| |
|
|
|
|
|
|
|||
|
Blood, 15 May 2006, Vol. 107, No. 10, pp. 3868-3875. Prepublished online as a Blood First Edition Paper on January 24, 2006; DOI 10.1182/blood-2005-07-2755.
HEMATOPOIESIS Characterization of the megakaryocyte demarcation membrane system and its role in thrombopoiesisFrom the Dana-Farber Cancer Institute, Boston, MA; the Department of Medicine, Harvard Medical School, Boston, MA; the Beth Israel-Deaconess Medical Center, Boston, MA; and the Albert Einstein College of Medicine, Bronx, NY.
To produce blood platelets, megakaryocytes elaborate proplatelets, accompanied by expansion of membrane surface area and dramatic cytoskeletal rearrangements. The invaginated demarcation membrane system (DMS), a hallmark of mature cells, has been proposed as the source of proplatelet membranes. By direct visualization of labeled DMS, we demonstrate that this is indeed the case. Late in megakaryocyte ontogeny, the DMS gets loaded with PI-4,5-P2, a phospholipid that is confined to plasma membranes in other cells. Appearance of PI-4,5-P2 in the DMS occurs in proximity to PI-5-P-4-kinase (PIP4K ), and short hairpin (sh) RNA-mediated loss of PIP4K impairs both DMS development and expansion of megakaryocyte size. Thus, PI-4,5-P2 is a marker and possibly essential component of internal membranes. PI-4,5-P2 is known to promote actin polymerization by activating Rho-like GTPases and Wiskott-Aldrich syndrome (WASp) family proteins. Indeed, PI-4,5-P2 in the megakaryocyte DMS associates with filamentous actin. Expression of a dominant-negative N-WASp fragment or pharmacologic inhibition of actin polymerization causes similar arrests in proplatelet formation, acting at a step beyond expansion of the DMS and cell mass. These observations collectively suggest a signaling pathway wherein PI-4,5-P2 might facilitate DMS development and local assembly of actin fibers in preparation for platelet biogenesis.
Mammals synthesize blood platelets as functional cell particles within a precursor cell, the megakaryocyte (MK). Terminally differentiated MKs acquire a significantly polyploid DNA content and enlarge to 50 to 100 µm in diameter before releasing their platelet load. In the release phase, the MK cytoplasm converts into long branched protrusions, and disc-shaped platelets are assembled de novo within these proplatelet extensions.1 Microtubule bundles form the core of each proplatelet, and their distal tips organize into the repetitively coiled structure of the platelet marginal band.1-3 The actin cytoskeleton also participates actively in thrombopoiesis, judged mainly by the effects of inhibitors of actin polymerization on proplatelet morphology.1,4-6 Although these studies reveal cytoskeletal aspects of thrombopoiesis, little is known about the corresponding regulation of nascent platelet membranes or how membrane and cytoskeletal morphogenesis are coordinated. The conversion of a single MK into thousands of platelets is accompanied by a large increase in total surface area. MK ultrastructure reveals an abundant pool of cytoplasmic membranes that constitute the demarcation membrane system (DMS). By virtue of its origin in tubular invaginations of the plasma membrane, the DMS maintains continuity with the extracellular space,7,8 and whole-cell patch-clamp recordings reveal the DMS to be a single electrophysiologic entity.9 DMS functions, however, remain controversial, and its name recalls early theories on platelet biogenesis. Prior to proplatelet-based models of thrombopoiesis, nascent platelets were believed to assemble within the MK cytoplasm, partitioned or demarcated by these membranes.10 Subsequently, the DMS was proposed to function instead as the membrane reservoir required to extend proplatelets.11 This is an appealing idea that remains untested and also predicts that internal membranes evert in the course of platelet assembly.
