Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 1 June 2006, Vol. 107, No. 11, pp. 4514-4523.
Prepublished online as a Blood First Edition Paper on February 2, 2006; DOI 10.1182/blood-2005-11-4745.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figure
Right arrow All Versions of this Article:
2005-11-4745v1
107/11/4514    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Falini, B.
Right arrow Articles by Nicoletti, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Falini, B.
Right arrow Articles by Nicoletti, I.
Related Collections
Right arrow Neoplasia
Right arrow Oncogenes and Tumor Suppressors
Right arrow Free Research Articles
Right arrowRelated Article in Blood Online
Right arrowRelated Letter in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

NEOPLASIA

Both carboxy-terminus NES motif and mutated tryptophan(s) are crucial for aberrant nuclear export of nucleophosmin leukemic mutants in NPMc+ AML

Brunangelo Falini, Niccolò Bolli, Jing Shan, Maria Paola Martelli, Arcangelo Liso, Alessandra Pucciarini, Barbara Bigerna, Laura Pasqualucci, Roberta Mannucci, Roberto Rosati, Paolo Gorello, Daniela Diverio, Giovanni Roti, Enrico Tiacci, Giovanni Cazzaniga, Andrea Biondi, Suzanne Schnittger, Torsten Haferlach, Wolfgang Hiddemann, Massimo F. Martelli, Wei Gu, Cristina Mecucci, and Ildo Nicoletti

From the Institute of Hematology and Internal Medicine, University of Perugia, Italy; the Institute for Cancer Genetics and Department of Pathology, Columbia University, New York, NY; the Institute of Hematology, University of Bari, Italy; the Institute of Hematology, University of Foggia, Italy; the Institute of Hematology, University La Sapienza, Rome, Italy; the Pediatric Clinic, M. Tettamanti Research Center, San Gerardo Hospital, Monza, Italy; and the Laboratory for Leukemia Diagnostics, Department of Internal Medicine III, Ludwig-Maximilian University, Munich, Germany.


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
We recently identified aberrant cytoplasmic expression of nucleophosmin (NPM) as the immunohistochemical marker of a large subgroup of acute myeloid leukemia (AML) (about one-third of adult AML) that is characterized by normal karyotype and mutations occurring at the exon-12 of the NPM gene. In this paper, we have elucidated the molecular mechanism underlying the abnormal cytoplasmic localization of NPM. All 29 AML-associated mutated NPM alleles so far identified encode abnormal proteins which have acquired at the C-terminus a nuclear export signal (NES) motif and lost both tryptophan residues 288 and 290 (or only the residue 290) which determine nucleolar localization. We show for the first time that both alterations are crucial for NPM mutant export from nucleus to cytoplasm. In fact, the cytoplasmic accumulation of NPM is blocked by leptomycin-B and ratjadones, specific exportin-1/Crm1-inhibitors, and by reinsertion of tryptophan residues 288 and 290, which respectively relocate NPM mutants in the nucleoplasm and nucleoli. NPM leukemic mutants in turn recruit the wild-type NPM from nucleoli to nucleoplasm and cytoplasm. These findings indicate that potential therapeutic strategies aimed to retarget NPM to its physiological sites will have to overcome 2 obstacles, the new NES motif and the mutated tryptophan(s) at the NPM mutant C-terminus.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
In acute myeloid leukemia (AML), a clinically and molecularly heterogeneous disease,1 recurrent cytogenetic abnormalities help define subgroups with different prognosis, and identify patients who might benefit from targeted therapies.1 However, almost half adult AMLs display normal karyotype at conventional cytogenetics,2 and the clinical and molecular features of this large subgroup of patients are still poorly understood.3,7

We recently observed that about 60% of adult AML with normal karyotype display aberrant cytoplasmic expression of nucleophosmin (NPM).8 A multifunctional protein9,15 that characteristically shuttles between the nucleus and the cytoplasm,16 NPM is found mainly in the nucleolus,17,19 where it is one of the most abundant of the approximately 700 proteins so far identified by proteomic techniques.20 Cytoplasmic NPM identifies a distinct subgroup of AML, named NPMc+ AML, that accounts for about 35% of all adult AML and is characterized by wide morphologic spectrum, multilineage involvement, high frequency of FLT3-ITD mutations, absence of CD34, and relatively good response to induction therapy.8 NPMc+ AML also has a distinct gene expression profile21 and carries mutations in exon-12 of the NPM gene8 that serve as predictor of favorable prognosis in AML with normal karyotype,22,24 and as a marker for monitoring of minimal residual disease.25

In spite of the close association between the aberrant cytoplasmic expression of NPM and exon-12 NPM mutations,8 the mechanism underlying cytoplasmic accumulation of NPM in leukemic cells and its interference with wild-type NPM protein remained to be elucidated.

Recently, Nakagawa et al26 asserted that the creation of a nuclear export signal (NES) motif at the C-terminus of NPM leukemic mutants (as consequence of the exon-12 NPM mutations) is alone responsible for cytoplasmic dislocation of NPM. In this paper, we provide evidence that the new NES motif created by the mutational event is not in itself sufficient to cause nuclear export of the NPM leukemic mutants and demonstrate it needs to act in concert with the mutated tryptophan(s) 288 and 290 at the mutant C-terminus. These findings have a relevant biological and potentially therapeutic significance.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Cells for transfection, primary AML samples, and OCI/AML3 cell line

Transfections were performed on NIH-3T3 murine fibroblasts and human lung carcinoma H1299 cells. Lymphoprep-isolated leukemic cells for biochemical studies were obtained from 3 patients with AML carrying NPM mutation A and 2 patients with AML with wild-type NPM. Bone marrow trephines from 20 patients with AML (10 with NPM mutations and 10 without NPM mutations) were B5-fixed/decalcified and embedded in paraffin, as previously described.8 The 10 NPM-mutated cases included 7 mutations A, 1 mutation B, and 2 mutations D. The human AML cell line OCI/AML3, which carries an exon-12 NPM mutation A,27 was provided by H. Drexler and grown in alpha–modified Eagle medium (MEM) plus 10% fetal bovine serum (FBS), 1% glutamine, and antibiotics.

Plasmid constructs

NPM mutants A, B, C, and D were generated by polymerase chain reaction (PCR) using NPMwt as template; the same forward primer (5'-CGCCACGCTAGCGAAGATTCGATGGAC-3') with different reverse primers were used for each mutant (mutant A: 5'-CTATTTTCTTAAAGAGACTTCCTCCACTGCCAGACAGAGATCTTGAATAGCCTCTTGG-3'; mutant B:5'-CTATTTTCTTAAAGAGACTTCCTCCACTGCCATGCAGAGATCTTGAAT AGCCTCTTGG; mutant C: 5'-CTATTTTCTTAAAGAGACTTCCTCCACTGCCACGCA GAGATCTTGAATAGCCTCTTGG; and mutant D: 5-CTATTTTCTTAAAGAGACTTCCTCCAC TGCCAGGCAGAGATCTTGAATAGCCTCTTGG). The PCR products of mutants A, B, C, and D were cloned into the pcDNA3.1/NT-GFP-TOPO vector (Invitrogen, Carlsbad, CA). To generate the double-flag–HA tag at the N-terminal of both wild-type NPM and mutant A, PCR was performed with either wild-type or mutant A as template; 5'-CGCCACGCTAGCGAAGATTCGATGGAC and 5'-TCAAGAATTCCAGAAATGAAATAAGACGG were used, respectively, as forward and reverse primers. The PCR product was excised by NheI and EcoRI, and the resulting fragment was subcloned into the PCIN4 vector containing the Flag-HA tag at the N-terminal of the inserted fragment.

