SEARCH:   Advanced

Blood, 15 February 2006, Vol. 107, No. 4, pp. 1643-1650. Prepublished online as a Blood First Edition Paper on October 20, 2005; DOI 10.1182/blood-2005-06-2509. This Article Abstract Full Text (PDF) All Versions of this Article: 2005-06-2509v1 107/4/1643    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Yakubenko, V. P. Articles by Ugarova, T. P. Search for Related Content PubMed PubMed Citation Articles by Yakubenko, V. P. Articles by Ugarova, T. P. Related Collections Hemostasis, Thrombosis, and Vascular Biology Phagocytes Cell Adhesion and Motility Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  PHAGOCYTES Integrin D2, an adhesion receptor up-regulated on macrophage foam cells, exhibits multiligand-binding properties Valentin P. Yakubenko, Satya P. Yadav, and Tatiana P. Ugarova From the Joseph J. Jacobs Center for Thrombosis and Vascular Biology, Department of Molecular Cardiology, Lerner Research Institute, Cleveland Clinic Foundation, OH.    Abstract Top Abstract Introduction Materials and methods Results Discussion References   Integrin D2, the most recently discovered member of the 2 subfamily of integrin adhesion receptors, is up-regulated on macrophage foam cells. Although other members of the subfamily have been subjects of extensive research, the recognition specificity and the molecular basis for D2 ligand binding remain unknown. Based on the high extent of structural homology between D2 and the major myeloid-cell-specific integrin M2 (Mac-1), noted for its capacity to bind multiple ligands, we considered that the 2 integrins have similar recognition specificity. In this study, using recombinant and natural D2-expressing cells, we demonstrate that D2 supports adhesion and migration to many extracellular matrix proteins in a fashion similar to M2. Consistent with these data, the recombinant DI-domain of the receptor bound selected ligands. The binding was activation-dependent because the DI-domain with its C-terminal 7 helix truncated, but not the form with the C-terminal part extended, bound ligands. When the DI-domain segment Lys244-Lys260 (highly homologous to its MI-domain counterpart Lys245-Arg261 responsible for M2 multiligand-binding properties) was inserted into the mono-specific LI-domain, the chimeric protein bound many ligands with affinities similar to those of wild-type DI-domain. These results establish integrin D2 as a multiligand receptor and indicate that the mechanism whereby D2 exhibits broad ligand specificity resembles that used by M2, the most promiscuous member of the integrin family.    Introduction Top Abstract Introduction Materials and methods Results Discussion References   Integrins are ubiquitous / heterodimeric adhesion receptors that mediate cell-cell and cell-extracellular-matrix (ECM) interactions. The subfamily of 2 integrins comprises a monophyletic group of closely related glycoproteins critically involved in leukocyte adhesion and migration during the inflammatory immune responses. The group consists of 4 members, L2 (LFA-1, CD11a/CD18), M2 (Mac-1, CD11b/CD18), X2 (p150,95, CD11c/CD18), and D2 (CD11d/CD18). These integrins are assembled as a group on the basis of their common 2 subunit and their expression restricted to leukocytes. Whereas structure-function relationships of 3 integrins, L2, M2, and X2, have been the subjects of intensive research, the ligand-binding specificity and pathophysiologic roles of the most recently discovered integrin D21 are poorly understood. Like 2 other highly related 2 integrins, M2 and X2, integrin D2 is expressed on myeloid cells such as monocytes and neutrophils. However, the pattern of expression of this integrin is unique among other myeloid cell-specific 2 integrins in that D2 is expressed poorly on peripheral blood leukocytes but strongly on macrophage foam cells within atherosclerotic plaques.1,2 In contrast, the major myeloid-specific integrin M2 is progressively up-regulated on circulating neutrophils and monocytes in response to chemotactic stimulation3,4 and is down-regulated in lesion-derived macrophages.5 The significance of the up-regulation of D2 in monocyte-derived cells from atherosclerotic