Here, we provide direct evidence that the DMS is the source of proplatelet membranes. We show further that in anticipation of platelet release, these membranes acquire biochemical distinction in the form of harboring PI-4,5-P2, a phospholipid that is usually associated with the plasma membrane. We suggest that PI-4,5-P2 may accumulate through the enzymatic activity of the lipid kinase PI-5-P-4-kinase
Mice, megakaryocyte culture, and proplatelet and platelet studies
GPIIb-EYFP knock-in mice were generated by conventional gene targeting (J.Z., Nicole Faust, Florencio Varas, and T.G., manuscript in preparation). All animal studies were approved by the Institutional Review Board at Dana-Farber Cancer Institute, Boston, MA. Fetal livers were recovered from mouse embryos between the 13th and 15th gestational days and cultured to expand megakaryocytes, as described previously.12 Unless indicated otherwise, cells were separated on the fourth or fifth culture day over a 1.5% to 3% discontinuous bovine serum albumin (BSA) gradient to recover populations enriched or depleted for mature MKs. Washed cells were concentrated and processed for RNA or protein isolation. Electron microscopy of mouse bone marrow MKs12 and isolation of mouse blood platelets13 were performed as described previously. Proplatelets were monitored by phase-contrast microscopy of cells growing in suspension. For direct fluorescence microscopy and indirect immunofluorescence, blood platelets or 103 to 105 cultured MKs were cytocentrifuged onto poly L-lysine-coated coverslips or glass slides, respectively. MK preparations were fixed in 4% formaldehyde for 15 minutes, washed, permeabilized with PBS containing 0.5% Triton X-100 for 3 minutes, blocked with 3% goat serum in phosphate-buffered saline, and incubated with phycoerythrin-conjugated CD41 antibody (PharMingen, San Diego, CA) or Alexa Fluor594conjugated phalloidin (Molecular Probes, Eugene, OR). Indirect immunofluorescence was performed using rabbit antiserum against PIP4K Retrovirus production and megakaryocyte transduction Intact or GFP-fused cDNAs were cloned into the pWZL plasmid prior to virus production in packaging cells, as described.13 Briefly, 293 cells were cultured in DMEM supplemented with 10% FBS and transfected with 5 µg each of plasmids encoding gag/pol, vsvG, and pWZL constructs. Medium was exchanged after 16 hours, and viral supernatant was collected after 48 to 60 hours. The medium was filtered (0.45 µm) and either used immediately or stored at 80°C. Cells were isolated on day 2 of MK culture as described in the preceding section, and cultured for 16 to 24 hours in 1 mL DMEM containing 10% FBS, TPO (0.5% culture supernatant from a TPO producer cell line, as described previously12), 5 µg/mL polybrene (Sigma), and retroviral supernatants. Viral titers were not determined routinely, and supernatants were applied without modification when at least 5% of large cells (mature MKs) displayed GFP signals. Low-titer viral supernatants were concentrated by ultracentrifugation to achieve comparable infection rates; most supernatants gave infection rates between 5% and 60%, which was suitable for single-cell level analysis. Following exchange with fresh medium, MKs were cultured for 2 additional days.
For RNA interference, an oligonucleotide corresponding to the target sequence GGCTCGACAGTGGCTAGAGAA (nucleotides 640-660 of the murine type II PIP4K Plasmids
Constructs for the pleckstrin homology (PH) domain of phospholipase C (PLC) Fluorescence microscopy Immunostained coverslips were stained with DAPI, mounted with Fluoromount G (Southern Biotech, Birmingham, AL), and examined on an Olympus IX70 inverted fluorescence microscope (Olympus, Melville, NY) at room temperature. Images were acquired with a CM350 CCD camera (Applied Precision, Issaquah, WA) using 60x (Olympus PLAN-APO 1.40 NA, 0.10 mm WD) or 100x (PLAN-APO 1.40NA, 0.10 mm WD) oil objectives. Thirty to 50 cross-sections were taken at 0.2-µm spacing and deconvolved using 10 cycles with the Ratio method, using DeltaVision software (Applied Precision, Issaquah, WA). As the emission spectrum of EYFP overlaps with that of GFP, EYFP signals were acquired using GFP filter settings and represented in green. Three-dimensional video-enhanced reconstruction and contrast enhancement for some images were performed using the same software. Images were captured using Adobe Photoshop 7.0 software (Adobe, San Diego, CA). Antiserum and immunoblot analysis
A naturally occurring PIP4K Flow cytometry
MKs treated with drugs, shRNA, or corresponding controls were pelleted at the indicated times and incubated for 20 minutes in 100 µL PBS containing either FITC-conjugated CD41 antibody (clone MWReg30), phycoerythrin-conjugated CD61 antibody (clone 2C9.G2), or the corresponding isotype controls (all from Becton Dickinson, Franklin Lakes, NJ). Cells were washed and either scored manually for proplatelet formation (fraction of large cells elaborating