Constructs pEGFP-C1-NPM_MUT_A_A290W, pEGFP-C1-NPM_MUT_A_C288W+A290W, and pEGFP-C1-NPM_MUT_A_NO_ 2nd_NES were generated using pEGFP-C1-NPMmA8 as a template, by a set of 2 partially self-complementary primers bearing the desired mutation. The 2 primers were annealed, and the resulting double-stranded DNA sequence bearing BglII-EcoRI–compatible ends was ligated into the pEGFP-C1-NPMmA vector previously digested with the same 2 enzymes, exploiting the localization of the mutated region between these restriction sites. The sequences of primers are the following: NPM_ MUT_A_A290W_FOR: 5'-GATCTCTGTCTGTGGGTGGAGGAAGTCTCTTTAAGAAAATAGG-3'; NPM_MUT_A_A290W_REV: 5'-AATTCCTATTTTCTTAAAGAGACTTCCTCCACCCACAGACAGA-3'; NPM _MUT_A_C288W+A290W_FOR: 5'-GATCTCTGGCTGTGGGTGGAGGAAGTCTCTTTAAGAAAATAGG-3'; NPM_MUT_A_C288W+A290W_ REV: 5'-AATTCCTATTTTCTTAAAGAGACTTCCTCCACCCACAGCCAGA-3'; NPM_MUT_A_NO_2nd_NES_FOR: 5'-GATCTCTGTGGAGCAGGGGAGGAAGGCTCTTTAAGAAAATAGG-3'; and NPM_MUT_A_ NO_2nd_NES_REV: 5'-AATTCCTATTTTCTTAAAGAGCCTTCCTCCCCTGCTCCACAGA-3'.

pEGFP-C1-NPM mutants E, G, and pEGFP-C1-NPM_MUT_ A_NO_1st_NES were generated with the QuikChange Multi Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA), using pEGFP-C1-NPMwt8 (for mutants E and G) and pEGFP-C1-NPMmA (for deletion of the first NES) as a template. The manufacturer's instructions were followed except for transformation of bacteria, which was done with 5 µL PCR products instead of 1 µL. Primers were designed on the following sequences: NPM-_MUT_E: 5'-GATCTCTGGCAGTCTCTTGCCCAAGTCTCTTTAAG-3'; NPM_MUT_G: 5'-GATCTCTGGCAGTGCTTCGCCCAAGTCTCTTTAAG-3'; and NPM_MUT_A_NO_1st_NES: 5'-GCACCAGTTATCTGGAAGAACGGGCAGTTTAGGGGCTGG-3'. Every construct was validated by DNA sequencing.

Antibodies

We previously used anti-NPM monoclonal antibodies17,18 that recognize both wild-type and mutated NPM proteins. To study the NPM mutants without the interference of wild-type NPM, we generated an affinity-purified polyclonal antibody (Sil-C) against the synthetic peptide NHCOCH3-CLAVEEVSLRK-COOH (Inbio-Ltd, Tallin, Estonia) corresponding to NPM mutant A. The specificity of Sil-C for the NPM mutant was confirmed by Western blotting (Figure S1, available on the Blood website; see the Supplemental Figure link at the top of the online article). To assess the subcellular distribution of wild-type NPM without the interference of leukemic NPM mutants, we used a mouse monoclonal antibody (clone FC-61991) that recognizes the wild-type but not mutant NPM proteins (Invitrogen, Carlsbad, CA). The antinucleolin/C23 monoclonal antibody, used as a control, was purchased from DakoCytomation (Glostrup, Denmark).

Inhibition of the Crm1-dependent nuclear export pathway

Expression vectors (5 µg) coding HA-NPM wild-type, enhanced green fluorescent protein (eGFP)–NPMmA, or both were transfected in H1299 cells by the calcium-phosphate precipitation method. After 24 hours, cells were treated with 20 nM leptomycin B (LMB; Sigma, St Louis, MO) for 8 hours or left untreated. Cells were fixed with 4% paraformadehyde for immunofluorescence analysis.

NIH-3T3 cells were transfected using Lipofectamine 2000 (Invitrogen) following manufacturer's instructions. After 24 hours, cells grown on glass coverslips were incubated with 10 µg/mL cycloheximide (Merck Biosciences, Nottingham, United Kingdom) (30 minutes), and 20 ng/mL LMB (Merck Biosciences) (5 hours) or 20 ng/mL ratjadones A and C (Alexis Biochemicals, Carlsbad, CA) (5 hours). For immunofluorescence studies, cells were fixed in 4% paraformaldehyde (10 minutes). For time-course experiments, transfected cells were transferred on an Attofluor chamber (Molecular Probes, Eugene, OR) and observed on a MRC-1024 (BioRad, Cambridge, United Kingdom) confocal apparatus mounted on an Olympus IMT-2 microscope with an SPlan 60 x/1.4 numeric aperture (NA) oil objective (Olympus, Tokyo, Japan). Images of a single slice of cells were recorded in the basal state and after LMB addition at 60-second intervals using the time-series function of the LaserSharp (BioRad) software. The 488-nm line of an argon laser was used for excitation and a 505-550–nm band-pass filter on the PMT2 was used for collecting the fluorescence emission. The images were processed and analyzed with the public-domain ImageJ software (Rasband WS, Image J; US National Institutes of Health, Bethesda, MD; http://rsb.info.nih.gov/ij/, 1997-2005). Confocal image analysis was performed as previously described.27

For Western blot analysis of eGFP-NPM mutant A subcellular distribution, NIH-3T3 cells transfected with either pEGFP-C1 or pEGFP-C1-NPMmA were incubated with 20 ng/mL LMB (or vehicle, as control) in absence of cycloheximide for either 3 or 6 hours. Cells were then harvested, washed in phosphate-buffered saline (PBS) and lysed in hypotonic buffer according to the method of Schreiber et al,28 slightly modified. The supernatant was saved as cytoplasmic fraction. The pellet fraction, containing nuclei, was washed with hypotonic buffer, solubilized in hypertonic buffer and boiled in SDS before loading. Equivalent dilutions (representing equal number of cells) of the cytoplasmic and pellet fractions were prepared for Western blot analysis of eGFP-NPM mutant A distribution with an anti-GFP monoclonal antibody (Roche, Indianapolis, IN).

The OCI/AML3 cell line cells were seeded in growth medium (106 cells/mL in 24-well plates) and incubated at 37°C with 5% CO2 for 5 hours. Following overnight incubation with LMB (20 ng/mL), cells were washed in PBS, centrifuged, fixed in B5, and embedded in paraffin for immunostaining. Primary leukemic cells from a NPMc+ patient with AML with a high peripheral blood count were processed in the same way.

Immunostaining procedures

For the Flag-HA constructs, H1299-fixed cells were permeabilized with 0.2% Triton-X 100 (10 minutes) and blocked with 10% antigoat serum (30 minutes). Primary antibody anti-HA (1:1000; Roche) was incubated with cells (1 hour), followed by secondary antibody Alexa 568–conjugated antirat (1:1000; Molecular Probes) for 30 minutes. Nuclei were visualized by DAPI staining. Images were collected using a Nikon Eclipse E400 microscope and a 40 x/1.3 NA oil objective. Pictures were captured by the Spot Camera coupled with Spot 4.09 imaging software (Diagnostic Instruments, Sterling Heights, MI).

The nuclei of NIH-3T3 cells transfected with pEGFP-C1-NPM mutants and pEGFP-C1-NPMwt were visualized with propidium iodide. pEGFP-C1-NPM mutants transfected NIH-3T3 were immunostained with a specific antinucleolin antibody followed by a secondary Texas-Red–conjugated goat antimouse antibody (Southern Biotechnology Associates, Birmingham, AL); nuclei were counterstained with TO-PRO-3 (Molecular Probes). Paraffin-embedded samples from the OCI/AML3 cell line and 1 patient with NPMc+ AML were immunostained with anti-NPM monoclonal antibody.8,29 The primary antibody was revealed using the immunoalkaline phosphatase APAAP technique8,29 and hematoxylin counterstain or a secondary Alexa 488–conjugated goat antimouse antibody (Molecular Probes) and propidium iodide counterstain.

Cellular extracts, Western blotting, and coprecipitation studies

Nuclear and cytoplasmic extracts were prepared either using the NE-PER Nuclear and Cytoplasmic Extraction kit (PIERCE Biotechnology, Rockford, IL) or according to the Schreiber's method,28 slightly modified. For immunoprecipitation, cells were lysed in 1 mL ice-cold lysis buffer (0.5% NP-40, 150 mM NaCl, 25 mM Tris [pH 7.5], 1 mM EDTA, 1 mM Na3VO4, 1 µg/mL leupeptin, 1 µg/mL aprotinin, and 1 mM phenylmethylsulfonyl fluoride). After incubation on ice (20 minutes), lysates were centrifuged at 14 000g (10 minutes at 4°C) and then incubated with 4 µg of either control immunoglobulin G (IgG), rabbit anti-NPMm (Sil-C), or mouse anti-NPM (clone 376),8 followed by 30 µL Protein A/G Plus–agarose beads (Santa Cruz Biotechnology, Santa Cruz, CA) rocking overnight at 4°C. Beads were extensively washed with buffer containing 0.1% NP-40, 150 mM NaCl, 25 mM Tris (pH 7.5), 1 mM EDTA, and inhibitors. Proteins were separated by SDS–polyacrylamide gel electrophoresis (SDS-PAGE), transferred to polyvinylidene difluoride (PVDF; Millipore, Billerica, MA), and probed with either rabbit polyclonal anti-Crm1 (Santa Cruz Biotechnology) or mouse monoclonal anti-Crm1 antibody (BD Transduction Laboratories, Palo Alto, CA), followed by horseradish peroxidase–conjugated secondary antibodies. Polypeptides were detected using the enhanced chemiluminescence (ECL) method (Amersham Bioscience, Uppsala, Sweden).