lesions is not known. The role of high levels of D2 in these cells may become clear if the ligands with which this integrin interacts are defined. Previous studies demonstrated that D2 is capable of binding vascular cell adhesion molecule 1 (VCAM-1)6,7 and intercellular adhesion molecule 3 (ICAM-3).1 VCAM-1 is present on endothelial cells and, thus, clearly absent from the extravascular compartment in which formation of foam cells occurs. ICAM-3 is present on lymphocytes that are detectable in atherosclerotic lesions (for a review, see Getz8). However, recruitment of monocytes into atherogenic foci and their retention within lesions would require cell interactions with their surroundings. Yet, essentially nothing is known about the interaction of D2 with the ECM proteins. It is well documented that the interactions of 2 integrins with ligands are mediated by their I-domains, the regions of about 180 amino acid residues inserted into the -propeller of subunits.9 The DI-domain is highly homologous to the MI-domain with 60% of its amino acid sequence being identical. A distinctive feature of integrin M2 is its ability to bind numerous structurally diverse ligands, including many ECM proteins (reviewed in part by Yakubenko et al10). We have previously demonstrated that within the MI-domain, the M(Lys245-Arg261) segment contributes to the binding of many ligands.10 This segment forms the (D-5)-loop/5-helix in the 3-dimensional structure of the MI-domain11 and is the site of the major structure and sequence divergence between the MI-domain and the LI-domain, an integrin with a narrow ligand-binding specificity and that binds only ICAMs.12 We have noted that the MI-domain region M(Lys245-Arg261) and its homolog, Lys244-Lys260 in the DI-domain, have 59% identical and 12% conserved residues (Figure 1). Furthermore, 4 residues in the M sequence, Asp248, Tyr252, Asp254, and Pro257, which were shown to be critical for ligand binding by M2,13,14 are present in the DI-domain. Given these similarities, we hypothesized that D2 and M2 have overlapping recognition specificity and that the region in the DI-domain homologous to M(Lys245-Arg261) is involved in ligand binding. In the present study, we have examined the molecular basis for ligand binding by integrin D2. We have generated D2-expressing cells and demonstrated that they are capable of binding many ECM proteins with specificity overlapping that of M2, a finding that places D2 into the category of multiligand receptors. Furthermore, we have shown that the mechanism whereby D2 exhibits promiscuity in ligand binding is like that used by M2.    Materials and methods Top Abstract Introduction Materials and methods Results Discussion References   Proteins, peptides, and antibodies Human fibrinogen was obtained from Enzyme Research Laboratories (South Bend, IN). Fibronectin was isolated from fresh human plasma by gelatin-agarose affinity chromatography.15 Vitronectin was isolated from outdated plasma treated with 8 M urea using heparin-agarose affinity chromatography.16 Plasminogen was purified from human plasma using lysine-agarose affinity chromatography followed by gel filtration as described.17 Recombinant cysteine-rich angiogenic inducer (Cyr61) was a generous gift from Dr S. Lam (University of Illinois, Chicago, IL). VCAM-1 and ICAM-3 were purchased from R&D Systems (Minneapolis, MN). The P2-C peptide (TMKIIPFNRLTIG), corresponding to the fibrinogen sequence 383-395, was synthesized and purified as described.18 The monoclonal antibody (mAb) IB4 directed against the 2-integrin subunit and rat mAb 1/70, which recognizes mouse M integrin subunit, were purified from the conditioned media of the hybridoma cell line obtained from American Tissue Culture Collection (ATCC; Manassas, VA) using protein A agarose (Amersham Biosciences, Piscataway, NJ). Polyclonal antibody 1950 directed against the 1-integrin subunit was purchased from Chemicon (Temecula, CA). Polyclonal antibody against the DI-domain was generated by BioSource International (Camarillo, CA) using recombinant DI-domain as an immunogen. The antibody was isolated from rabbit serum by precipitation with 35% ammonium sulfate