|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, 15 October 2005, Vol. 106, No. 8, pp. 2827-2836. Prepublished online as a Blood First Edition Paper on June 28, 2005; DOI 10.1182/blood-2005-01-0358.
NEOPLASIA Transcription profiling of C/EBP targets identifies Per2 as a gene implicated in myeloid leukemiaFrom the Cedars-Sinai Medical Center, Division of Hematology/Oncology, University of California (UCLA) School of Medicine, Los Angeles, CA; and the Department of Hematology and Oncology and Transfusion Medicine, University Hospital "Benjamin Franklin," Berlin, Germany.
CCAAT/enhancer-binding proteins (C/EBPs) are a family of transcription factors that regulate cell growth and differentiation in numerous cell types. To identify novel C/EBP-target genes, we performed transcriptional profiling using inducible NIH 3T3 cell lines expressing 1 of 4 members of the C/EBP family. Functional analysis revealed a previously unknown link between C/EBP proteins and circadian clock genes. Our microarray data showed that the expression levels of 2 core components of the circadian network, Per2 and Rev-Erb  , were significantly altered by C/EBPs. Recent studies suggested that Per2 behaves as a tumor suppressor gene in mice. Therefore, we focused our additional studies on Per2. We showed that Per2 expression is up-regulated by C/EBP and C/EBP . Per2 levels were reduced in lymphoma cell lines and in acute myeloid leukemia (AML) patient samples. In addition, we generated stable K562 cells that expressed an inducible Per2 gene. Induction of Per2 expression resulted in growth inhibition, cell cycle arrest, apoptosis, and loss of clonogenic ability. These results suggest that Per2 is a downstream C/EBP-target gene involved in AML, and its disruption might be involved in initiation and/or progression of AML. (Blood. 2005; 106:2827-2836)
The precise transcriptional regulation of numerous genes is required to maintain the balance between normal cellular proliferation and terminal differentiation. Such control is achieved through specific transcription factors that act as master regulators of various cellular functions. The CCAAT/enhancer-binding protein (C/EBP) family falls into this category of transcription factors, with many physiologic and pathologic conditions associated with their activities.1,2 To date, 6 C/EBP family members have been identified, with further diversity achieved by the generation of different isoforms and extensive protein-protein interactions both within the family and with other transcription factors. All C/EBP family members contain a highly conserved basic region and a leucine zipper domain (bZIP). Tissue- and stage-specific expression, as well as variable DNA-binding specificities, contributes to the differences in the biologic functions of the C/EBP isoforms.
C/EBP proteins play a key role in regulating proliferation and differentiation of many cell types including mammary epithelia cells, neuronal cells, granulocytes, hepatocytes, and adipocytes.3 Increasing evidence now shows that deregulated activity of some C/EBPs is involved in tumorigenesis.4-7 Within the hematopoietic system, C/EBP Circadian rhythms are generated by a set of clock genes organized in interlocking transcriptional-translational feedback loops. Circadian oscillations of clock genes are found in the suprachiasmatic nucleus (SCN), where the central pacemaker is located, and in many peripheral tissues including liver, muscle, and bone marrow.20-22 Recent studies provide evidence for molecular links between the circadian clock and cell proliferation.23,24 Many cell cycle-related genes are deregulated and cell cycle progression from S to M phase is impaired in mice lacking the Cry gene, a core component of the clock network.25 Recent studies suggest that the murine Per2 gene, another key factor of the circadian system, is involved in tumor suppression by regulating cell cycle- and apoptosis-related genes.26 In addition, disruption of circadian rhythms has been associated with cancer in humans.27 Understanding the molecular links between the cell and the circadian cycles may lead to new therapeutic approaches to cancer as well as other challenging diseases.