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
All NPM exon-12 mutations create a leucine-rich NES motif in the carboxy-terminal portion of the NPM protein

Analysis of the 6 NPM mutant forms (A to F) originally identified in NPMc+ AML (Table 1)8 revealed a putative nuclear export signal (NES) motif26 in the C-terminal portion of NPM proteins, which was suggested to be responsible for abnormal NPM cytoplasmic expression. This hypothesis implies that a NES motif is present in all NPM mutant proteins generated by NPM exon-12 mutations.


View this table:
[in this window]
[in a new window]
 
Table 1.. Changes in tryptophans 288 and 290 and creation of a NES motif in NPM mutant proteins generated by 29 NPM exon-12 mutations in 1554 patients with AML

 
Therefore, we searched for additional exon-12 NPM mutations in patients with AML. Table 1 lists the 29 NPM mutations that have been so far identified by mutational screening of a total of 1554 patients with AML.8,22,24,30,32 In addition to the 6 NPM mutants forms (A to F) we initially reported,8 they include 3 new mutations (G to I) that we identified in 107 pediatric patients,30 6 new mutations (Gm to Qm) that we identified in 401 patients with AML with normal karyotype of the protocol 99 of the German AML Cooperative Group (AMLCG),23 9 new mutations (numbered in Table 1 as 1, 3, 4, 6, 7, 12, 13, 10, and 14) reported by Dohner et al,22 4 new mutations (G{dagger} to J{dagger}) reported by Suzuki et al,31 and 1 new mutation (I{delta}) reported by Verhaak et al.24

We analyzed the NPM mutant proteins derived from the 29 mutation variants listed in Table 1 for the presence of a NES motif, as defined by a short stretch of amino acids characterized by multiple hydrophobic residues with typical spacing (eg, {psi}XXX{psi}XX{psi}X, where {psi} indicates large hydrophobic residues such as leucine, isoleucine, methionine, valine, or phenylalanine).33

The most frequent NES motif was L-xxx-V-xx-V-x-L that was present in 20 (69%) of 29 NPM leukemic mutants. Nine (31%) of the 29 mutants carried a NES motif in which the valine at the second position of NES motif was replaced with another hydrophobic amino acid. In particular, 3 (10.4%) of 29 mutants carried the L-xxx-L-xx-V-x-L motif; 2 (6.9%) of 29 mutants (Table 1; mutations G and H) displayed the L-xxx-F-xx-V-x-L motif; 2 (6.9%) of 29 mutants (Table 1; mutations 10 and 14) had the L-xxx-C-xx-V-x-L motif; and 1 (3.4%) of 29 mutants (Table 1; mutation 1) exhibited the L-xxx-M-xx-V-x-L motif. Of the 29 mutants, 1 (3.4%) (Table 1; mutation 6), generated by a deletion of 7 nucleotides and insertion of 14 nucleotides, showed at the C-terminus the sequence LWQDFLNRLFKKIV. Although this sequence slightly deviates from the accepted NES consensus L-x-(2,3)-(LIVFM)-x(2,3)-L-x-(LI)33 present in the other 29 mutants, it is still consistent with a leucine-rich NES because of the presence of 5 hydrophobic residues (leucine and phenylalanine) within a region of 10 amino acids.34

In conclusion, generation of an additional NES motif in the C-terminal portion of the NPM protein is one common consequence of NPM exon-12 mutations in NPMc+ AML.

Export of NPM leukemic mutants is NES dependent

Finding an additional NES motif suggests cytoplasmic dislocation of NPM may be due to a more active transport of the NPM mutants by Crm1 (exportin 1),35 the receptor for the NES motif of yeast and mammalian proteins.36,37

To test this hypothesis, we looked for perturbations in the nucleo-cytoplasmic transport of NPM mutant proteins in the presence/absence of the specific Crm1 inhibitor LMB.35 H1299 or NIH3T3 cells were transfected with plasmids expressing NPM mutants A to D, fused to enhanced green fluorescent protein (eGFP), or NPM wild-type as control, and analyzed by immunofluorescence before and after treatment with LMB. In basal conditions, all 4 NPM mutant proteins were localized in the cytoplasm while NPM wild-type was restricted to the nucleoli, as expected (Figure 1A). However, LMB treatment completely relocated the cytoplasmic NPM mutants A to D into the nucleus (Figure 1B). Identical results (not shown) were obtained in NIH-3T3 cells transfected with mutant A and treated with ratjadones A and C that inhibit specifically the Crm138 with the same mechanism as LMB.39 Time course experiments with mutant A showed that about 50% of protein was relocated in the nucleus at 20 minutes and the process was completed after 1 hour (Figure 1C-D). Western blot analysis of eGFP-NPM mutant A subcellular distribution in LMB-treated NIH-3T3 cells confirmed a time-dependent accumulation of the intact eGFP-NPM mutant A protein (64 kDa) in the pellet fractions (containing the nuclei) (Figure 1E). No alteration of eGFP protein (27 kDa) localization was observed in LMB-treated cells (only a mild contamination of the pellet fractions by the overexpressed protein was detected). In untreated cells, either eGFP or eGFP-NPM mutant A protein were found (except for the contaminant part) only in cytoplasmic fractions, as expected.

Confocal microscopy analysis of eGFP-NPM mutant A (L-xxx-V-xx-V-x-L NES motif) showed that relocalization of the mutated protein induced by LMB was limited to the nucleoplasm (Figure 2A, top panel). This localization clearly differed from that of eGFP-NPM wild-type protein which, as expected, was located in the nucleoli, whether LMB was present or not (Figure 2A, middle panel). Transient transfection with pEGFP-C1-NPMmA and immunostaining for nucleolin/C23 followed by 3D reconstruction confirmed that intranuclear location of NPM mutant A (nucleoplasm, green) and nucleolin (nucleoli, red) were mutually exclusive (Figure 2A, lower panel). A nucleoplasmic staining pattern (not shown) was observed after LMB treatment with 1 rare NPM mutant bearing the NES motif L-xxx-F-xx-V-x-L (mutant G; Table 1).

LMB also caused nuclear relocation of the mutant NPM in the OCI/AML3 cells (Figure 2B) that are known to carry the exon-12 mutation A.27 In these cells, Crm1 and NPM mutant A were shown to coprecipitate, indicating a physical interaction between the 2 molecules (Figure 2C). Leptomycin induced similar nuclear relocation of NPM in primary leukemic cells of 1 patient with NPMc+ AML (not shown).

Finally, the requirement of a NES motif for abnormal cytoplasmic expression of NPM was further documented by testing the subcellular localization of a modified eGFP-NPM mutant A construct where the 2 valine residues in the NES motif were replaced by glycines. Transient transfection of NIH-3T3 cells with this construct showed that the NPM mutant accumulated in the nucleoplasm, whether LMB was present or not (Figure 3, right panel).

These results provide evidence that aberrant cytoplasmic localization of NPM mutants in NPMc+ AML is a NES-dependent event.

Two NESs are better than one

The NPM wild-type protein contains a putative physiologic N-terminus NES motif at position 92-104.40 To assess the contribution of the physiologic versus additional C-terminus NES motif created by the mutations in causing abnormal cytoplasmic expression of NPM, we tested the subcellular localization of modified eGFP-NPM mutant A constructs where the second and third hydrophobic residues of the N-terminal or C-terminal NES motif were replaced by glycines (Figure 3). Transient transfection of NIH-3T3 with such constructs showed that the NPM mutants lacking either the physiologic (N-terminus) or the new mutation-related (C-terminus) NES accumulated in the nucleoplasm (Figure 3, middle and right panels), indicating that the nuclear export and cytoplasmic accumulation of NPM mutants can only occur in the presence of 2 NES motifs (Figure 3, left panel); LMB had no effect on subcellular localization of the 2 mutants (not shown).


Figure 1
View larger version (29K):
[in this window]
[in a new window]
 
Figure 1.. Nuclear export of NPM mutants is NES dependent. (A-B) H1299 cells transfected with cDNA encoding for the NPMwt and the NPM mutant proteins A to D8 in the absence (A) and presence (B) of LMB. eGFP-NPMwt localizes in the nucleoli both in the presence and absence of LMB. In the absence of LMB, all GFP mutants (A-D) show the expected aberrant cytoplasmic location (A). The same eGFP-mutants are completely relocated in the nucleus in the presence of LMB (B). (C-E) Time-course analysis of LMB induced nuclear retention of eGFP-NPMmutA in NIH-3T3 cells. (C) Confocal microscope images of NIH-3T3 cells at the indicated time points. {circ} represents the regions (regions of interest [ROIs]) where the mean fluorescence emission of eGFP-NPMmutA was calculated in the experiment (eg, nucleus [N], cytoplasm [Cy], and the Golgi apparatus [G]). (D) Time-course measurements of mean fluorescence in the selected areas (ROIs) of NIH-3T3 cells. LMB addition produced a loss of fluorescence in the cytoplasm and Golgi apparatus and a concomitant increase in the mean fluorescence of the nucleoplasm. ImageJ software was used for the generation of ROIs and time-course analysis. (E) Western blot analysis of eGFP-NPMmutA subcellular distribution in NIH-3T3 cells with anti-GFP monoclonal antibody. LMB treatment induces a time-dependent accumulation of eGFP-NPMmutA in the pellet fractions (P). Purity of the subcellular fractions was assessed by stripping the membrane and reblotting with an anti–beta-tubulin antibody (bottom panel). Only a nonsignificant contamination was detected for the overexpressed proteins (as evident in the GFP blotting) (middle panel). In untreated cells, eGFP-NPMmutA (except for the contaminant part) was found only in the cytoplasmic fractions (Cy). The experiment was conducted in absence of cycloheximide so that continuous presence of GFP-NPMmA in the cytoplasmic fraction during LMB treatment was detected with time.