and then purified by affinity chromatography using DI-domain-Sepharose. The polyclonal antibody recognizes both human and mouse DI-domains and has no cross-reactivity with the M-integrin subunits (V.P.Y., unpublished data, May 2004). Purified rabbit, mouse, and rat IgG were purchased from Sigma (St Louis, MO). View larger version (35K): [in this window] [in a new window]   Figure 1.. Amino acid alignment of the MI-domain sequence Lys245-Arg261 with other integrin subunit I-domains. The MI-domain sequence was aligned with human X, D, L, 1, 2, 10, 11, and E using the National Center for Biotechnology Informatics (NCBI) database. Numbers on the right indicate the homology between M (assigned a value of 100%) and other subunits expressed as the percentage of identical residues (shown in bold). Dots above the DI-domain sequence indicate residues homologous between D and M. Residues identified as critical for ligand binding in the MI-domain13,14 are underlined.   Expression of recombinant I-domains and site-directed mutagenesis Two recombinant DI-domains, the "active" and "nonactive," were expressed in Escherichia coli. The cDNA encoding the "active" DI-domain (residues Pro128-Lys314) was generated by polymerase chain reaction (PCR) from a randomly primed cDNA library of the U937 monocytoid cell line. A PCR fragment was digested with NdeI and XhoI and inserted into the pET-15b vector (Novagen, Madison, WI). The DI-domain as a His-tag fusion protein containing 6 His residues at its NH2 terminus was purified from a soluble fraction of E coli lysates using affinity chromatography on Ni-chelating agarose (Qiagen, Valencia, CA). To express the "nonactive" DI-domain (residues Pro128-Ala323), the cDNA coding this region was amplified from the U937 cell library and inserted into the PGEX-4T-1 vector (Amersham Biosciences) using EcoRI and XhoI sites for expression in E coli BL-21(DE3) pLysS cells. The DI-domain as a fusion with GST was purified from a soluble fraction of E coli lysates using affinity chromatography on glutathione agarose essentially as described.14 The GST component was removed by cleavage with thrombin as described. The "active" LI-domain, originally described by Lu et al,19 was prepared using the previously created L-PGEX4T-1 construct (Gly128-Tyr307)14 as a framework. In the new construct, 2 lysines, Lys287 and Lys294, were substituted to cysteines to create a disulfide bond and, thus, lock the protein in the active conformation. Mutations were introduced using the QuickChange site-directed mutagenesis kit from Stratagene (La Jolla, CA) according to the manufacturer's instructions. The LI-domain as a fusion with GST was purified from a soluble fraction of E coli using affinity chromatography on glutathione agarose and its fusion part removed by thrombin. To generate the L(DLys244-Lys260) I-domain chimera, the segment corresponding to the LI-domain sequence Ala242-Asp251 was changed to the homologous segment of the DI-domain Lys244-Lys260. A segment switch was created by oligonucleotide-directed mutagenesis using PCR. The construction of the chimera was based on the observation that oligonucleotide sequence encoding D Lys244-Lys260 contains a unique restriction site for XbaI. Therefore, designed mutagenic primers contained nucleotide sequence for the DLys244-Lys260 segment and additional unchanged L bases: 5'-CCTCTAGAATACAGTGACGTCATCCCCCAGGCAGAGAAGAAAGACATCATCCGCTACATCATC (forward), 5'-GTATTCTAGAGGGTCTTTGTACTTCTCCCCATCCGTGATGATGATAAGCAC (reverse); the D sequences are in italics and the restriction site for XbaI is underlined. The pGEX-4T-1 vector containing the cDNA encoding the "active" LI-domain was modified by PCR using PfuTurbo DNA polymerase with the following cycling parameters: 95°C for 30 seconds, 55°C for 1 minute, and 68°C for 11.5 minutes. Following temperature cycling, the product was treated with DpnI to digest the parental DNA template. The linear product was purified and digested with XbaI to produce a cDNA fragment with cohesive ends. These fragments were ligated and transformed into BL-21(DE3)pLysS E coli-competent cells. The accuracy of the DNA sequence was verified by sequencing. The chimeric