In the present study, we used cDNA microarray analysis to examine the composition of C/EBP target genes following induction of C/EBP
Patient samples Low-density mononuclear bone marrow cells from 21 patients with AML as well as from 9 healthy individuals were obtained after their informed consent; approval was obtained from Cedars-Sinai Medical Center institutional review board for these studies. Informed consent was provided according to the Declaration of Helsinki. The samples were processed as previously described.28 Cell culture NIH 3T3 (murine fibroblast), KCL22, K562 (chronic myelocytic leukemia), U937 (myelomonoblastic), and Daudi (Burkitt lymphoma) cell lines were obtained from the American Type Culture Collection (Manassas, VA) and grown in the recommended medium and conditions. Generation of zinc-inducible stable cell lines
The zinc-inducible C/EBP expression vectors pMT Oligonucleotide array hybridization and data analysis
Triplicate clones of NIH 3T3 cells were induced by addition of ZnSO4 (100 µM) for 16 hours to the medium. Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA). Biotinylated cRNAs were prepared and hybridized to murine MG_74Av2 microarrays (Affymetrix, Santa Clara, CA), which contain more than 12 000 genes. The probed arrays were scanned with a Hewlett Packard Gene Array scanner (Hewlett Packard, Palo Alto, CA). The scanned output image files were analyzed using Affymetrix Microarray Suite version 5.0 (Affymetrix Microarray, Santa Clara, CA). To identify genes that were differentially expressed between the 5 sample sets (empty vector, C/EBP Semiquantitative RT-PCR and real-time RT-PCR
Total RNA (2 µg) was converted into cDNA using SuperScript II reverse transcriptase (Invitrogen). Semiquantitative reverse-transcriptase-polymerase chain reaction (RT-PCR) was performed to determine the expression levels of haptoglobin (Hp) and lipocalin (Lcn2). RT-PCR for 18S was used as an internal control. Reaction products were visualized on ethidium bromide-stained agarose gels. Real-time RT-PCR analysis of selected genes was performed to confirm the microarray data. The expression levels of Per2 and Rev-Erb Northern blot analysis
Total RNA (10 µg) was electrophoresed on a denaturing formaldehyde gel, transferred onto a nylon membrane, and hybridized with [ Western analysis
Cells were lysed with lysis buffer (50 mM Tris [tris(hydroxymethyl)aminomethane]-HCl [pH 7.4], 150 mM NaCl, 0.5% nonidet P-40 [NP-40]); subsequently cell lysates were resolved on 4% to 15% gradient sodium dodecyl sulfate-polyacrylamide gels (SDS-PAGEs) and transferred to nitrocellulose membranes (Sigma, St Louis, MO). Immunoblots were incubated with the following antibodies: anti-C/EBP Reporter assay
NIH 3T3 cells were cotransfected with a murine Per2 promoter reporter construct (pGL3B/mPer2 [-1670 to +53], generous gift from P. Sassone-Corsi, Louis Pasteur, France,31 0.6 µg), along with either C/EBP Electrophoretic mobility-shift assay (EMSA)
Double-stranded oligonucleotides containing the C/EBP site (underlined: CCCAGGGCTTCTTTGGAAAGGGCTGCTGAA) from the Per2 promoter were end-labeled with Chromatin immunoprecipitation assay
Bone marrow cells from 5 mice were suspended in Iscoves modified Dulbecco medium (IMDM) with 10% fetal bovine serum (FBS). Chromatin was prepared and immunoprecipitated according to the manufacturer's protocol (Upstate, Lake Placid, NY). Samples were immunoprecipitated with either rabbit anti-C/EBP Transient transfections and cell viability assays K562 and U937 cells (8 x 106) were electroporated using a Gene Pulser electroporation apparatus (BTX, San Diego, CA), at 310 V for 35 milliseconds. For cell viability assays, cells were electroporated with either pcDNA3.1 V5-taggeted Per2 expression vector or empty pcDNA3.1 vector, together with pMSCVpuro vector (Clontech, Palo Alto, CA) and selected with puromycin (0.8 µg/mL) for 3 days. Equal numbers of transfected cells (5 x 104/mL) were then plated in fresh medium. The mean number of viable cells was determined daily using trypan blue exclusion. Cell proliferation, cell cycle, apoptosis, and clonogenic assays Cell proliferation was determined by methyl-thiazol tetrazolium (MTT) assays (Roche Diagnostics, Mannheim, Germany) according to the manufacturer's protocol. For cell cycle analyses, cells were fixed in cold ethanol, stained with propidium iodide, and analyzed by FACScan and CELLFit program (Becton Dickinson, San Jose, CA). Apoptosis analysis was performed with annexin V-fluorescein isothiocyanate (FITC) Apoptosis Detection Kit I (BD PharMingen, San Diego, CA) according to the manufacturer's instructions. For clonogenic assay, cells (1 x 103) were plated into 24-well flat-bottomed plates using a 2-layer soft agar system. After 14 days of incubation, colonies were counted and measured. Experiments were done at least twice using triplicate plates per experimental point. Statistical significance of the results was analyzed using t test.