 
Role of tryptophans 288 and 290 in nucleolar binding and nuclear export of NPM leukemic mutants

After LMB treatment, NPM mutant A relocated into the nucleoplasm but not in the nucleoli (Figure 2A, top and bottom panels). This finding was not unexpected as both tryptophans 288 and 290 are mutated in this sequence, and the homologous residues in rats (positions 286 and 288) appear to be critical for nucleolar localization of wild-type NPM, with mutations of both tryptophans resulting in nucleoplasmic delocalization of the protein.41

All 29 NPM mutant proteins carried a mutated tryptophan 290, while tryptophan 288 was retained in 9 (31%) of 29 mutants (Table 1). Analysis of tryptophan mutations and NES motif distribution in NPM mutants revealed that the NES most commonly found in the NPM mutants (ie, L-xxx-V-xx-V-x-L) is always associated with mutations of both tryptophans, while tryptophan 288 is retained only in the NPM mutants carrying variants of the most common NES motif (ie, substitution of the valine at the second position of NES with leucine, phenylalanine, cysteine, or methionine).

We used constructs expressing NPM mutant E (Table 1) fused to eGFP to assess the effect of the single mutation at tryptophan 290 on nucleolar binding. After treatment with LMB, cytoplasmic mutant E, like mutant A, relocated to the nucleoplasm; however, mutant E also retained some capability to target nucleoli, as traces of GFP were detected in these structures (Figure 4). A similar pattern was observed using a derivative construct of mutant A with tryptophan 290 reinserted by site-directed mutagenesis (A290W; Figure 4). Notably, when both tryptophans were reinserted in mutant A (C288W + A290W), the mutant protein localized completely to the nucleoli whether LMB was present or not (Figure 4), suggesting a dose effect for tryptophan molecules.

These findings provide evidence that: (1) tryptophan 290 is mutated in all NPM leukemic mutants; (2) tryptophan 288 is retained only in NPM mutants carrying a NES variant other than the most common motif L-xxx-V-xx-V-x-L; (3) as in the rat,41 tryptophans 288 and 290 are both important for nucleoli targeting; (4) maximum dislocation of NPM mutants from nucleoli to nucleoplasm occurs when both tryptophans are mutated; and (5) NES-dependent nuclear export of the NPM mutant A is blocked following reinsertion of both tryptophans 288 and 290.

Identification of the mutant NPM protein by a novel specific antibody

Currently used anti-NPM antibodies17 do not discriminate between wild-type and mutated NPM proteins, which, since NPM exon-12 mutations are heterozygous,8 are both found in leukemic cells.


Figure 2
View larger version (52K):
[in this window]
[in a new window]
 
Figure 2.. LMB relocates NPM mutants in the nucleoplasm. (A) Confocal microscopy of NIH-3T3 cells transfected with pEGFP-C1-NPMmA or pEGFP-C1-NPMwt in presence and absence of LMB. In basal conditions, the mutant A is cytoplasmic (top left) but relocates in the nucleoplasm (top right) following incubation with LMB. eGFP-NPMwt localizes in the nucleoli both in the presence and absence of LMB (middle panel, left and right). The bottom panel shows LMB-treated cells transfected with pEGFP-C1-NPMmA (green) and immunostained with an antinucleolin (C23) monoclonal antibody (Texas red)–labeling nucleoli (arrow). The nuclear membrane is blue (TO-PRO-3 staining). After LMB, the eGFP-NPM mutant A was relocated in the nucleoplasm. Nucleolar exclusion was confirmed by an electronic cut of the nucleolar surface (inset in the bottom right figure). (B) The anti-NPM antibody 376 labels both nucleoli and cytoplasm of OCI/AML3 cells in the absence of LMB (left). Incubation with LMB results in nucleoplasmic relocation of the cytoplasmic NPM (right). Images were collected as described27 using a Zeiss Plan Apochromat 100 x/1.4 NA oil objective. (C) OCI-AML3 and U937 cell lysates were subjected to immunoprecipitation (IP) with either control IgG or rabbit anti-NPMm (Sil-C) and mouse anti-NPM (Cl. 376): Western blots with anti-Crm1 antibodies are shown in the top panels. Blotting with the anti-NPMm (Sil-C) and anti-NPM (Cl. 376) antibody are also shown (middle and bottom panels). WCL indicates OCI-AML3 whole-cell lysate included as control.

 
Although the NPM mutant constructs localize exclusively in the cytoplasm in transfected cells,8 subcellular distribution (nuclear vs cytoplasmic) of NPM mutant proteins in primary NPMc+ AML samples could not be investigated because of interference of NPM wild-type protein. To address this issue, we developed a polyclonal antibody (Sil-C) specifically directed against NPM mutants. Upon Western blotting, Sil-C recognized a specific 37-kDa band only in whole-cell lysates from NPMc+ AML primary cells (Figure 5A, top panel; patients 1-3) and not in NPMc AML samples (patients 4 and 5). Conversely, the anti-NPM monoclonal antibody 376, which also reacts with wild-type NPM, detected the 37-kDa band in all 5 patients (Figure 5A, bottom panel). In patient 2 (carrying NPM mutation A), the Sil-C antibody recognized the 37-kDa band only in the cytoplasm (Figure 5B, top panel) while the 376 antibody detected it in both nuclear and cytoplasmic fractions, as expected (Figure 5B, bottom panel).

These findings were confirmed by immunohistochemical staining of bone marrow biopsies from 10 patients with NPMc+ AML (Figure 5C). Interestingly, the Sil-C antibody not only stained the 7 NPMc+ AMLs carrying the mutation A, but also those carrying the mutation B (1 case) and D (2 cases). In all samples, Sil-C gave cytoplasmic-restricted positivity (Figure 5D), which, in competition experiments, was antagonized by the peptide used as immunogen (not shown). The same peptide did not antagonize cytoplasmic reactivity of a monoclonal antibody (clone 376) directed against a different epitope of NPM (not shown). As expected, immunostaining with monoclonal anti-NPM antibodies recognizing wild-type and mutated NPM17 resulted in nuclear plus cytoplasmic positivity of the leukemic cells (Figure 5E). The Sil-C antibody did not stain leukemic cells in any of the 10 AMLs with an unmutated NPM gene and nucleus-restricted expression of wild-type NPM (NPMc) used as a negative control (Figure 5F-G).


Figure 3
View larger version (50K):
[in this window]
[in a new window]
 
Figure 3.. Export of NPM mutants require 2 NES motifs. Confocal microscope analysis of NIH-3T3 transfected with either pEGFP-C1-NPMmA (left panel), pEGFP-C1-NPM_MUT_A_NO_1st_NES (middle panel), or pEGFP-C1-NPM_MUT_A_NO_2nd_NES (right panel). NPM mutant A containing both NES motifs localizes in the cytoplasm. Disruption of either N-terminal (middle panel) or C-terminal (right panel) NES motif in the NPM mutant A impedes nuclear export of the protein that appears localized in the nucleoplasm (middle and right panels, bottom). Images were collected as described27 using a Zeiss Plan Apochromat 100 x/1.4 NA oil objective.

 
These findings confirm that the endogenous mutated NPM proteins localize exclusively in the cytoplasm of primary NPMc+ AML cells, suggesting that export of mutated NPM protein from the nucleus is highly efficient and more rapid than nuclear import.


Figure 4
View larger version (44K):
[in this window]
[in a new window]
 
Figure 4.. NES and tryptophan(s) mutations act in concert to export NPM mutants. Confocal microscope analysis of NIH-3T3 transfected with either pEGFP-C1-NPMwt or different pEGFP-C1-NPM mutants. NPM mutant A localizes exclusively in the cytoplasm. The NPM mutant E, retaining tryptophan 288 but lacking tryptophan 290, partially relocalizes in the nucleoli when the nuclear export of the protein is blocked by LMB treatment. Reinsertion of the tryptophan 290 (NPMmutA, A290W) produced an almost identical effect. When both tryptophans (288 and 290) were reinserted in the mutant A, the eGFP-tagged protein totally localized into the nucleoli, despite the 2 NES motifs, whether LMB was present or not. Images were collected as described27 using a Zeiss Plan Apochromat 100 x/1.4 NA oil objective.

