-IX in human platelets, we synthesized a membrane-permeable myristoylated phospho-peptide named MP{alpha}C (C13H27CONH-SIRYSGHpSL) based on the sequence of the 14-3-3{zeta} binding site in the C-terminal region of GPIb{alpha} including phosphorylation of Ser609 (Figure 1A). We also synthesized a myristoylated nonphosphorylated peptide with the identical sequence as MP{alpha}C (M{alpha}C), a myristoylated scrambled peptide (M{alpha}Csc), and a myristoylated scrambled phospho-peptide (MP{alpha}Csc) as controls. To examine if these peptides interfere with endogenous 14-3-3{zeta} interaction with GPIb-IX, platelets were preincubated with MP{alpha}C or control peptides, and then solubilized. GPIb-IX-14-3-3{zeta} complex was then coimmunoprecipitated with a monoclonal antibody against GPIb{alpha}. MP{alpha}C peptide but not the control peptides abrogated coimmunoprecipitation of 14-3-3{zeta} with GPIb-IX (Figure 1C). Thus, MP{alpha}C is a potent inhibitor of 14-3-3{zeta} binding to GPIb-IX.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 1.. Disruption of 14-3-3{zeta} binding to GPIb-IX by mutagenesis and a novel inhibitor. (A) Schematic depicting GPIb-IX and the reported 14-3-3{zeta} binding sites (black boxes). Also shown is the GPIb{alpha} 14-3-3{zeta} binding sequence from which a novel membrane-permeable inhibitor of 14-3-3{zeta}-GPIb{alpha} interaction, MP{alpha}C, is derived. (B) CHO cells expressing wild-type, GPIb-IX (1b9), or GPIb-IX mutants bearing 14-3-3{zeta} binding disrupting mutations, S609A (GPIb{alpha} Ser609 to alanine mutation), S166A (GPIb{beta} Ser166 to alanine mutation), and S609A/S166A double mutations, were solubilized in Triton X-100 containing lysis buffer and immunoprecipitated with the anti-GPIb{alpha} antibody LJ-P3 (P3), or control IgG. The immunoprecipitates were immunoblotted with anti-GPIb{alpha} and anti-14-3-3{zeta} antibodies. (C) Platelets were preincubated with MP{alpha}C, control peptides (M{alpha}C, MP{alpha}Csc, or M{alpha}Csc), or DMSO. Platelets were then solubilized and immunoprecipitated with an anti-GPIb{alpha} antibody (P3). Immunoprecipitates were immunoblotted with anti-GPIb{alpha} and anti-14-3-3{zeta} antibodies.

 
The effect of MP{alpha}C on ristocetin-induced platelet aggregation/agglutination

To determine if 14-3-3{zeta}-GPIb interaction plays a role in the ligand binding function of GPIb-IX in human platelets, we examined the effects of the myristoylated peptide inhibitor of 14-3-3{zeta}-GPIb-IX interaction, MP{alpha}C, on GPIb-IX function in platelets. MP{alpha}C dose-dependently inhibited VWF-mediated platelet aggregation induced by ristocetin (Figure 2A). In contrast, the myristoylated control peptides, M{alpha}C, MP{alpha}Csc, or M{alpha}Csc, had no effect (Figure 2B). Similarly, myristic anhydride also had no effect on ristocetin-induced platelet aggregation (Figure 2C), suggesting that myristoylation is not responsible for the effect of MP{alpha}C. Conversely, a nonmyristoylated phospho-peptide with an identical peptide sequence to MP{alpha}C(P{alpha}C) had no effect on ristocetin-induced platelet aggregation (Figure 2C), suggesting that myristoylation is required for the inhibitory effect. Since myristoylation is known to confer membrane permeability to short peptides, these data indicate that the inhibitory effect of MP{alpha}C requires membrane permeability of this specific 14-3-3{zeta} inhibitor. These data also indicate that 14-3-3{zeta} binding to GPIb-IX is required for ristocetin-induced platelet aggregation.

MP{alpha}C specifically inhibits GPIb-IX-dependent platelet agglutination

Ristocetin-induced platelet aggregation involves platelet agglutination (caused directly by VWF binding to GPIb-IX), platelet activation, and subsequent integrin {alpha}IIb{beta}3-mediated platelet aggregation. To determine if the inhibitory effect of MP{alpha}C results from inhibition of GPIb-IX-dependent platelet agglutination or GPIb-IX-mediated platelet activation, we examined the effect of MP{alpha}C on ristocetin-induced platelet agglutination in the presence of Arg-Gly-Asp-Ser (RGDS) peptide, which blocks integrin-dependent platelet aggregation. MP{alpha}C completely inhibited ristocetin-induced platelet agglutination in the presence of RGDS (Figure 3A-B). In contrast, control peptides had no inhibitory effect. MP{alpha}C also inhibited botrocetin-induced platelet agglutination (not shown). To exclude the possibility that MP{alpha}C may affect general platelet activation processes, we examined the effect of this peptide on platelet aggregation induced by the platelet agonists adenosine diphosphate (ADP), collagen, and the thromboxane A2 analog, U46619 [GenBank] . Neither MP{alpha}C nor the control peptides had an inhibitory effect on platelet aggregation induced by these agonists (Figure 3C-E). MP{alpha}C and control peptides also had no effect on U46619 [GenBank] -induced fibrinogen binding to platelets (not shown). Thus the effect of MP{alpha}C peptide is specific for GPIb-IX-dependent platelet agglutination.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 2.. The effect of an inhibitor of 14-3-3{zeta}-GPIb-IX interaction, MP{alpha}C, on ristocetin-induced platelet aggregation. (A) PRP was preincubated with DMSO as control or with increasing concentrations of the myristoylated 14-3-3{zeta} inhibitor peptide for 5 minutes, and stimulated with ristocetin to induce platelet aggregation. (B) Ristocetin-induced platelet aggregation in the presence of 100 µM myristoylated 14-3-3{zeta} inhibitor peptides; MP{alpha}C; control peptides M{alpha}C, MP{alpha}Csc, or M{alpha}Csc; or DMSO. (C) Ristocetin-induced platelet aggregation in the presence of nonmyristoylated peptide, P{alpha}C (phosphorylated) or {alpha}C (nonphosphorylated) with sequence identical to MP{alpha}C, or myristic anhydride (MA).