Transcriptional profiling of C/EBP-inducible NIH 3T3 cells
To identify C/EBP target genes, we generated a series of cell lines by stably transfecting NIH 3T3 cells with zinc-inducible vectors that express either C/EBP
To test the transcriptional activity of the C/EBP proteins, semiquantitative RT-PCR was performed using haptoglobin (Hp) and lipocalin (Lcn2), 2 known C/EBP target genes. Zinc treatment induced the expression of both genes (Hp, strong induction by C/EBP and low induction by C/EBP , C/EBP , and C/EBP; Lcn2, induction by C/EBP and C/EBP), demonstrating that the stably transfected C/EBP proteins could specifically activate target genes that are normally expressed in other tissues (Figure 1B).
For global gene expression profiling, the transfected NIH 3T3 cell lines (3 independent polyclones from each stably transfected C/EBP family member) were cultured in the presence of zinc for 16 hours. Oligonucleotide microarray analysis was performed with total RNA using Affymetrix U74Av2 chips. The raw expression data were processed and filtered according to the criteria described in "Patients, materials, and methods." Using these criteria, we found that the expression of 158 genes was modulated in a statistically significantly fashion by one or more of the C/EBP proteins (Table S1, available on the Blood website; see the Supplemental Table link at the top of the online article). These genes were classified into 4 functional categories (Table 1). Consistent with previous knowledge about C/EBP functions, many of the differentially regulated genes are involved in regulation of cell growth, immune response, cellular metabolism, and differentiation.3,33-37 Our analysis also showed that induction of C/EBP
Confirmation of microarray data To verify the microarray results, the induction/repression of several genes was assessed by real-time PCR (data not shown) and Northern blot analysis (Figure 2). A high degree (93%) of concordance occurred between the microarray results and the confirmation studies. In addition, several known C/EBP target genes (such as Pparg, Hp, Lcn2, and Saa3) were represented on the microarrays. In several cases, a gene predicted to be selectively modulated by one or more C/EBP transcription factors by the microarray analysis was shown also to be regulated by other C/EBPs in real-time and/or Northern studies. Furthermore, with the exception of a small number of genes, the fold changes in gene expression, induced by the C/EBP proteins as calculated by the chip analysis, underestimated the level of modulation as found by quantitative real-time PCR. These studies indicate that our transcriptional profiling accurately reflected target gene expression levels in the transfected NIH 3T3 populations.
Per2 is a direct target for C/EBP
Functional annotation analysis showed that the expression levels of 2 core circadian genes, Per2 (Period 2) and Nr1d1 (nuclear receptor subfamily 1, group D, member 1, Rev-Erb
Analysis of the Per2 promoter region revealed that it contains several potential C/EBP binding sites between -1520 and -910 relative to the mRNA start site. We used reporter assays to examine whether C/EBP and C/EBP can regulate Per2 promoter activity. Cotransfection of NIH 3T3 cells with a Per2 promoter-luciferase construct along with either the C/EBP or C/EBP expression vector resulted in a 7- and 5-fold stimulation of Per2 promoter activity, respectively (Figure 3A). Dbp, one of the genes identified by our transcriptional profiling, is a transcription factor that recognizes DNA binding sites similar to those recognized by C/EBPs.38 We, therefore, tested the ability of DBP to activate Per2 transcription. Cotransfection of NIH 3T3 cells with the Per2 promoter-luciferase construct and a DBP expression vector led to a 3-fold increase in the reporter activity (Figure 3A). These results show that the Per2 promoter is induced by C/EBP, C/EBP, and DBP.
EMSAs were performed to examine whether C/EBP
We also performed chromatin immunoprecipitation (ChIP) experiments using murine bone marrow cells to determine whether C/EBP
Per2 is regulated by C/EBP and C/EBP in human hematopoietic leukemic cell lines
We next tested whether C/EBP
Per2 expression is down-regulated in lymphoid and myeloid malignancies A significant number of mice deficient in expression of Per2 develop lymphomas.26 We used real-time RT-PCR to measure Per2 expression in 6 human cell lines representing different lymphoma subtypes, as well as in normal human lymph nodes. Results showed that in 4 types of B-cell malignant cell lines, Burkitt (Daudi, Raji, and Ramos), pre-B-cell acute lymphoblastic leukemia (B-ALL; Naml6 and blin1), Mantle cell (Jeko1), and large B-cell lymphoma (Sudhl6 and Sudhl16), Per2 levels were extremely low in comparison with levels in cells from normal human lymph nodes (Figure 4B). These results suggest that Per2 expression is down-regulated in several subsets of lymphomas.