 
NPM mutants dislocate NPM–wild type in the nucleoplasm and cytoplasm

As all mutated NPM proteins conserve the N-terminal dimerization domain, they may be expected to form heterodimers with wild-type NPM, as occur with wild-type NPM and NPM-containing fusion proteins like NPM-ALK and NPM-MLF1.18,42,44

To assess whether delocalized NPM mutant proteins recruit wild-type NPM from nucleoli, we cotransfected H1299 cells with vectors encoding for wild-type NPM-HA and mutant A fused to eGFP. In basal conditions, both mutant (eGFP) and wild-type (anti-HA) NPM were detected in the cytoplasm, indicating NPM mutant A delocalized wild-type protein (Figure 6A). Upon treatment with LMB, both mutant and wild-type NPM shuttled to the nucleoplasm, with some wild-type protein being observed in the nucleoli (Figure 6A). These findings were confirmed by anti-Flag immunoprecipitation of Flag-HA-NPM–mutant A or Flag-HA-NPM-wt–transfected cells, followed by anti-HA and anti-NPM blotting (Figure 6B). These findings demonstrate that, in transfected cells, NPM mutants recruit wild-type protein from the nucleoli and partially delocalize it into the nucleoplasm and cytoplasm.

To investigate whether the wild-type NPM is cytoplasmic-dislocated even in primary AML cells carrying NPM mutations, we used the anti-NPM monoclonal antibody (clone FC-61991) that recognizes the wild-type but not mutant NPM proteins.45 Western blot and immunohistochemistry studies clearly demonstrated the endogenous wild-type NPM was localized both in the nucleus and cytoplasm in NPMc+ AML primary samples while, as expected, was restricted to the nucleus in NPMc AML cells (Figure 6C).

A putative mechanism of altered nucleo-cytoplasmic traffic of the mutated and wild-type NPM proteins in NPMc+ AML is depicted in Figure 6D.


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The present study shows how specific mutations on the NPM exon-12 sequences severely impair NPM nucleo-cytoplasmic trafficking in transfected cells, AML cell line OCI/AML3 (carrying exon-12 mutation A), and primary NPMc+ AML cells. Consequent to the mutations, 2 major alterations occur at the C-terminus of NPM leukemic mutants: (1) generation of a leucine-rich NES motif that reinforces the Crm1-dependent nuclear export of mutated NPM proteins; and (2) loss of the C-terminus tryptophan(s) residues that are normally required for NPM binding to the nucleoli.


Figure 5
View larger version (137K):
[in this window]
[in a new window]
 
Figure 5.. NPM mutants localize exclusively in the cytoplasm of leukemic cells. (A-B) Western blot analysis (Sil-C vs 376 mAb) of whole-cell lysates from either NPMc+ or NPMc AML cells (A) and of nuclear (N) and cytoplasmic (Cy) cell fractions from a patient with AML bearing NPM mutation A (B). Sil-C recognizes specifically the mutated NPM protein in the cytoplasmic fraction of NPMc+ primary leukemic cells. Results are representative of at least 3 independent experiments. (C-E) Bone marrow biopsy from a NPMc+ AML bearing mutation A. (C) Typical appearance of FAB-M5a type AML; the arrow points to a large leukemic cell with kidney-shaped nucleus. (D) The Sil-C antibody that recognizes specifically the NPM mutant (NPMm) shows a cytoplasmic-restricted positivity of leukemic cells (arrow); T indicates a bone trabecula. (E) Monoclonal anti–NPM 376 that recognizes both the wild-type and mutant NPM proteins labels leukemic cells both in the cytoplasm and the nucleus (arrow). (F-G) Bone marrow biopsy from a case of promyelocytic leukemia lacking NPM mutations (NPMc). (F) Typical appearance of AML FAB-M3 (hematoxylineosin). (G) The Sil-C antibody does not stain leukemic cells (devoid of mutated NPM protein) and only cross-reacts with a vessel wall; the asterisk indicates the lumen of the vessel (APAAP technique; hematoxylin counterstain). Images were collected using an Olympus BX51 microscope and a UPlanFl 100 x/1.3 NA oil (C-E) or a UPlanApo 40 x/0.85 (F-G) objective.

 


Figure 6
View larger version (51K):
[in this window]
[in a new window]
 
Figure 6.. NPM mutant A acts as a dominant-negative on wild-type NPM. (A) Cotransfection of H1299 cells with pEGFP-C1-NPMmA and HA-NPM wild-type. About 30% of cells were transfected and in about 70% of transfected cells the NPM mutant causes partial recruitment of the wild-type NPM from nucleoli to the nucleoplasm and the cytoplasm. (B) Both FH-NPMwt and FH-NPM mutant A interact with the endogenous NPM in H1299 cells. FH-NPM wt and FH-NPM mutant A plasmids were stably transfected into H1299 cells. In the left panel, 5% of the whole-cell lysates from stably transfected FH-NPMwt, FH-NPM mutant A, or control H1299 cells were subjected to Western blot with either {alpha}-NPM or {alpha}-HA. In the right panel, the rest 95% of whole cell lysates were immunoprecipitated with {alpha}-flag (M2), followed by Western blot with either {alpha}-NPM or {alpha}-HA. (C) Endogenous wild-type NPM protein is dislocated in the cytoplasm of NPMc+ AML primary samples. In the top panel, nuclear and cytoplasmic extracts from either NPMc+ or NPMc AML primary patient cells were subjected to Western blot analysis with either the anti-NPM mouse monoclonal antibody (clone FC-61991) from Invitrogen (anti-NPM wt) or the Sil-C antibody (anti-NPMm). A strong signal for NPMwt was evident in both the nuclear and cytoplasmic fraction of AML cells carrying NPM mutation but only in the nuclear fraction of NPMc–AML cells. The lower panel shows immunohistochemical study of 2 different AML samples with the anti-NPMwt antibody. The NPMc+ AML sample expresses the wild-type NPM both in the nucleus and cytoplasm (arrow). In contrast, the NPMc–AML sample shows the expected nucleus-restricted expression of wild-type NPM (arrow). Images were collected using an Olympus BX61 microscope and a UPlanFl 100 x/1.3 NA objective. (D) Hypothetical mechanism of altered nucleo-cytoplasmic traffic of NPM mutant A and wild-type NPM. Red circles indicate tryptophan residues; black circles, mutated tryptophans; magenta boxes, NES motif; blue boxes, mutated NPM protein; and green boxes, wild-type NPM protein. To simplify, the scheme shows only the binding of Crm1 to the mutant NES but not to the physiologic one, nor to the full ternary complex (Crm1-NES-ranGTP). NLS indicates nuclear localization signal.

 
The NPM wild-type protein contains a putative hydrophobic leucine-rich NES motif (I-xx-P-xx-L-x-L) within residues 94-102 which is conserved from Xenopus laevis to humans.40 Despite the presence of this motif, the NPM wild-type protein is mainly localized in the nucleoli suggesting that, in physiologic conditions, protein import greatly predominates over nuclear export. Interestingly, rat41 and human40 NPM wild-type protein mutants lacking the 2 tryptophans 288 and 290 delocalize in the nucleoplasm but not in the cytoplasm,40,41 strongly suggesting that the additional NES motif reinforces the leukemic NPM mutant ability to be exported from the nucleus to the cytoplasm. As the NES motif at the C-terminus of leukemic NPM mutant A is absent in the NPM wild-type protein, enhanced export could be due to the additive effects of the 2 NES and/or to an increased affinity of the new NES motif for Crm1. The results presented in this paper indicates that cytoplasmic accumulation of NPM mutants depends on the additive effect of the newly generated C-terminal NES motif.

The tryptophans 288 and 290 both appear to be important for nucleolar localization, with tryptophan 290 being perhaps more critical since it is mutated in all NPM mutants so far identified. Maximal inhibition of nucleolar binding and nucleoplasmic delocalization of mutants is observed when both tryptophans are mutated. Notably, mutations affecting both tryptophans 288 and 290 were detected in 20 (69%) of 29 NPM mutants identified to date, and account for about 95% of all tryptophan mutations found in NPM leukemic mutants.

The correlation between the type of NES motif and mutations of tryptophans 288 and 290 is intriguing. The observation that the NES motif most commonly found in the NPM mutants (ie, L-xxx-V-xx-V-x-L) is always associated with mutations of both tryptophans and that tryptophan 288 is retained only in the NPM mutants carrying variants of the most common NES motif (ie, substitution of the valine at the second position of NES with leucine, phenylalanine, cysteine or methionine), suggest a functional difference between the NES motifs.