 



View larger version (30K):
[in this window]
[in a new window]
 
Figure 3.. MP{alpha}C specifically inhibits VWF- and GPIb-IX-dependent platelet agglutination. (A,B) PRP was preincubated with myristoylated peptides MP{alpha}C, M{alpha}C, MP{alpha}Csc, or M{alpha}Csc, or vehicle (DMSO) together with 1 mM of the integrin inhibitor RGDS. Ristocetin (1.25 mg/mL) was added to induce GPIb-IX-specific platelet agglutination. Typical agglutination traces are shown in panel A, and quantitative data from 4 experiments are shown in panel B (mean ± SD). (C-E) PRP was preincubated with MP{alpha}C; M{alpha}C or M{alpha}Csc; or DMSO, then stimulated with ADP (C), collagen (D), or the thromboxane A2 analog, U46619 [GenBank] (E) to induce platelet aggregation.

 
The effect of MP{alpha}C on ristocetin-induced VWF binding to platelets

We also directly examined the effect of MP{alpha}C on ristocetin-induced VWF binding to platelet GPIb-IX (to exclude the possible role of integrin, binding assays were performed in the presence of RGDS or EDTA). MP{alpha}C inhibited ristocetin-induced VWF binding to platelets (Figure 4A-B). In contrast, the control peptides had no inhibitory effect. Thus, a cell-permeable inhibitor of 14-3-3{zeta} binding to GPIb{alpha} specifically inhibits VWF binding to the extracellular ligand binding domain of GPIb-IX, indicating that 14-3-3{zeta} binding to the C-terminal region of GPIb{alpha} is required for the VWF binding function of GPIb-IX in platelets.

A critical role for 14-3-3{zeta} in platelet adhesion to VWF

The physiologic function of VWF binding to GPIb-IX is to mediate platelet adhesion under flow conditions.40,41 Thus, we examined if MP{alpha}C could inhibit platelet adhesion to VWF under flow. To do so, washed platelets were preincubated with peptides or vehicle (DMSO) and then perfused through VWF-coated glass capillaries. To exclude the role of integrins, these experiments were performed in the presence of the integrin inhibitor, RGDS. As expected, platelets preincubated with vehicle or control peptides adhered to the VWF surface. In contrast, there was almost no adhesion of platelets preincubated with MP{alpha}C (Figure 4C). This dramatic inhibitory effect of MP{alpha}C on platelet adhesion not only indicates that 14-3-3{zeta} interaction with the cytoplasmic domain of GPIb{alpha} is important for platelet adhesive function, but also suggests that MP{alpha}C or similar agents that prevent 14-3-3{zeta} binding to GPIb{alpha} may be useful as a new class of antiplatelet agents that specifically inhibit GPIb-IX-dependent platelet adhesion.

The roles of the 14-3-3{zeta} binding sites in GPIb{alpha} and GPIb{beta} in regulating the VWF binding function of GPIb-IX

To further exclude the possibility that the peptide inhibitor may affect the VWF binding function of GPIb-IX nonspecifically, we investigated whether disruption of the 14-3-3{zeta} binding sites in GPIb-IX may also affect the VWF binding function of GPIb-IX. CHO cell lines expressing either wild-type or mutant GPIb-IX were analyzed for ristocetin-induced VWF binding. We detected only a low level of VWF binding to wild-type GPIb-IX expressed in CHO cells (1b9) (Figure 5A). This is because GPIb-IX molecules expressed in CHO cells are fully phosphorylated at Ser166 and thus are in a resting form.15 In comparison, more than 30% of GPIb{beta} is dephosphorylated at Ser166 in platelets isolated ex vivo,15 which explains why GPIb-IX in isolated platelets appears constitutively active with respect to VWF binding. In contrast to CHO cells expressing wild-type GPIb-IX, VWF binding to cells expressing the S166A mutant lacking the PKA phosphorylation site in GPIb{beta} was significantly enhanced (Figure 5A-B). The GPIb{alpha} S609A mutant by itself was similar to resting wild-type GPIb-IX as indicated by minimal VWF binding. However, the enhancing effect of the GPIb{beta} S166A mutation on VWF binding was diminished when expressed with the GPIb{alpha} S609A mutant (Figure 5A). Thus, 14-3-3{zeta} binding to the C-terminal site of GPIb{alpha} is required for the enhancing effects of the S166A mutation on VWF binding.