PI-4,5-P2 is a lipid marker for the DMS The invaginated membranes of the DMS are dispersed through most of the mature MK cytoplasm except for a cortical organelle-poor zone (Figure 1A). We studied a mouse strain (EYFPki) in which the GPIIb (CD41) locus is replaced by cDNA encoding enhanced yellow fluorescent protein (EYFP); the reporter protein was modified by a C-terminal farnesylation site, which allows it to be incorporated in cellular membranes (J.Z., N. Faust, F. Varas, and T.G., manuscript in preparation). Young MKs showed low fluorescence that was confined to the cell periphery (Figure 1F-H). Fluorescence levels increased substantially in mature MKs (Figure 1B), judged by their size and nuclear lobularity, and the staining pattern was highly reminiscent of the DMS ultrastructure (Figure 1A). Indeed, the DMS is the only membrane system with the same mass and distribution as the observed EYFP localization. In cells with advanced differentiation, plasma-membrane signal was comparatively weak, and EYFP did not colocalized with the cytoplasmic and cytoskeletal marker Arp3 (Figure 1C-E), thus excluding the possibility that the fusion protein accumulates in the cytosol. Notably, the fluorescent internal membranes were contiguous with the full outline of emerging proplatelets (Figure 1I-J), and platelets circulating in EYFPki mice showed surface fluorescence (Figure 1K). These observations directly reveal the DMS as a reservoir for proplatelet and platelet membranes and suggest that EYFPki mice can serve as a tool to monitor the DMS.
Because the biochemistry of the DMS is obscure, we sought to identify molecules that might help elucidate its properties and serve as compartmental markers. Greater than 90% of the lipids in MK membranes consist of phosphatidylcholine, phosphatidylethanolamine, sphingomyelin, and phosphatidylserine15; much of the rest consists of the phosphatidylinositol (PI) group, wherein 7 species may be phosphorylated at specific positions.16 Pleckstrin homology (PH) and Phox domains bind phospholipids with high affinity and specificity,17,18 and fusion of these heterologous domains to enhanced green fluorescent protein (EGFP) permits interrogation of the phospholipid composition of cellular membranes. In particular, the PH domain derived from phospholipase C 1 (PLC 1) binds predominantly to PI-4,5-P2 in membranes, and a PH(PLC 1)EGFP fusion protein has been used to mark plasma membranes.19,20 Indeed, in young MKs infected with PH(PLC 1)EGFP retrovirus, fluorescence was largely confined to the cell membrane (Figure 2A-D), where PI-4,5-P2 expression is detected in other cell types.
As transduced MKs matured, however, the PH(PLC
MKs lacking the transcription factor NF-E2 fail to form proplatelets and harbor a highly disorganized DMS.12,24 Forced expression of PH(PLC Enzymatic origin of PI-4,5-P2 at the DMS
Cells generate PI-4,5-P2 by 2 alternative routes: a canonical pathway of PI-4-P phosphorylation by PI-4-P 5-kinases (type I) or via type II kinases that phosphorylate PI-5-P at the 4 position.25 The latter pathway may first convert PI-3-P into PI-3,5-P2, which is subsequently cleaved to produce the PI-5-P substrate.16,26,27 PI-5-P 4-kinase II
In platelets and MKs, PIP4K appears in 2 (51 kDa and 43 kDa) forms, as suggested for erythrocytes32; the smaller, less abundant form lacks 59 N-terminal amino acids, reflecting use of an alternative promoter and mRNA, which we have cloned from primary MKs and designate 59N-PIP4K (Figure S1A). Antisera that we raised against 59N-PIP4K also recognize the full-length protein (Figure 3A), and indirect immunofluorescence using these antibodies revealed cytoplasmic localization in MKs (Figure 3B). To confirm this result, we used EGFP fusion proteins. Retroviral expression of EGFP-tagged full-length PIP4K was toxic to cultured MKs, but surviving cells showed exclusively cytoplasmic fluorescence (data not shown). As enzymatic activity of the 59N form is comparable to that of the full-length protein (Figure S1B), we used this nontoxic natural variant to refine subcellular localization. EGFP- 59N-PIP4K concentrated at DMS-like internal membranes, sparing both the membrane-depleted periphery and the plasma membrane (Figure 3C). This distribution was confirmed by costaining the cells with CD41 antibody (data not shown). Although it is formally possible that the 59N variant is regulated differently, these data suggest that PIP4K resides in the vicinity of the DMS and of its product PI-4,5-P2. In contrast, some PI4P 5-kinases (PIP5K and PIP5K ) are also expressed in MKs, but neither of these enzymes colocalizes with the DMS; both enzymes appear mainly in the cell periphery (Figure 3D-E; Chen et al33) and thus are not suitably positioned to produce PI-4,5-P2 in the DMS. Taken together, these findings support the candidacy of PIP4K as the pertinent enzyme.