Taken together, our data clearly show that, for cytoplasmic accumulation of NPM to occur, the 2 NES motifs and tryptophan(s) mutations must act in concert. This view clearly differs from that of Nagakawa et al,26 who claimed the NES motif at the C-terminus was the only player in cytoplasmic dislocation of NPM leukemic mutants. The mechanism of altered nucleo-cytoplasmic traffic in NPMc+ AML cells also emerges as different to what den Besten et al45 recently observed in transfected cells. In MT-Arf cells, leukemic NPM mutant A relocation after incubation with LMB is reported to be nucleolar, while we clearly demonstrate relocation of NPM mutant A by Crm1-inhibitors is nucleoplasmic in transfected NIH-3T3 cells. Several points need to be borne in mind when analyzing these discrepancies. Like Nakagawa et al,26 den Besten et al45 appear to disregard or underestimate the role of mutated tryptophan(s) 288 and 290 in the altered nucleo-cytoplasmic transport of NPM leukemic mutants. Artificial interference by the Arf protein in MT-Arf cells used by den Besten et al45 may be another factor. Finally, den Besten et al45 show that much wild-type NPM protein is delocalized in the cytoplasm by the NPM mutant A. Our immunohistologic studies of bone marrow biopsies using anti-NPM antibodies, including reagents specific for the wild-type and mutated NPM proteins, confirm the presence of cytoplasmic-dislocated wild-type NPM in primary NPMc+ AML cells, but also reveal that a residue of wild-type NPM remains in the nucleus (Figure 6C, bottom panels). Further studies are required to exactly quantify by fluorescence-based techniques the ratio of wild-type to mutated NPM in the subcellular compartments of NPMc+ primary leukemic cells.

Based on these findings, the following scenario can be envisaged. Mutated NPM proteins that retain the 2 nuclear localization signals (NLSs) enter the nucleus. Their capability to bind nucleoli is hindered completely (when both tryptophans are mutated) or partially (when only tryptophan 290 is altered). Nucleoplasmic NPM mutants may become easily available for binding to Crm1 roaming in the nucleoplasm46 through the NES motifs. NPM mutants accumulate in the cytoplasm most likely because the NES-Crm1–mediated nuclear export of mutants is more efficient than nuclear import. The NPM leukemic mutants cause in turn partial delocalization of the NPM wild-type protein from the nucleus to the cytoplasm.

Our demonstration that antibodies can be produced to react with mutant, but not with wild-type, NPM proteins is of biological interest and potential clinical relevance. It might be feasible in the future to use intracellular antibodies ("intrabodies")47 against NPM mutants to ablate protein function as an alternative to gene-based knockout technologies which do not appear to discriminate between wild-type and mutated NPM encoding RNAs (B.F. and A.L., unpublished observations, June 2005). The OCI/AML3 cell line may well serve as a preclinical model for screening intrabodies and other compounds designed to interfere with the NPM-altered nucleo-cytoplasmic traffic.

The NPM wild-type protein plays a critical role in the control of hematopoiesis (especially erythropoiesis) during embryonic development,15 and is involved in regulation of the Arf-p53 pathway9,11,14 and centrosome duplicaton.10,40 Our finding that in transfected cells NPM mutants recruit wild-type NPM to the nucleoplasm and cytoplasm suggests they interfere with native protein functions and could contribute to AML. However, exactly how the mutants exert their putative leukemogenic action remains elusive. Den Besten et al45 showed that NPM mutant proteins dislocate both wild-type NPM and the Arf protein into the cytoplasm, but were unable to demonstrate any transforming activity of the NPM mutants in NIH-3T3 and in Atm-null MEF cells. These findings suggest that NPM mutants could exert their transforming activity in a tissue-specific manner, an issue that needs to be addressed using appropriate animal models. Animal models show that AML may arise as result of the cooperative effect of different genetic lesions (eg, FLT3-ITD mutations in combination with molecular alterations, such PML-RAR alpha or AML1-ETO fusion genes).1 We previously demonstrated that FLT3-ITD mutations in AML with normal karyotype occur twice as frequently in cases with NPM mutations as in those without.8 Consequently, a major focus of future studies should be to determine whether interactions between FLT3-ITD and NPM mutations contribute to the leukemogenesis. Although at present there is no evidence for the leukemogenic potential of NPM mutations, if it should be demonstrated in the future, then retargeting NPM mutants to their physiologic cell compartment (nucleoli) might be a potential therapeutic strategy.36,37 This paper clearly shows that, to be successful, retargeting has to overcome 2 obstacles, the new NES motif and the mutated tryptophan(s) at the mutant C-terminus.


    Acknowledgements
 
We are indebted to Roberta Pacini, Alessia Tabarrini, and Barbara Verducci for their skillfull technical assistance, and to Claudia Tibidò for her excellent secretarial assistance. We would also like to thank Dr Geraldine Anne Boyd for her help in editing this paper.


    Footnotes
 
Submitted November 30, 2005; accepted January 21, 2006.

Prepublished online as Blood First Edition Paper, February 2, 2006; DOI 10.1182/blood-2005-11-4745.

Supported by the Associazione Italiana per la Ricerca sul Cancro (AIRC). L.P. is a Special Fellow of the Leukemia and Lymphoma Society. N.B. is supported by the Federazione Italiana per la Ricerca sul Cancro (FIRC).

Two of the authors (B.F. and C.M.) have applied for a patent, related to the work described in the present study, on the clinical use of NPM mutants.

N.B. and J.S. contributed equally to this work.

The online version of this article contains a data supplement.

An Inside Blood analysis of this article appears at the front of this issue.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Brunangelo Falini, Institute of Hematology, Policlinico Monteluce, 06122 Perugia, Italy; e-mail: faliniem{at}unipg.it.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Gilliland DG, Jordan CT, Felix CA. The molecular basis of leukemia. Hematology. Washington, DC: American Society of Hematology Education Program Book; 2004: 80-97.

  2. Grimwade D, Walker H, Oliver F, et al. The importance of diagnostic cytogenetics on outcome in AML: analysis of 1,612 patients entered into the MRC AML 10 trial: the Medical Research Council Adult and Children's Leukaemia Working Parties. Blood. 1998;92: 2322-2333.[Abstract/Free Full Text]

  3. Pabst T, Mueller BU, Zhang P, et al. Dominant-negative mutations of CEBPA, encoding CCAAT/enhancer binding protein-alpha (C/EBPalpha), in acute myeloid leukemia. Nat Genet. 2001;27: 263-270.[CrossRef][Medline] [Order article via Infotrieve]

  4. Schnittger S, Schoch C, Dugas M, et al. Analysis of FLT3 length mutations in 1003 patients with acute myeloid leukemia: correlation to cytogenetics, FAB subtype, and prognosis in the AMLCG study and usefulness as a marker for the detection of minimal residual disease. Blood. 2002; 100: 59-66.[Abstract/Free Full Text]

  5. Frohling S, Schlenk RF, Breitruck J, et al. Prognostic significance of activating FLT3 mutations in younger adults (16 to 60 years) with acute myeloid leukemia and normal cytogenetics: a study of the AML Study Group Ulm. Blood. 2002;100: 4372-4380.[Abstract/Free Full Text]

  6. Steudel C, Wermke M, Schaich M, et al. Comparative analysis of MLL partial tandem duplication and FLT3 internal tandem duplication mutations in 956 adult patients with acute myeloid leukemia. Genes Chromosomes Cancer. 2003; 37: 237-251.[CrossRef][Medline] [Order article via Infotrieve]

  7. Bullinger L, Dohner K, Bair E, et al. Use of gene-expression profiling to identify prognostic subclasses in adult acute myeloid leukemia. N Engl J Med. 2004;350: 1605-1616.[Abstract/Free Full Text]

  8. Falini B, Mecucci C, Tiacci E, et al. Cytoplasmic nucleophosmin in acute myelogenous leukemia with a normal karyotype. N Engl J Med. 2005; 352: 254-266.[Abstract/Free Full Text]

  9. Colombo E, Marine JC, Danovi D, Falini B, Pelicci PG. Nucleophosmin regulates the stability and transcriptional activity of p53. Nat Cell Biol. 2002; 4: 529-533.[CrossRef][Medline] [Order article via Infotrieve]

  10. Okuda M. The role of nucleophosmin in centrosome duplication. Oncogene. 2002;21: 6170-6174.[CrossRef][Medline] [Order article via Infotrieve]

  11. Kurki S, Peltonen K, Latonen L, et al. Nucleolar protein NPM interacts with HDM2 and protects tumor suppressor protein p53 from HDM2-mediated degradation. Cancer Cell. 2004;5: 465-475.[CrossRef][Medline] [Order article via Infotrieve]