We also examined whether the S609A mutation in the GPIb{alpha} affected GPIb-IX-dependent cell adhesion to VWF under flow conditions. As shown in Figure 6A, a very small number of CHO cells expressing wild-type GPIb-IX (1b9) were able to adhere and roll on a VWF-coated surface at a shear rate of 150 s-1. In contrast, the S166A mutant cells showed a significantly enhanced adhesion. The enhancing effect of the S166A mutation was diminished in S166A/S609A cells, indicating that the high-affinity 14-3-3{zeta} binding site in GPIb{alpha} is required for the S166A mutation-induced activation of cell adhesion mediated by GPIb-IX. Similar to the effect of S609A mutant coexpression, preincubation of S166A mutant cells with the 14-3-3{zeta} inhibitor, MP{alpha}C, resulted in a significant decrease in the adhesion of S166A mutant cells to VWF under flow conditions (Figure 6B). In contrast, MP{alpha}C had no effect on the already reduced adhesion of S166A/S609A cells (Figure 6C) or S609A cells (not shown). These results indicate that the effect of MP{alpha}C was similar to the GPIb{alpha} S609A mutation, and resulted from inhibition of GPIb{alpha}-14-3-3{zeta} interaction. Therefore, similar mechanisms are responsible for the 14-3-3{zeta}-mediated regulation of VWF binding function of GPIb-IX both in platelets and in the reconstituted CHO cell model.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 4.. Effects of MP{alpha}C on VWF binding to GPIb-IX-and VWF-mediated platelet adhesion. (A) Washed human platelets were preincubated with MP{alpha}C or control peptides M{alpha}C or M{alpha}Csc, or DMSO and incubated with ristocetin in the presence (VWF) or absence (control) of VWF. VWF binding was detected using FITC-labeled anti-VWF antibody and flow cytometry. (B) Quantitative data from 3 experiments (mean ± SD). VWF binding index equals total fluorescence/background fluorescence-1. (C) Platelets were preincubated with MP{alpha}C or control peptides M{alpha}C or M{alpha}Csc, or DMSO, and then perfused through VWF-coated capillary tubes. Numbers of adherent platelets were counted at 10 randomly selected time frames and locations (mean ± SD).

 



View larger version (29K):
[in this window]
[in a new window]
 
Figure 5.. The effect of disruption of the 14-3-3{zeta} binding sites in GPIb{alpha} and GPIb{beta} by mutagenesis on the VWF binding function. (A) CHO cells expressing wild-type GPIb-IX (1b9), S609A, S166A, or S166A/S609A mutants were incubated with human VWF in the presence of ristocetin or with ristocetin alone (controls). VWF binding to cells was analyzed by flow cytometry using FITC-labeled anti-VWF antibody, SZ29. The same cells were also analyzed for surface expression of GPIb-IX by flow cytometry using an anti-GPIb{alpha} antibody SZ2 followed by a FITC-labeled goat anti-mouse IgG. Results from a typical experiment are shown in panel A. Quantitative data are shown in panel B, in which fluorescence intensity of VWF binding (mean ± SD, 6 experiments) was corrected for the relative level of GPIb-IX expression. FL indicates fluorescence.

 
The role of the 14-3-3{zeta} binding site in GPIb{alpha} in the activation of VWF binding by a PKA inhibitor