To assess PIP4K
These results suggest a specific requirement for PIP4K in terminal maturation of CD41+ MKs. To assess whether absence of PIP4K affects DMS structure, we applied the shRNA treatment to MKs from EYFPki mice and examined cells by deconvolution fluorescence microscopy. The target cell population is absent in the third wave of megakaryopoiesis (Figure 4C). However, in the preceding wave, when PIP4K is considerably reduced, staining of the EYFPki MK cytoplasm is diffuse, suggestive of notable membrane loss or disorganization (Figure 4D-E). These results directly implicate PIP4K in the expansion of cell size and the organization of the DMS and raise the possibility that the 2 processes may be functionally coupled. Relation of the DMS to MK maturation
Having observed that the DMS loads with PI-4,5-P2 before forming proplatelets, we investigated the possible consequences of this change in membrane phospholipids. PI-4,5-P2 has multiple known functions, one of which is to trigger actin polymerization.34-36 Indeed, in mature EYFPki MKs stained with fluorescent phalloidin, actin filaments colocalize with many portions of the DMS (data not shown). Similarly, in MKs infected with PH(PLC Rho-family GTPases are especially linked to PI-4,5-P2, which activates Rho-dependent kinases to induce actin stress fibers38 and regulates Rac1-dependent actin assembly.39 PI-4,5-P2dependent signaling from these GTPases to the Arp2/3 actin-nucleating complex is mediated by the Wiskott-Aldrich syndrome protein (WASp) family.40 To address whether DMS-associated actin assembly occurs through this pathway, we exploited the dominant inhibitory function of an isolated C-terminal WASp CA (cofilin-binding and acidic) domain, which antagonizes actin-related functions by sequestering Arp2/3.41,42 On retroviral transduction of primary MKs, an N-WASp CA fragment fused to EGFP colocalized substantially with Arp3 (Figure 5G-I), suggesting that its action occurs as expected. Punctate phalloidin staining in infected cells (Figure 5J) contrasts with the typically filamentous pattern and confirms the anticipated interference with actin assembly. WASp-CA-EGFP did not affect MK size, but compared with the EGFP (Figure 5K) or untreated (data not shown) controls, it inhibited dramatically the ability of MKs to elaborate proplatelets. Infected cells increased in size, showed multilobed nuclei, and extended occasional proplatelets (Figure 5L and inset), thus excluding severe cytotoxicity as the basis for arrested differentiation. Actin assembly is important at several steps in thrombopoiesis: initial protrusion of proplatelets and subsequent branching of individual proplatelet strands.1,5,6 WASp-CA appears to block the first of these steps, which suggests that WASp-Arp2/3dependent actin assembly is an essential and early event in proplatelet formation (PPF).