Inactivation of C/EBP
Expression of Per2 leads to growth arrest Further studies explored the consequences of expressing Per2 on cell proliferation. The CML, K562, and the myelomonocytic, U937, human cell lines were transfected with either a V5-tagged Per2 expression vector or an empty vector as control. After a short period of antibiotic selection, equal numbers of polyclonal populations were cultured in fresh media, and their growth rate was measured by daily viable cell counts. In both cell lines, forced expression of Per2 led to a dramatic decrease in proliferation (Figure 6B). Expression of the Per2 protein was verified by Western analysis (Figure 6A). To analyze additionally the role of Per2 in cell proliferation, we established an inducible cell line system. The K562 cell line was stably transfected with a zinc-inducible V5-tagged Per2 expression vector (pMTPer2) as well as control empty vector (pMT). Clones were selected on the basis of G418 resistance, and inducibility of Per2 expression was demonstrated by Western blot (Figure 6C). Induction of Per2 led to very substantial growth reduction as measured by MTT assays (Figure 6D). Cell cycle analysis was carried out to determine which phase of the cell cycle is inhibited by Per2 expression. After 3 days of culture in the presence of zinc, the K562-pMTPer2 cells had a significantly (P < .01) increased number of cells (8%) in the G2/M phase and a decreased number of cells (30%) in the S phase of the cell cycle compared with K562-pMT cells containing the empty vector (2% G2/M and 44% S phase [Figure 7A]). Furthermore, increased apoptosis (statistically significant, P < .01) was observed in K562-pMTPer2 cells (10%) by day 5 of culture in zinc-supplemented media, in contrast to the low level of apoptosis in the K562-pMT cells (1%) cultured under identical conditions (Figure 7B). We next examined the effect of Per2 expression on anchorage-independent clonal growth of K562 in soft agar (Figure 7C). Incubation of the K562-pMTPer2 cells in zinc-containing media led to complete inhibition of colony formation (0 colonies). Exposure of the K562-pMT control cells to zinc also inhibited colony formation compared with the wild-type untreated cells, but to a significantly lesser extent.
As one approach for better understanding the full extent of gene expression under the control of C/EBP proteins, we performed transcriptional profiling with NIH 3T3 cells ectopically expressing either C/EBP , C/EBP, C/EBP, or C/EBP. Several C/EBP microarray studies using a number of cell types were previously reported.12,39-41 We elected to use NIH 3T3 cells because they do not express endogenous C/EBP proteins. Furthermore, these multi-potential mesenchymal stem cells have the capacity to express genes normally restricted to more differentiated cell types such as adipocytes, myocytes, granulocytes, and neuronal cells42-46; using theses cells allowed induction of numerous C/EBP target genes from heterologous cell types.
An interesting question is whether C/EBP family members regulate specific genes or if they regulate a common set of genes. One major finding of our study is that almost all identified genes were regulated by more than 1 of the C/EBP members, albeit at different levels. These results suggest that strict C/EBP target gene specificity is rare; rather, specificity may be conveyed by how efficiently the C/EBPs can activate a given target gene. Of the 4 C/EBPs examined, C/EBP
While a number of genes identified by our screen were common to C/EBP targets identified by previous studies (eg, gadd45, Ptx3, Rgs2, Btg2, Pim1, Fos, Cyr61, and Lcn2), a substantial number of genes found in our list were not previously linked to C/EBP function. Nonetheless, many of them correlate very well with known physiologic activities of C/EBP proteins. A large number of the identified genes are implicated in the inflammatory response. A second group of genes includes those associated with cell proliferation. Several of the repressed genes (such as Fos, Junb, Atf3, Pim1, and Pea15) are genes known to promote growth, while a number of the induced genes (such as Slfn2, Slfn4, Dcn, Orm1, and Lnc2) inhibit growth. This is in accordance with known functions of C/EBP proteins in arrest of proliferation in different cell types. Two additional sets of modulated genes include those associated with differentiation/development and those involved in cellular metabolism.
The highest up-regulated gene was Cd1d1, which showed a 53-fold induction following C/EBP expression. CD1d1, a member of the major histocompatibility complex (MHC) family, presents glycolipids to natural killer T cells and is thought to be involved in the antitumor immune response.47 Peroxisome proliferator-activated receptor gamma (PPAR ), a well-known C/EBP target, was also strongly induced by C/EBP (45-fold). Of interest, C/EBP down-regulated PPAR expression by 2.5-fold. Although C/EBP and C/EBP are both expressed during granulocytic differentiation, recent findings demonstrated specific roles for these 2 C/EBPs in modulating secondary granule gene expression.48 Thus, they may have unique functions in regulating common target genes in other cell types. Of note, PPAR, C/EBP, and C/EBP are all expressed during macrophage development and play key roles in maturation and metabolic functions of macrophages.49-52 It is possible that cross-talk between PPAR and C/EBP signaling pathways is necessary for coordinated gene expression in macrophages.