Ser166 of wild-type GPIb{beta} expressed in CHO cells is fully phosphorylated under our experimental conditions. Thus, it is likely that the effect of the S166A mutant in enhancing the VWF binding function of GPIb-IX results from abrogation of PKA-mediated Ser166 phosphorylation. To further confirm if Ser166 dephosphorylation activates the VWF binding function of GPIb-IX in a 14-3-3{zeta}-dependent manner, cells expressing GPIb-IX were treated with a specific membrane-permeable PKA inhibitor, the myristoylated PKA inhibitor peptide (PKI), and then analyzed for ristocetin-induced VWF binding. We have previously shown that PKI treatment significantly reduced phosphorylation of Ser166 of GPIb{beta}, but had no significant effect on GPIb{alpha} Ser609 phosphorylation.15,26 PKI treatment enhanced VWF binding to wild-type GPIb-IX (1b9 cells), but this effect was significantly reduced in cell lines {Delta}605 and {Delta}591 expressing GPIb-IX mutants in which the 14-3-3{zeta} binding site in the C-terminal domain of GPIb{alpha} was deleted ({Delta}605 lacks the C-terminal 5 residues of GPIb{alpha} and {Delta}591 lacks the C-terminal 19 residues containing the 14-3-3{zeta} binding site26,27; Figure 6D). Similarly, PKI-induced up-regulation of VWF binding was diminished in S609A cells (not shown), suggesting that 14-3-3{zeta} binding to the C-terminal site in GPIb{alpha} is important for the GPIb{beta} dephosphorylation-induced activation of the VWF binding function of GPIb-IX. Taken together, our data indicate a critical role for 14-3-3{zeta} in regulating the VWF binding function of GPIb-IX.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 6.. The effects of disruption of 14-3-3{zeta} binding to GPIb{alpha} on cell adhesion to VWF and on PKA inhibitor-induced GPIb-IX activation. (A) 1b9, S166A, S166/609A, or S609A cell lines were perfused through VWF-coated capillaries at 150 s-1. Transient adhesion (rolling) of these cells was recorded. The number of rolling cells was counted in 30 randomly selected fields of 0.25 mm2 and at randomly selected time points. The results shown are the mean ± SD of cell number/mm2. (B,C) S166A cells (B) or S166A/S609A cells (C) were preincubated with MP{alpha}C; control peptides M{alpha}C, MP{alpha}Csc, M{alpha}Csc; or DMSO, and then perfused into VWF-coated glass capillaries. Numbers of adherent cells were counted at 10 randomly selected time frames and locations (mean ± SD). (D) CHO cells expressing wild-type GPIb-IX (1b9) and mutant GPIb-IX with deletion of the GPIb{alpha} C-terminal 14-3-3 binding site ({Delta}591 and {Delta}605) were preincubated without or with 100 µM PKI for 15 minutes at 22°C. The cells were then incubated with VWF and ristocetin at 22°C for 30 minutes. VWF binding was detected using the FITC-labeled anti-VWF antibody, SZ29, and flow cytometry. Nonspecific fluorescence was determined by incubating the cells with ristocetin alone. Effects of PKI on enhancing VWF binding in the indicated cell lines were quantified and expressed as the percentage increase in the fluorescence intensity of VWF binding compared with the fluorescence intensity of VWF binding in the absence of PKI. Shown in the figure are the results from 3 separate experiments (mean ± SD).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The data described in this study indicate that (1) 14-3-3{zeta} binding to GPIb-IX is required for an active GPIb-IX capable of binding VWF; (2) cAMP-regulated phosphorylation and dephosphorylation of GPIb{beta} Ser166 via a 14-3-3{zeta} dependent mechanism controls whether GPIb-IX is in a resting, or an active state; and (3) agents that interfere with 14-3-3{zeta}-GPIb-IX interaction inhibit VWF binding function of GPIb-IX and thus potentially may be useful as a novel type of antiplatelet drug.

The conclusion that 14-3-3{zeta} is required for the VWF binding function of GPIb-IX is supported by data that a membrane-permeable inhibitor of 14-3-3{zeta}-GPIb-IX interaction, MP{alpha}C, inhibited GPIb-IX-dependent VWF binding to platelets, platelet agglutination, and adhesion. The effect of MP{alpha}C is unlikely to be nonspecific because disruption of the 14-3-3{zeta} binding site in GPIb{alpha} by mutagenesis also abolished activation of the VWF binding function induced by Ser166 dephosphorylation in a CHO cell model. There have been apparently conflicting reports whether GPIb-IX expressed in CHO cells is in an active state or resting state. We showed that wild-type GPIb-IX molecules expressed in CHO cells are mostly in a resting state.14,15 Dephosphorylation or S166A mutation of GPIb{beta} significantly enhanced the VWF binding function of GPIb-IX.15 Dong and colleagues42,43 reported that wild-type GPIb-IX expressed in CHO cells was in an active VWF binding state. Although the reason for this difference remains to be determined, it is possible that it results from different phosphorylation states of GPIb{beta} under clearly different experimental conditions. Under our conditions, GPIb-IX molecules expressed in CHO cells are almost fully phosphorylated at Ser166 of GPIb{beta},15 which inhibits VWF binding function. However, the findings of Dong et al,42 although showing a partial reduction in VWF binding to GPIb{alpha} deletion mutations, are consistent with our finding that disruption of the 14-3-3{zeta} binding site in GPIb{alpha} abolishes activation of VWF binding to GPIb-IX in CHO cells. Our data using the novel membrane-permeable inhibitor thus provide first evidence that, in human platelets, 14-3-3{zeta} binding to GPIb-IX plays a key physiologic role in regulating VWF binding function of GPIb-IX and VWF-mediated platelet adhesion.