Taken together, our results are consistent with a signaling pathway wherein PI-4,5-P2 in the DMS activates the WASp-Arp2/3 complex and thereby nucleates F-actin in preparation for platelet release. To test the predictions of this model, we inhibited actin polymerization with cytochalasin D (cytoD). If actin assembly is essential early in proplatelet morphogenesis, the presence of cytoD should reduce PPF when the first wave of cultured primary MKs terminates maturation. In contrast, later exposure to cytoD might inhibit strand branching but should not reduce the number of proplatelet-producing cells. This is exactly what we observed (Figure 5M). Application of cytoD on or before culture day 2.5 nearly eliminated PPF, measured at its usual peak on day 4. Proplatelet numbers were unaffected if cytoD was applied on or after day 3, when the drug adversely influenced proplatelet morphology and branching as expected. CytoD-induced disruption of F-actin was confirmed by phalloidin staining and did not impair cell survival (data not shown). A second prediction is that, unlike manipulations that affect the DMS, cytoD treatment should preserve both cell volume and the morphology of internal membranes. Indeed, cytoD did not alter DMS structure in EYFPki MKs (Figure 5N). Moreover, in contrast to the effects on PPF (Figure 5M) and to the effects of PIP4K
At the conclusion of their maturation, MKs elaborate remarkably dynamic proplatelets that can extend for several millimeters. To support de novo assembly of thousands of platelets, MKs must coordinate numerous interactions between membrane, cytoskeletal, and signaling systems. Whereas some of the cytoskeletal changes associated with thrombopoiesis are known, the role of cellular membranes and their resident phospholipids is poorly understood. We show that PI-4,5-P2 is a prominent marker lipid for internal membranes in mature MKs and identify the DMS as the origin of the proplatelet and platelet surface. Our studies suggest a model wherein MK-expressed lipid kinases, possibly PIP4K in particular, generate abundant PI-4,5-P2 at the DMS concurrent with terminal differentiation. We also present data in support of a function for PI-4,5-P2 accumulation in the DMS: to trigger cytoplasmic actin polymerization via the WASp/WAVE pathway.
Ultrastructural studies of the DMS reveal that it invaginates from the plasma membrane and presents profiles of fenestrated tubules and cisternae.7,9-11 Reflecting the extensive invagination, the specific membrane capacitance per unit peripheral surface area in primary rat MKs, 8 to 9 µF/cm2, exceeds that in most other cell types and increases 1.4-fold per doubling of spherical surface area.9 These measurements suggest that MK enlargement is inherently coupled to development of the DMS and agree with observations that DMS abundance correlates with MK diameter.7 Using EYFPki cells and EGFP-PH(PLC In any case, the side of the invaginated DMS that faces the extracellular space must emerge as the proplatelet surface, much like the turning of a glove inside out. Contents on the cytoplasmic side include the contents of future platelets and factors responsible for proplatelet morphogenesis such as oriented microtubule bundles. In one of the last visible events in the MK-cell body, dispersed microtubules reorganize in thick bundles at the cell cortex and enable pseudopod formation.1 At or about the same time, portions of the DMS dilate considerably and migrate into the cell periphery,5,37 presumably to prepare for microtubule-powered eversion as proplatelets. Our data raise the possibility that the protrusive force for internal DMS migration, distinct from subsequent elongation of proplatelets, might rely on actin fibers that assemble at the DMS cytoplasmic face in response to local PI-4,5-P2 signaling. This model is consistent with the demonstrated role of PI-4,5-P2 signaling in a range of membrane motility functions, including ruffle formation, endocytosis, membrane traffic, and phagocytosis.43-48 However, models of thrombopoiesis are inferred largely from still images of MKs, and current understanding of MK morphogenesis remains sketchy. DMS movement and eversion are especially mysterious acts, as are the role and fate of the MK plasma membrane. deBotton et al49 have identified phosphatidylserine as a membrane lipid present on MK but not proplatelet surfaces. The sum of evidence thus suggests that internal MK membranes acquire distinctive biochemical and functional properties, whereas parts of the cell bounded by the plasma membrane are destined to degenerate.