I-domain as fusion with GST was expressed and purified following the procedure described for the wild-type I-domains. Cells and stable transfection of integrin subunit constructs The IC-21 macrophage cell line was obtained from the ATCC (Rockville, MD). Cells were cultured in RPMI-1640 medium (Gibco, Carlsbad, CA) supplemented with 10% FBS, 0.1 mg/mL streptomycin, 0.1 U/mL penicillin, and 2 mM L-glutamine. The M2-expressing and mock-transfected HEK 293 cells10 were maintained in DMEM/F-12 (Gibco) supplemented with 10% FBS, 2 mM glutamine, 15 mM HEPES, 0.1 mg/mL streptomycin, and 0.1 U/mL penicillin. The cDNA encoding the 2-integrin subunit was generated as previously described.10 The full-length cDNA of the D-integrin subunit was cloned from a human U937 monocytoid cell line cDNA library. The library was synthesized from total cellular RNA using SuperScriptII reverse transcriptase (Invitrogen) as described previously.20 The D cDNA was cloned into pcDNA3.1/Neo(-) vector and the 2 cDNA was cloned into pcDNA3.1/Hygro(-) vector (Invitrogen). HEK 293 cells were stably transfected with pcDNA3.1 plasmids with inserted D and 2 using LipofectAMINE 2000 reagent (Invitrogen). After 48 hours at 37°C in 5% CO2, cells were harvested and cultured in medium with 500 µg/mL G418 (Invitrogen) and 250 µg/mL Hygromycin (Invitrogen). After 14 days, surviving cells were collected, sorted, and analyzed using flow cytometry and immunoprecipitation. Flow cytometry Fluorescence-activated cell sorting (FACS) analyses were performed to assess the expression of receptors on the surface of the cells transfected with D2 integrin. The cells were incubated with anti-D polyclonal antibody and anti-2 mAb IB4 and analyzed using a FACScan (Becton Dickinson, San Jose, CA) as described.10 Populations of cells expressing similar amounts of M2 and D2 were selected by FACS using a BD Biosciences (San Jose, CA) FACS Vantage Instrument. Immunoprecipitation Cells (5 x 106) were labeled with 100 µg Immunopure Sulfo-NHS-LC-Biotin (Pierce, Rockford, IL) in 200 µL PBS for 30 minutes at 22°C. The cells were solubilized with a lysis buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% Triton X-100, 1 mM CaCl2, 1 mM PMSF, 100 µg/mL leupeptin, 10 mM benzamidine) for 30 minutes at 22°C. The lysates were incubated with 10 µg normal mouse IgG (Sigma) and 50 µL Zysorbin-G (Zymed, San Francisco, CA) for 2 hours at 4°C. After centrifugation, the supernatant was incubated with 10 µg mAb IB4 (anti-2) for 2 hours at 4°C. The integrin-mAb complex was captured by incubating with 50 µL protein A-Sepharose (Amersham Biosciences) for 2 hours at 4°C. The immunoprecipitated proteins were eluted with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer and analyzed by Western blotting. The Immobilon-P membranes (Millipore, New Bedford, MA) were incubated with streptavidin conjugated to horseradish peroxidase and developed using enhanced SuperSignal Chemiluminescent Substrate (Pierce). Adhesion and migration assays For adhesion assays, 96-wells tissue culture plates (Costar, Cambridge, MA) were coated with different concentrations of fibrinogen, fibronectin, vitronectin, plasminogen, Cyr61, and VCAM-1 for 3 hours at 37°C. The wells were post-coated with 0.5% PVA for 1 hour at 22°C. Cells in DMEM/F-12 were labeled with 10 µM calcein AM (Molecular Probes, Eugene, OR) and assays were performed as described previously.10,21 Cell migration assays with calcein-labeled IC-21 cells were performed under sterile conditions using uncoated Transwell inserts with a pore size of 8 µm and 6.5 mm in diameter (Costar, Corning, NY) as described.21 Briefly, the lower chambers contained 600 µL of 10 µg/mL vitronectin. Cells (150 µL) in DMEM/F-12 at a concentration of 2.5 x 106/mL were placed in the upper chamber and allowed to migrate for 18 hours at 37°C in 5% CO2.Two hours prior to the completion of the migration assay, calcein AM was added to the lower chamber to label cells. Assays were stopped by removing cells from the upper surface of the polycarbonate membrane. Cells migrating to the bottom of the filter were detected using a CytoFluorII fluorescence plate reader (Applied