Our data also show that the intracellular signaling messenger, cAMP, by modulating PKA-dependent GPIb{beta} phosphorylation, mediates 14-3-3{zeta}-dependent regulation of the VWF binding function of GPIb-IX, thus suggesting a novel regulatory mechanism for GPIb-IX. The 14-3-3{zeta} protein is dimeric. Each monomer of the 14-3-3{zeta} dimer has a binding pocket, and thus dimeric 14-3-3{zeta} is able to simultaneously interact with 2 different sites on a protein or 2 different ligands.23 Therefore, different 14-3-3{zeta} binding sites in GPIb-IX may interact with a single 14-3-3{zeta} dimer. Phosphorylation-dependent binding sites for dimeric 14-3-3{zeta} are present in the cytoplasmic domains of both GPIb{alpha} and GPIb{beta} (Figure 1A). A site critical for 14-3-3{zeta} binding to GPIb{alpha} is located in the C-terminal SIRYSGHpS609L sequence of GPIb{alpha} in which Ser609 is constitutively phosphorylated.26,27 The 14-3-3{zeta} binding site in GPIb{beta} is located in the RLpS166LTDP sequence,24,25 in which phosphorylation of Ser166 by PKA is dynamically regulated by cAMP levels.15,17 However, GPIb{alpha} alone is sufficient to support the binding of 14-3-3{zeta} without requiring cooperation of the 14-3-3{zeta} binding site in GPIb{beta}. On the other hand, deletion of the GPIb{alpha} C-terminal binding site abolishes high-affinity binding of 14-3-3{zeta} to GPIb-IX, suggesting that GPIb{beta} alone and other sites in GPIb{alpha} are not sufficient to support high-affinity binding of 14-3-3{zeta} without the GPIb{alpha} C-terminal site (Figure 1). These data suggest that GPIb-IX may have 2 different 14-3-3{zeta} interacting modes: (1) 14-3-3{zeta} dimer is bound to both GPIb{alpha} and GPI{beta} when PKA is activated by elevated cAMP; and (2) 14-3-3{zeta} dimer is bound only to GPIb{alpha} but not GPIb{beta} when the cAMP level is low. Therefore, we propose a "toggle switch" model as a possible regulatory mechanism for GPIb-IX (Figure 7). In this model, elevation of cAMP induces binding of 14-3-3{zeta} to both sites in GPIb{alpha} and GPIb{beta}, resulting in a resting GPIb-IX. Decreases in cAMP level lead to GPIb{beta}-14-3-3{zeta} dissociation, resulting in the binding of 14-3-3{zeta} to GPIb{alpha} alone and activation of the VWF binding function of GPIb-IX in a 14-3-3{zeta}-dependent manner (Figure 7). It remains to be determined how disruption of the 14-3-3{zeta} binding site in GPIb{beta} causes the 14-3-3{zeta}-dependent activation of GPIb-IX. However, it is important to note that 14-3-3{zeta} binding sites have been reported in the cytoplasmic domain of GPIb{alpha} in addition to the critical C-terminal SIRYSGHSL sequence. Also, our data suggest that whereas dimeric 14-3-3{zeta} is required for optimal binding to GPIb-IX,38 disruption of the 14-3-3{zeta} binding site in GPIb{beta} does not significantly affect 14-3-3{zeta} binding to GPIb-IX (Figure 1), suggesting the possibility that the 14-3-3{zeta} dimer still binds to 2 sites in GPIb{alpha} when the binding site in GPIb{beta} is disrupted. Interestingly, the sequences that may serve as a second binding site for 14-3-3{zeta} in the cytoplasmic domain of GPIb{alpha} overlap with the filamin binding site of GPIb{alpha},18,20,25,29 suggesting the possibility that 14-3-3{zeta} binding may regulate filamin-mediated GPIb-IX association with the membrane skeleton. We have shown previously that dissociation of GPIb-IX from the membrane skeleton activates the ligand binding function of GPIb-IX.14 Alternatively, it is also possible that dissociation of one of the ligand binding pockets in the 14-3-3{zeta} dimer from GPIb{beta} allows 14-3-3{zeta} to interact with a signaling molecule that in turn regulates GPIb-IX function. In this regard, it has been reported that 14-3-3{zeta} links GPIb-IX to other intracellular molecules such as phosphoinositide 3-kinase.44 Finally, it is also possible that dimeric 14-3-3{zeta} may link 2 GPIb molecules into a dimer. It is common that oligomerization of a receptor activates its ligand binding function. Consistent with this, dimerization of GPIb-IX has been shown to activate GPIb-IX-mediated signaling in a CHO cell expression model.45

GPIb-IX as a major platelet adhesion receptor is an excellent target for antithrombosis drug development. Due to the critical roles GPIb-IX plays in platelet adhesion under high shear stress flow conditions, GPIb-IX-specific inhibitors are likely to have selective effects for arterial thrombosis (for example, in stenotic arteries) and microthrombosis (for example, in arterioles and capillaries). Similarly, in patients suffering from thrombotic thrombocytopenic purpura and other types of thrombotic microangiopathy, microthrombosis can be directly induced by the spontaneous binding of circulating VWF to GPIb-IX.2 Thus, development of a GPIb-IX-specific antiplatelet drug would be useful in treating these types of thrombotic diseases. Here we show that pharmacologic blockade of the interaction between 14-3-3{zeta} and GPIb{alpha} with MP{alpha}C inhibits the VWF binding function of GPIb-IX and platelet adhesion. Thus, MP{alpha}C or similar reagents that block GPIb-IX-14-3-3{zeta} interaction have the potential to be developed into a new class of antithrombotic agents.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 7.. A new toggle switch model for 14-3-3{zeta}-dependent regulation of VWF binding function of GPIb-IX. Intracellular cAMP levels regulate VWF-dependent platelet adhesion by controlling the 14-3-3{zeta} binding states in a way similar to a toggle switch. Disruption of 14-3-3{zeta} interaction with GPIb{alpha} inhibits activation of VWF binding function of GPIb-IX and thus platelet adhesion. GP indicates glycoprotein.

 

    Acknowledgements
 
We thank Drs Changgeng Ruan, Zaverio Ruggeri, and Jose Lopez for providing reagents.


    Footnotes
 
Submitted February 1, 2005; accepted May 20, 2005.

Prepublished online as Blood First Edition Paper, June 7, 2005; DOI 10.1182/blood-2005-01-0440.