Our results help construct a rough outline that divides terminal MK differentiation into sequential phases. DMS invagination occurs after endomitosis is completed, and expansion of the DMS mass and synthesis of platelet granules occur simultaneously.7,50 Despite the origin of the DMS in the plasma membrane, it does not appear initially to contain much PI-4,5-P2, which the (PH)PLC 1 beacon reveals only in the plasma membrane (Figure 2). Subsequent loading of the DMS with PI-4,5-P2 correlates with subcellular localization of PIP4K , an enzyme that is required to increase MK size (Figure 4C) and stabilize DMS membranes (Figure 4D-E). These correlative observations suggest a causative effect that will need to be established in future genetic and molecular studies. Subsequently, actin filaments assemble near the DMS (Figure 5A-C) and are required after the cell achieves its terminal proportions: cytochalasin D and the N-WASp CA fragment interfere with proplatelet formation but not with MK enlargement (Figure 5K-O). We suggest that PI-4,5-P2 might serve as a molecular bridge between these steps and transmit one of several possible signals to trigger actin assembly. Finally, microtubules are mobilized to transport organelles and to extend proplatelets,1,5 a process that is largely independent of actin, although proplatelets contain long arrays of actin filaments.1,37 Each of these steps represents a potential target for interference, and it should soon be possible to consider thrombopoietic disorders according to the specific stage in MK maturation that is affected.
Distinctive PI species usually mark different cellular membrane compartments; PI-3-P and PI-3,5-P2, for example, are found on endosomes and internal vesicles, respectively (reviewed in Roth51). The bulk of cellular PI-4,5-P2 is usually present at the plasma membrane, with less than 10% detected in the Golgi and endoplasmic reticulum,23 and may be produced in a synthetic pathway via PI-4-P. The corresponding lipid kinases accordingly localize at the plasma membrane and, to a lesser degree, in nuclear speckles. These type I kinases may account for much of the cellular PIP2 turnover in MKs. However, as they are present mainly in the cell periphery but not in the DMS (Figure 3D-E), and the plasma membrane loses PIP2 over time, we suggest an additional role for type II kinases, which use PI-5-P as the substrate to generate PI-4,5-P2. Indeed, PIP4K Extension of branched actin filaments occurs through Arp2/3-containing complexes and WASp/WAVE proteins,36,53,54 which are expressed abundantly in MKs.55 PI-4,5-P2 enhances WASp binding to Arp2/336,56,57 and its accumulation on the mature DMS could trigger Rho-family GTPases to activate WASp/WAVE proteins locally and stimulate actin fiber assembly. Although our results imply that these are essential events to initiate PPF, actin is required again at a later step, when cytochalasins reduce or eliminate proplatelet branching.1,6 Furthermore, DMS-associated actin assembly probably represents one of many stimuli for PPF, because thrombopoiesis is blocked in NF-E2deficient MKs even though their DMS accumulates both PI-4,5-P2 and associated actin fibers (data not shown). For example, actin assembly in maturing MKs responds to external signals transmitted through integrins and other glycoprotein receptors.58 In summary, we show that the DMS is the source of proplatelet and platelet membranes and explore some of its characteristics. These studies, conducted exclusively in primary MKs, the only source of bona fide platelets, advance understanding of how MK membranes and cytoskeleton may be coordinated for platelet assembly and release.
We thank Tamás Balla, Hervé Falet, and Tom Roberts for PH-PLC 1, WASP-CA, and retroviral expression plasmids, respectively; Ben Neel for the gift of ecotropic retroviral packaging vector; Andreas Krueger for help with flow cytometry; Katja Lamia for PIP kinase assays; and John Hartwig for critical review of the manuscript. R.A.S. is a Scholar of the Leukemia and Lymphoma Society.
Submitted July 12, 2005; accepted January 12, 2006.
Prepublished online as Blood First Edition Paper, January 24, 2006; DOI 10.1182/blood-2005-07-2755.
Supported by the National Institutes of Health (R01HL63143) and by a fellowship from the Deutsche Forschungsgemeinschaft (Schu1421/2-1) (H.S.).
H.S. and R.A.S. designed and performed the research and wrote the paper; M.K., J.H., S.-W.K., and J.Z. designed and performed the research; L.C.C. and T.G. designed the research.
An Inside Blood analysis of this article appears at the front of this issue.
The online version of this article contains a data supplement.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Ramesh A. Shivdasani, Dana-Farber Cancer Institute, One Jimmy Fund Way, Boston, MA 02115; -mail: ramesh_shivdasani{at}dfci.harvard.edu.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||