Functional annotation analysis suggested a previously unreported relationship between C/EBP transcription factors and the circadian clock. Our microarray data identified 3 circadian genes, Per2, Nr1d1, and Dbp, as novel C/EBP targets (Figure 8). This finding is especially intriguing given recent reports that link the circadian clock to cell-cycle regulation and tumor suppression. In a recent study, Fu et al26 presented strong evidence supporting a role for Per2 in tumor suppression and response to DNA damage; Per2 mutant mice showed increased sensitivity to
Clock genes are expressed in several peripheral tissues including bone marrow where they control cell proliferation and apoptosis by regulating genes involved in those processes.20-26,53 To investigate whether Per2 is involved in leukemia, we measured its expression in normal bone marrow and bone marrow from patients with AML. Our results show that Per2 expression is reduced in 42% of AML samples. Casein kinase I (CKI), a core component of the circadian system, regulates the stability of Per by phosphorylating these proteins. A recent report showed that CKI is essential for granulocytic differentiation.53 Perhaps the decreased activity of Per2 in leukemic cells, which are blocked in their terminal differentiation, occurs not only by down-regulation of its mRNA but also by a posttranscriptional mechanism such as phosphorylation.
We showed that forced expression of Per2 in K562 and U937 human myeloid leukemia cell lines leads to a marked growth inhibition. We also generated a stably transfected K562 line containing an inducible Per2 gene. Induction of Per2 in this cell system resulted in arrest of proliferation, apoptosis, and loss of clonogenic ability. Our finding that Per2 overexpression results in a significant G2/M arrest is in agreement with several earlier studies showing that the G2/M checkpoint is under circadian control.25,54 Nonetheless, genetic and molecular data point to circadian regulation of multiple stages of the cell cycle pathway.23,24 Increased expression of c-myc was suggested as a possible mechanism contributing to the cancer-prone phenotype of the Per2 mutant mice. In myeloid cells, down-regulation of c-myc is critical for terminal differentiation and growth arrest associated with C/EBP
A significant number of Per2 mutant mice die before the age of 16 months from spontaneous lymphomas.26 We found that Per2 expression is down-regulated in several types of human B-ALL and lymphoma cell lines, suggesting that inactivation of Per2 may contribute to the development of B-cell leukemias and lymphomas in humans. We also found that Per2 inhibits the proliferation of several epithelial cell types including breast, prostate, and lung cancer cells (data not shown). C/EBP
Nr1d1, the second clock gene identified by our transcriptional profiling, is a transcriptional repressor that plays a key role in the circadian clock feedback loops. A recent report showed an association between Rev-Erb
In summary, our transcriptional profile study identified C/EBP-target genes, many of which were not previously associated with the C/EBP family. These studies identified for the first time a link between C/EBPs and circadian clock genes. We showed that C/EBP
This work is dedicated to the memory of David Golde, a mentor and friend.
Submitted January 27, 2005; accepted June 6, 2005.
Prepublished online as Blood First Edition Paper, June 28, 2005; DOI 10.1182/blood-2005-01-0358.
Supported in part by National Institutes of Health grants, as well as by the Ronald Havner, Parker Hughes, and the Cindy, Alan Horn, and Inger funds. H.P.K. is a member of the Jonsson Comprehensive Cancer Center and the Molecular Biology Institute (UCLA) and holds the endowed Mark Goodson Chair of Oncology Research at Cedars-Sinai Medical Center/UCLA School of Medicine.
The online version of the article contains a data supplement.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Sigal Gery, Cedars-Sinai Medical Center, Davis Bldg 5066, 8700 Beverly Blvd, Los Angeles, CA 90048; e-mail: gerys{at}cshs.org.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Top
Abstract
Introduction
) or a Per2 expression vector (pMTPer2; 
) were cultured with zinc for 3 days, harvested, stained with propidium iodide (PI), and analyzed by flow cytometry for cell cycle analysis. 
indicates wt. (Bottom) Bar graphs present the means ± SD of 3 independent experiments. (B) Apoptosis analysis. Stably transfected K562 cells (pMT and pMTPer2) treated with zinc for 4 days were stained with annexin V-FITC and PI. Data represent the mean ± SD of 3 experiments. (C) Clonogenic analysis. Zinc-treated stably transfected K562 cells (pMT and pMTPer2 [1 x 104/well]) were cultured in soft agar. Colonies containing approximately 1000 cells or more were counted on day 14. Experiments were performed in triplicate and repeated twice, and the mean ± SD of a representative experiment is shown. Untreated wild-type K562 cells (wt) were included as controls.