Supported by grants from the National Institutes of Health, HL62 350 and HL68 819 (X.D.), and also RO1 50 744 (M.C.B.). K.D. is a recipient of the Postdoctoral Fellowship Award from the American Heart Association Midwest Affiliate.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Xiaoping Du, Department of Pharmacology, College of Medicine, University of Illinois at Chicago, 835 South Wolcott Ave, Chicago, IL 60612; e-mail: xdu{at}uic.edu.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Ware J. Molecular analyses of the platelet glycoprotein Ib-IX-V receptor. Thromb Haemost. 1998; 79: 466-478.[Medline] [Order article via Infotrieve]

  2. Moake JL. Thrombotic thrombocytopenic purpura: the systemic clumping "plague." Annu Rev Med. 2002;53: 75-88.[CrossRef][Medline] [Order article via Infotrieve]

  3. Kroll MH, Harris TS, Moake JL, Handin RI, Schafer AI. von Willebrand factor binding to platelet GpIb initiates signals for platelet activation. J Clin Invest. 1991;88: 1568-1573.[Medline] [Order article via Infotrieve]

  4. Li Z, Xi X, Gu M, et al. A stimulatory role for cGMP-dependent protein kinase in platelet activation. Cell. 2003;112: 77-86.[CrossRef][Medline] [Order article via Infotrieve]

  5. Jackson SP, Schoenwaelder SM, Yuan Y, Rabinowitz I, Salem HH, Mitchell CA. Adhesion receptor activation of phosphatidylinositol 3-kinase: von Willebrand factor stimulates the cytoskeletal association and activation of phosphatidylinositol 3-kinase and pp60c-src in human platelets. J Biol Chem. 1994;269: 27093-27099.[Abstract/Free Full Text]

  6. Asazuma N, Ozaki Y, Satoh K, et al. Glycoprotein Ib-von Willebrand factor interactions activate tyrosine kinases in human platelets. Blood. 1997; 90: 4789-4798.[Abstract/Free Full Text]

  7. Falati S, Edmead CE, Poole AW. Glycoprotein Ib-V-IX, a receptor for von Willebrand factor, couples physically and functionally to the Fc receptor gamma-chain, Fyn, and Lyn to activate human platelets. Blood. 1999;94: 1648-1656.[Abstract/Free Full Text]

  8. Li Z, Xi X, Du X. A mitogen-activated protein kinase-dependent signaling pathway in the activation of platelet integrin {alpha}IIb{beta}3. J Biol Chem. 2001; 276: 42226-42232.[Abstract/Free Full Text]

  9. De Marco L, Girolami A, Russell S, Ruggeri ZM. Interaction of asialo von Willebrand factor with glycoprotein Ib induces fibrinogen binding to the glycoprotein IIb/IIIa complex and mediates platelet aggregation. J Clin Invest. 1985;75: 1198-1203.[Medline] [Order article via Infotrieve]

  10. Gralnick HR, Williams SB, Coller BS. Asialo von Willebrand factor interactions with platelets: interdependence of glycoproteins Ib and IIb/IIIa for binding and aggregation. J Clin Invest. 1985;75: 19-25.[Medline] [Order article via Infotrieve]

  11. Gu M, Xi X, Englund GD, Berndt MC, Du X. Analysis of the roles of 14-3-3 in the platelet glycoprotein Ib-IX-mediated activation of integrin {alpha}IIb{beta}3 using a reconstituted mammalian cell expression model. J Cell Biol. 1999;147: 1085-1096.[Abstract/Free Full Text]

  12. Lopez JA. The platelet glycoprotein Ib-IX complex. Blood Coagul Fibrinolysis. 1994;5: 97-119.[Medline] [Order article via Infotrieve]

  13. Coller BS. Inhibition of von Willebrand factor-dependent platelet function by increased platelet cyclic AMP and its prevention by cytoskeleton-disrupting agents. Blood. 1981;57: 846-855.[Free Full Text]

  14. Englund GD, Bodnar RJ, Li Z, Ruggeri ZM, Du X. Regulation of von Willebrand factor binding to the platelet glycoprotein Ib-IX by a membrane skeleton-dependent inside-out signal. J Biol Chem. 2001;276: 16952-16959.[Abstract/Free Full Text]

  15. Bodnar RJ, Xi X, Li Z, Berndt MC, Du X. Regulation of glycoprotein Ib-IX-von Willebrand factor interaction by cAMP-dependent protein kinase-mediated phosphorylation at Ser 166 of glycoprotein Ib beta. J Biol Chem. 2002;277: 47080-47087.[Abstract/Free Full Text]

  16. Fox JE, Reynolds CC, Johnson MM. Identification of glycoprotein Ib beta as one of the major proteins phosphorylated during exposure of intact platelets to agents that activate cyclic AMP-dependent protein kinase. J Biol Chem. 1987; 262: 12627-12631.[Abstract/Free Full Text]

  17. Wardell MR, Reynolds CC, Berndt MC, Wallace RW, Fox JE. Platelet glycoprotein Ib beta is phosphorylated on serine 166 by cyclic AMP-dependent protein kinase. J Biol Chem. 1989;264: 15656-15661.[Abstract/Free Full Text]

  18. Andrews RK, Fox JE. Identification of a region in the cytoplasmic domain of the platelet membrane glycoprotein Ib-IX complex that binds to purified actin-binding protein. J Biol Chem. 1992;267: 18605-18611.[Abstract/Free Full Text]