  12. Bertwistle D, Sugimoto M, Sherr CJ. Physical and functional interactions of the Arf tumor suppressor protein with nucleophosmin/B23. Mol Cell Biol. 2004;24: 985-996.[Abstract/Free Full Text]

  13. Brady SN, Yu Y, Maggi LB Jr, Weber JD. ARF impedes NPM/B23 shuttling in an Mdm2-sensitive tumor suppressor pathway. Mol Cell Biol. 2004; 24: 9327-9338.[Abstract/Free Full Text]

  14. Korgaonkar C, Hagen J, Tompkins V, et al. Nucleophosmin (B23) targets ARF to nucleoli and inhibits its function. Mol Cell Biol. 2005;25: 1258-1271.[Abstract/Free Full Text]

  15. Grisendi S, Bernardi R, Rossi M, et al. Role of nucleophosmin in embryonic development and tumorigenesis. Nature. 2005;437: 147-153.[CrossRef][Medline] [Order article via Infotrieve]

  16. Borer RA, Lehner CF, Eppenberger HM, Nigg EA. Major nucleolar proteins shuttle between nucleus and cytoplasm. Cell. 1989;56: 379-390.[CrossRef][Medline] [Order article via Infotrieve]

  17. Cordell JL, Pulford KA, Bigerna B, et al. Detection of normal and chimeric nucleophosmin in human cells. Blood. 1999;93: 632-642.[Abstract/Free Full Text]

  18. Falini B, Mason DY. Proteins encoded by genes involved in chromosomal alterations in lymphoma and leukemia: clinical value of their detection by immunocytochemistry. Blood. 2002;99: 409-426.[Abstract/Free Full Text]

  19. Lam YW, Trinkle-Mulcahy L, Lamond AI. The nucleolus. J Cell Sci. 2005;118: 1335-1337.[Free Full Text]

  20. Andersen JS, Lam YW, Leung AK, et al. Nucleolar proteome dynamics. Nature. 2005;433: 77-83.[CrossRef][Medline] [Order article via Infotrieve]

  21. Alcalay M, Tiacci E, Bergomas R, et al. Acute myeloid leukemia bearing cytoplasmic nucleophosmin (NPMc+ AML) shows a distinct gene expression profile characterized by up-regulation of genes involved in stem-cell maintenance. Blood. 2005;106: 899-902.[Abstract/Free Full Text]

  22. Dohner K, Schlenk RF, Habdank M, et al. Mutant nucleophosmin (NPM1) predicts favorable prognosis in younger adults with acute myeloid leukemia and normal cytogenetics: interaction with other gene mutations. Blood. 2005;106: 3740-3746.[Abstract/Free Full Text]

  23. Schnittger S, Schoch C, Kern W, et al. Nucleophosmin gene mutations are predictors of favorable prognosis in acute myelogenous leukemia with a normal kayotype. Blood. 2005;106: 3733-3739.[Abstract/Free Full Text]

  24. Verhaak RG, Goudswaard CS, van Putten W, et al. Mutations in nucleophosmin NPM1 in acute myeloid leukemia (AML): association with other gene abnormalities and previously established gene expression signatures and their favorable prognostic significance. Blood. 2005;106: 3747-3754.[Abstract/Free Full Text]

  25. Gorello P, Cazzaniga G, Alberti F, et al. Quantitative assessment of minimal residual diseases in acute myeloid leukemia carrying nucleophosmin (NPM1) gene mutations. Leukemia. Prepublished on March 16, 2006, as DOI 10.1038/sj.leu.2404149.[CrossRef][Medline] [Order article via Infotrieve]

  26. Nakagawa M, Kameoka Y, Suzuki R. Nucleophosmin in acute myelogenous leukemia. N Engl J Med. 2005;352: 1819-1820.[Free Full Text]

  27. Quentmeier H, Martelli MP, Dirks WG, et al. Cell line OCI/AML3 bears exon-12 NPM gene mutation-A and cytoplasmic expression of nucleophosmin. Leukemia. 2005;19: 1760-1767.[CrossRef][Medline] [Order article via Infotrieve]

  28. Schreiber E, Matthias P, Muller MM, Schaffner W. Rapid detection of octamer binding proteins with "mini-extracts", prepared from a small number of cells. Nucleic Acids Res. 1989;17: 6419.[Free Full Text]

  29. Cordell JL, Falini B, Erber WN, et al. Immunoenzymatic labeling of monoclonal antibodies using immune complexes of alkaline phosphatase and monoclonal anti-alkaline phosphatase (APAAP complexes). J Histochem Cytochem. 1984;32: 219-229.[Abstract]

  30. Cazzaniga G, Dell'Oro MG, Mecucci C, et al. Nucleophosmin mutations in childhood acute myelogenous leukemia with normal karyotype. Blood. 2005;106: 1419-1422.[Abstract/Free Full Text]

  31. Suzuki T, Kiyoi H, Ozeki K, et al. Clinical characteristics and prognostic implications of NPM1 mutations in acute myeloid leukemia. Blood. 2005; 106: 2854-2861.[Abstract/Free Full Text]

  32. Boissel N, Renneville A, Biggio V, et al. Prevalence, clinical profile, and prognosis of NPM mutations in AML with normal karyotype. Blood. 2005;106: 3618-3620.[Abstract/Free Full Text]

  33. Bogerd HP, Fridell RA, Benson RE, Hua J, Cullen BR. Protein sequence requirements for function of the human T-cell leukemia virus type 1 Rex nuclear export signal delineated by a novel in vivo randomization-selection assay. Mol Cell Biol. 1996;16: 4207-4214.[Abstract]

  34. la Cour T, Gupta R, Rapacki K, Skriver K, Poulsen FM, Brunak S. NESbase version 1.0: a database of nuclear export signals. Nucleic Acids Res. 2003;31: 393-396.[Abstract/Free Full Text]

  35. Fukuda M, Asano S, Nakamura T, et al. CRM1 is responsible for intracellular transport mediated by the nuclear export signal. Nature. 1997;390: 308-311.[CrossRef][Medline] [Order article via Infotrieve]

  36. Macara IG. Transport into and out of the nucleus. Microbiol Mol Biol Rev. 2001;65: 570-594.[Abstract/Free Full Text]

  37. Kau TR, Way JC, Silver PA. Nuclear transport and cancer: from mechanism to intervention. Nat Rev Cancer. 2004;4: 106-117.[Medline] [Order article via Infotrieve]

  38. Koster M, Lykke-Andersen S, Elnakady YA, et al. Ratjadones inhibit nuclear export by blocking CRM1/exportin 1. Exp Cell Res. 2003;286: 321-331.[CrossRef][Medline] [Order article via Infotrieve]

  39. Meissner T, Krause E, Vinkemeier U. Ratjadone and leptomycin B block CRM1-dependent nuclear export by identical mechanisms. FEBS Lett. 2004;576: 27-30.[CrossRef][Medline] [Order article via Infotrieve]

  40. Wang W, Budhu A, Forgues M, Wang XW. Temporal and spatial control of nucleophosmin by the Ran-Crm1 complex in centrosome duplication. Nat Cell Biol. 2005;7: 823-830.[CrossRef][Medline] [Order article via Infotrieve]

  41. Nishimura Y, Ohkubo T, Furuichi Y, Umekawa H. Tryptophans 286 and 288 in the C-terminal region of protein B23.1 are important for its nucleolar localization. Biosci Biotechnol Biochem. 2002;66: 2239-2242.[CrossRef][Medline] [Order article via Infotrieve]

  42. Bischof D, Pulford K, Mason DY, Morris SW. Role of the nucleophosmin (NPM) portion of the non-Hodgkin's lymphoma-associated NPM-anaplastic lymphoma kinase fusion protein in oncogenesis. Mol Cell Biol. 1997;17: 2312-2325.[Abstract]

  43. Falini B, Pulford K, Pucciarini A, et al. Lymphomas expressing ALK fusion protein(s) other than NPM-ALK. Blood. 1999;94: 3509-3515.[Abstract/Free Full Text]

  44. Falini B, Bigerna B, Pucciarini A, et al. Aberrant subcellular expression of nucleophosmin and NPM-MLF1 fusion protein in acute myeloid leukaemia carrying t(3;5): a comparison with NPMc+ AML. Leukemia. 2006;20: 368-371.[CrossRef][Medline] [Order article via Infotrieve]

  45. den Besten W, Kuo ML, Williams RT, Sherr CJ. Myeloid leukemia-associated nucleophosmin mutants perturb p53-dependent and independent activities of the Arf tumor suppressor protein. Cell Cycle. 2005;4: 1593-1598.[Medline] [Order article via Infotrieve]

  46. Daelemans D, Costes SV, Lockett S, Pavlakis GN. Kinetic and molecular analysis of nuclear export factor CRM1 association with its cargo in vivo. Mol Cell Biol. 2005;25: 728-739.[Abstract/Free Full Text]

  47. Lobato MN, Rabbitts TH. Intracellular antibodies as specific reagents for functional ablation: future therapeutic molecules. Curr Mol Med. 2004;4: 519-528.[CrossRef][Medline] [Order article via Infotrieve]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?