  19. Williamson D, Pikovski I, Cranmer SL, et al. Interaction between platelet glycoprotein Ibalpha and filamin-1 is essential for glycoprotein Ib/IX receptor anchorage at high shear. J Biol Chem. 2002; 277: 2151-2159.[Abstract/Free Full Text]

  20. Feng S, Resendiz JC, Lu X, Kroll MH. Filamin A binding to the cytoplasmic tail of glycoprotein Ib alpha regulates von Willebrand factor-induced platelet activation. Blood. 2003;102: 2122-2129.[Abstract/Free Full Text]

  21. Andrews RK, Munday AD, Mitchell CA, Berndt MC. Interaction of calmodulin with the cytoplasmic domain of the platelet membrane glycoprotein Ib-IX-V complex. Blood. 2001;98: 681-687.[Abstract/Free Full Text]

  22. Du X, Harris SJ, Tetaz TJ, Ginsberg MH, Berndt MC. Association of a phospholipase A2 (14-3-3 protein) with the platelet glycoprotein Ib-IX complex. J Biol Chem. 1994;269: 18287-18290.[Abstract/Free Full Text]

  23. Fu H, Subramanian RR, Masters SC. 14-3-3 proteins: structure, function, and regulation. Annu Rev Pharmacol Toxicol. 2000;40: 617-647.[CrossRef][Medline] [Order article via Infotrieve]

  24. Calverley DC, Kavanagh TJ, Roth GJ. Human signaling protein 14-3-3zeta interacts with platelet glycoprotein Ib subunits Ibalpha and Ibbeta. Blood. 1998;91: 1295-1303.[Abstract/Free Full Text]

  25. Andrews RK, Harris SJ, McNally T, Berndt MC. Binding of purified 14-3-3 zeta signaling protein to discrete amino acid sequences within the cytoplasmic domain of the platelet membrane glycoprotein Ib-IX-V complex. Biochemistry. 1998;37: 638-647.[CrossRef][Medline] [Order article via Infotrieve]

  26. Bodnar RJ, Gu M, Li Z, Englund GD, Du X. The cytoplasmic domain of the platelet glycoprotein Ib{alpha} is phosphorylated at serine609. J Biol Chem. 1999;274: 33474-33479.[Abstract/Free Full Text]

  27. Du X, Fox JE, Pei S. Identifcation of a binding sequence for the 14-3-3 protein within the cytoplasmic domain of the adhesion receptor, platelet glycoprotein Ib{alpha}. J Biol Chem. 1996;271: 7362-7367.[Abstract/Free Full Text]

  28. Feng S, Christodoulides N, Resendiz JC, Berndt MC, Kroll MH. Cytoplasmic domains of GpIbalpha and GpIbbeta regulate 14-3-3zeta binding to GpIb/IX/V. Blood. 2000;95: 551-557.[Abstract/Free Full Text]

  29. Mangin P, David T, Lavaud V, et al. Identification of a novel 14-3-3{zeta} binding site within the cytoplasmic tail of platelet glycoprotein Ib{alpha}. Blood. 2004;104: 420-427.[Abstract/Free Full Text]

  30. Zaffran Y, Meyer SC, Negrescu E, Reddy KB, Fox JE. Signaling across the platelet adhesion receptor glycoprotein Ib-IX induces alpha IIbbeta 3 activation both in platelets and a transfected Chinese hamster ovary cell system. J Biol Chem. 2000; 275: 16779-16787.[Abstract/Free Full Text]

  31. Bialkowska K, Zaffran Y, Meyer SC, Fox JE. 14-3-3 zeta mediates integrin-induced activation of Cdc42 and Rac: platelet glycoprotein Ib-IX regulates integrin-induced signaling by sequestering 14-3-3 zeta. J Biol Chem. 2003;278: 33342-33350.[Abstract/Free Full Text]

  32. Handa M, Watanabe K, Zimmerman TS, Ruggeri ZM. Structure-function relationships of platelet glycoprotein Ib as a receptor for von Willebrand factor. Nippon Ketsueki Gakkai Zasshi. 1986;49: 1577-1582.[Medline] [Order article via Infotrieve]

  33. Berndt MC, Gregory C, Kabral A, Zola H, Fournier D, Castaldi PA. Purification and preliminary characterization of the glycoprotein Ib complex in the human platelet membrane. Eur J Biochem. 1985; 151: 637-649.[Medline] [Order article via Infotrieve]

  34. Ruan CG, Du XP, Xi XD, Castaldi PA, Berndt MC. A murine antiglycoprotein Ib complex monoclonal antibody, SZ 2, inhibits platelet aggregation induced by both ristocetin and collagen. Blood. 1987;69: 570-577.[Abstract/Free Full Text]

  35. Ruan CG, Xi XD, Gu JM. Studies on monoclonal antibodies to human von Willebrand factor. Chung Hua Nei Ko Tsa Chih. 1986;25: 547-550, 576.

  36. Lopez JA, Chung DW, Fujikawa K, Hagen FS, Papayannopoulou T, Roth GJ. Cloning of the alpha chain of human platelet glycoprotein Ib: a transmembrane protein with homology to leucine-rich alpha 2-glycoprotein. Proc Natl Acad Sci U S A. 1987;84: 5615-5619.[Abstract/Free Full Text]

  37. Lopez JA, Chung DW, Fujikawa K, Hagen FS, Davie EW, Roth GJ. The alpha and beta chains of human platelet glycoprotein Ib are both transmembrane proteins containing a leucine-rich amino acid sequence. Proc Natl Acad Sci U S A. 1988;85: 2135-2139.[Abstract/Free Full Text]

  38. Gu M, Du X. A novel ligand-binding site in the {zeta}-form 14-3-3 protein recognizing the platelet glycoprotein Iba and distinct from the c-Raf-binding site. J Biol Chem. 1998;273: 33465-33471.[Abstract/Free Full Text]

  39. Slack SM, Turitto VT. Flow chambers and their standardization for use in studies of thrombosis. On behalf of the Subcommittee on Rheology of the Scientific and Standardization Committee of the ISTH. Thromb Haemost. 1994;72: 777-781.[Medline] [Order article via Infotrieve]

  40. Savage B, Saldivar E, Ruggeri ZM. Initiation of platelet adhesion by arrest onto fibrinogen or translocation on von Willebrand factor. Cell. 1996; 84: 289-297.[CrossRef][Medline] [Order article via Infotrieve]

  41. Ruggeri ZM. Platelets in atherothrombosis. Nat Med. 2002;8: 1227-1234.[CrossRef][Medline] [Order article via Infotrieve]

  42. Dong JF, Li CQ, Sae TG, Hyun W, Afshar KV, Lopez JA. The cytoplasmic domain of glycoprotein (GP) Ibalpha constrains the lateral diffusion of the GP Ib-IX complex and modulates von Willebrand factor binding. Biochemistry. 1997;36: 12421-12427.[CrossRef][Medline] [Order article via Infotrieve]

  43. Schade AJ, Arya M, Gao S, et al. Cytoplasmic truncation of glycoprotein Ib alpha weakens its interaction with von Willebrand factor and impairs cell adhesion. Biochemistry. 2003;42: 2245-2251.[CrossRef][Medline] [Order article via Infotrieve]

  44. Munday AD, Berndt MC, Mitchell CA. Phosphoinositide 3-kinase forms a complex with platelet membrane glycoprotein Ib-IX-V complex and 14-3-3 zeta. Blood. 2000;96: 577-584.[Abstract/Free Full Text]

  45. Kasirer-Friede A, Ware J, Leng L, Marchese P, Ruggeri ZM, Shattil SJ. Lateral clustering of platelet GP Ib-IX complexes leads to up-regulation of the adhesive function of integrin alpha IIbbeta 3. J Biol Chem. 2002;277: 11949-11956.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
Y. Li, J. Lu, and E. V. Prochownik
Modularity of the Oncoprotein-like Properties of Platelet Glycoprotein Ib{alpha}
J. Biol. Chem., January 16, 2009; 284(3): 1410 - 1418.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F.-T. Mu, R. K. Andrews, J. F. Arthur, A. D. Munday, S. L. Cranmer, S. P. Jackson, F. C. Stomski, A. F. Lopez, and M. C. Berndt
A functional 14-3-3{zeta}-independent association of PI3-kinase with glycoprotein Ib{alpha}, the major ligand-binding subunit of the platelet glycoprotein Ib-IX-V complex
Blood, May 1, 2008; 111(9): 4580 - 4587.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
D. Varga-Szabo, I. Pleines, and B. Nieswandt
Cell Adhesion Mechanisms in Platelets
Arterioscler. Thromb. Vasc. Biol., March 1, 2008; 28(3): 403 - 412.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Yin, A. Stojanovic, N. Hay, and X. Du
The role of Akt in the signaling pathway of the glycoprotein Ib-IX induced platelet activation
Blood, January 15, 2008; 111(2): 658 - 665.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Jain, M. Zuka, J. Liu, S. Russell, J. Dent, J. A. Guerrero, J. Forsyth, B. Maruszak, T. K. Gartner, B. Felding-Habermann, et al.
Platelet glycoprotein Ib{alpha} supports experimental lung metastasis
PNAS, May 22, 2007; 104(21): 9024 - 9028.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S.-Z. Luo, X. Mo, V. Afshar-Kharghan, S. Srinivasan, J. A. Lopez, and R. Li
Glycoprotein Ib{alpha} forms disulfide bonds with 2 glycoprotein Ib{beta} subunits in the resting platelet
Blood, January 15, 2007; 109(2): 603 - 609.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Nurden, N. Debili, W. Vainchenker, R. Bobe, R. Bredoux, E. Corvazier, R. Combrie, E. Fressinaud, D. Meyer, A. T. Nurden, et al.
Impaired megakaryocytopoiesis in type 2B von Willebrand disease with severe thrombocytopenia
Blood, October 15, 2006; 108(8): 2587 - 2595.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Mo, N. Lu, A. Padilla, J. A. Lopez, and R. Li
The Transmembrane Domain of Glycoprotein Ibbeta Is Critical to Efficient Expression of Glycoprotein Ib-IX Complex in the Plasma Membrane
J. Biol. Chem., August 11, 2006; 281(32): 23050 - 23059.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2005-01-0440v1
106/6/1975    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dai, K.
Right arrow Articles by Du, X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dai, K.
Right arrow Articles by Du, X.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Cell Adhesion and Motility
Right arrow Signal Transduction
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2005 by American Society of Hematology         Online ISSN: 1528-0020