Related Article in Blood Online:

Rush hour in AML: news on NPM traffic
Konstanze Döhner and Hartmut Döhner
Blood 2006 107: 4200-4201. [Full Text] [PDF]

Related Letter in Blood Online:

High frequency of NPM1 gene mutations in acute myeloid leukemia with prominent nuclear invaginations ("cuplike" nuclei)
Weina Chen, Georgios Z. Rassidakis, Jiang Li, Mark Routbort, Daniel Jones, Hagop Kantarjian, L. Jeffrey Medeiros, and Carlos E. Bueso-Ramos
Blood 2006 108: 1783-1784. [Full Text] [PDF]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
K. L. Inder, C. Lau, D. Loo, N. Chaudhary, A. Goodall, S. Martin, A. Jones, D. van der Hoeven, R. G. Parton, M. M. Hill, et al.
Nucleophosmin and Nucleolin Regulate K-Ras Plasma Membrane Interactions and MAPK Signal Transduction
J. Biol. Chem., October 9, 2009; 284(41): 28410 - 28419.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. G. Turner, D. C. Marchion, J. L. Dawson, M. F. Emmons, L. A. Hazlehurst, P. Washausen, and D. M. Sullivan
Human Multiple Myeloma Cells Are Sensitized to Topoisomerase II Inhibitors by CRM1 Inhibition
Cancer Res., September 1, 2009; 69(17): 6899 - 6905.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
F. Scaloni, S. Gianni, L. Federici, B. Falini, and M. Brunori
Folding mechanism of the C-terminal domain of nucleophosmin: residual structure in the denatured state and its pathophysiological significance
FASEB J, August 1, 2009; 23(8): 2360 - 2365.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. G. Grummitt, F. M. Townsley, C. M. Johnson, A. J. Warren, and M. Bycroft
Structural Consequences of Nucleophosmin Mutations in Acute Myeloid Leukemia
J. Biol. Chem., August 22, 2008; 283(34): 23326 - 23332.
[Abstract] [Full Text] [PDF]


Home page
haematolHome page
A. Liso, F. Castiglione, A. Cappuccio, F. Stracci, R. F. Schlenk, S. Amadori, C. Thiede, S. Schnittger, P. J.M. Valk, K. Dohner, et al.
A one-mutation mathematical model can explain the age incidence of acute myeloid leukemia with mutated nucleophosmin (NPM1)
Haematologica, August 1, 2008; 93(8): 1219 - 1226.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
T. S. Laughlin, M. W. Becker, J. L. Liesveld, D. A. Mulford, C. N. Abboud, P. Brown, and P. G. Rothberg
Rapid Method for Detection of Mutations in the Nucleophosmin Gene in Acute Myeloid Leukemia
J. Mol. Diagn., July 1, 2008; 10(4): 338 - 345.
[Abstract] [Full Text] [PDF]


Home page
haematolHome page
B. Falini, M. P. Martelli, C. Mecucci, A. Liso, N. Bolli, B. Bigerna, A. Pucciarini, S. Pileri, G. Meloni, M. F. Martelli, et al.
Cytoplasmic mutated nucleophosmin is stable in primary leukemic cells and in a xenotransplant model of NPMc+ acute myeloid leukemia in SCID mice
Haematologica, May 1, 2008; 93(5): 775 - 779.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. Garzon, M. Garofalo, M. P. Martelli, R. Briesewitz, L. Wang, C. Fernandez-Cymering, S. Volinia, C.-G. Liu, S. Schnittger, T. Haferlach, et al.
Distinctive microRNA signature of acute myeloid leukemia bearing cytoplasmic mutated nucleophosmin
PNAS, March 11, 2008; 105(10): 3945 - 3950.
[Abstract] [Full Text] [PDF]


Home page
haematolHome page
B. Falini, C. Mecucci, G. Saglio, F. L. Coco, D. Diverio, P. Brown, F. Pane, M. Mancini, M. P. Martelli, S. Pileri, et al.
NPM1 mutations and cytoplasmic nucleophosmin are mutually exclusive of recurrent genetic abnormalities: a comparative analysis of 2562 patients with acute myeloid leukemia
Haematologica, March 1, 2008; 93(3): 439 - 442.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Bolli, I. Nicoletti, M. F. De Marco, B. Bigerna, A. Pucciarini, R. Mannucci, M. P. Martelli, A. Liso, C. Mecucci, F. Fabbiano, et al.
Born to Be Exported: COOH-Terminal Nuclear Export Signals of Different Strength Ensure Cytoplasmic Accumulation of Nucleophosmin Leukemic Mutants
Cancer Res., July 1, 2007; 67(13): 6230 - 6237.
[Abstract] [Full Text] [PDF]


Home page
haematolHome page
B. Falini, I. Nicoletti, N. Bolli, M. P. Martelli, A. Liso, P. Gorello, F. Mandelli, C. Mecucci, and M. F. Martelli
Translocations and mutations involving the nucleophosmin (NPM1) gene in lymphomas and leukemias
Haematologica, April 1, 2007; 92(4): 519 - 532.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. Falini, I. Nicoletti, M. F. Martelli, and C. Mecucci
Acute myeloid leukemia carrying cytoplasmic/mutated nucleophosmin (NPMc+ AML): biologic and clinical features
Blood, February 1, 2007; 109(3): 874 - 885.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
T. Lechertier, V. Sirri, D. Hernandez-Verdun, and P. Roussel
A B23-interacting sequence as a tool to visualize protein interactions in a cellular context
J. Cell Sci., January 15, 2007; 120(2): 265 - 275.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Mrozek, G. Marcucci, P. Paschka, S. P. Whitman, and C. D. Bloomfield
Clinical relevance of mutations and gene-expression changes in adult acute myeloid leukemia with normal cytogenetics: are we ready for a prognostically prioritized molecular classification?
Blood, January 15, 2007; 109(2): 431 - 448.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. Grimwade
NPM1 mutation in AML: WHO and why?
Blood, December 15, 2006; 108(13): 3965 - 3965.
[Full Text] [PDF]


Home page
BloodHome page
L. Pasqualucci, A. Liso, M. P. Martelli, N. Bolli, R. Pacini, A. Tabarrini, M. Carini, B. Bigerna, A. Pucciarini, R. Mannucci, et al.
Mutated nucleophosmin detects clonal multilineage involvement in acute myeloid leukemia: impact on WHO classification
Blood, December 15, 2006; 108(13): 4146 - 4155.
[Abstract] [Full Text] [PDF]


Home page
ASH ANNUAL MEETING ABSTRACTSHome page
N. Bolli, M. Paola Martelli, B. Bigerna, A. Pucciarini, B. Verducci, T. Pallotta, F. de Marco, V. Pettirossi, R. Mannucci, E. Bonifacio, et al.
Reciprocal Interaction between NPM Leukemic Mutants and Arf: Structural Basis and Functional Consequences.
Blood (ASH Annual Meeting Abstracts), November 16, 2006; 108(11): 1939 - 1939.
[Abstract] [PDF]


Home page
BloodHome page
B. Falini, M. P. Martelli, N. Bolli, R. Bonasso, E. Ghia, M. T. Pallotta, D. Diverio, I. Nicoletti, R. Pacini, A. Tabarrini, et al.
Immunohistochemistry predicts nucleophosmin (NPM) mutations in acute myeloid leukemia
Blood, September 15, 2006; 108(6): 1999 - 2005.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
W. Chen, G. Z. Rassidakis, J. Li, M. Routbort, D. Jones, H. Kantarjian, L. J. Medeiros, and C. E. Bueso-Ramos
High frequency of NPM1 gene mutations in acute myeloid leukemia with prominent nuclear invaginations ("cuplike" nuclei).
Blood, September 1, 2006; 108(5): 1783 - 1784.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Enomoto, M. S. Lindstrom, A. Jin, H. Ke, and Y. Zhang
Essential Role of the B23/NPM Core Domain in Regulating ARF Binding and B23 Stability
J. Biol. Chem., July 7, 2006; 281(27): 18463 - 18472.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figure
Right arrow All Versions of this Article:
2005-11-4745v1
107/11/4514    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Falini, B.
Right arrow Articles by Nicoletti, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Falini, B.
Right arrow Articles by Nicoletti, I.
Related Collections
Right arrow Neoplasia
Right arrow Oncogenes and Tumor Suppressors
Right arrow Free Research Articles
Right arrowRelated Article in Blood Online
Right arrowRelated Letter in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2006 by American Society of Hematology         Online ISSN: 1528-0020