Biosystems, Farmington, MA). Surface plasmon resonance studies The interaction between the I-domains and various ligands was measured using surface plasmon resonance (SPR) using a Biacore 3000 instrument (Biacore, Uppsala, Sweden). Vitronectin, fibrinogen, fibronectin, Cyr61, plasminogen, VCAM-1, and ICAM-3 were covalently coupled via primary amines, at concentrations ranging between about 1000 and 2000 response units, to the dextran matrix of CM5 sensor chips. Different concentrations of the I-domains in HBS-P buffer (Biacore) supplemented with 1 mM MgCl2 were flowed over cells containing various ligands. All data were corrected for the response obtained using a blank reference flow cell that was activated with EDC/NHS and then blocked with ethanolamine. Steady-state experiments were performed by injecting the analytes at 10 µL/min for 3 minutes. The chip surface was regenerated using 2 M NaCl plus 50 mM NaOH. Data were analyzed using the BIAevaluation 3.1 program (BiaCore, Uppsala, Sweden).    Results Top Abstract Introduction Materials and methods Results Discussion References   Analyses of ligand-binding properties of integrin D2 To search for potential D2 ligands, we have generated a cell line expressing this integrin. HEK 293 cells were cotransfected with the wild-type D and 2 and stable transfectants were established. FACS analyses using antibodies specific for the integrin subunits demonstrated similar levels of expression of D and 2 (Figure 2A). Heterodimer association of the integrin was evaluated by immunoprecipitation of detergent-lysed surface-labeled cells (Figure 2B). Anti-2-specific mAb IB4 immunoprecipitated both the D (molecular weight [MW], 150 kDa) and 2 (MW, 100 kDa) subunits from cells, indicating that they are associated on the cell surface. To test the possibility that the recognition specificity of D2 overlaps with that of the related integrin M2, we have investigated the ability of the D2-expressing cells to adhere to several EMC proteins that represent well-characterized M2 ligands. These included: (1) the ECM proteins fibronectin, vitronectin, and fibrinogen, and (2) the proteins Cyr61 and plasminogen, which are overexpressed or become ECM-associated during the inflammatory responses.22,23 Furthermore, cell adhesion to VCAM-1 was tested because it represents an established D2 ligand.1 Additionally, cell adhesion to the fibrinogen P2-C peptide, which duplicates the binding site for M2 in fibrinogen24 and contains the generic recognition information required for M2 binding,25 was examined. Naked plastic, which typifies the ability of M2 to stick to many unrelated proteins, was also tested. Figure 3 illustrates that the D2-expressing HEK 293 cells adhered to wells coated with all selected ligands and that comparable levels of D2- and M2-expressing HEK 293 cells attached to each protein. In this figure, maximal cell adhesion to each ligand is shown as obtained from the dose-dependent curves, and the data are expressed as a percentage of added cells. D2 supported efficient adhesion to vitronectin, fibronectin, Cyr61, plasminogen, and P2-C similar to M2. D2-mediated adhesion to fibrinogen was slightly lower than that mediated by M2. By contrast, the D2-expressing cells adhered better to uncoated plastic than the M2-expressing cells. Because cells expressing similar levels of D2 and M2 were used in these experiments, the difference in adhesion may reflect a stronger affinity of D2 to plastic. In control experiments, mock-transfected HEK 293 cells adhered poorly to fibrinogen, Cyr61, and plasminogen, as expected.18,26,27 These cells adhered to a lower extent to fibronectin,21 vitronectin, and VCAM-1, consistent with the presence of endogenous 1 integrins (see next paragraph). View larger version (22K): [in this window] [in a new window]   Figure 2.. Analysis of integrin expression and heterodimer formation in HEK 293 cells transfected with wild-type D2. (A) The binding of anti-D-specific polyclonal antibody and anti-2-specific mAb IB4 to the D2-expressing cells was analyzed by flow cytometry. Results are presented as histograms with the logarithm of fluorescence intensity on the abscissa and the cell number on the ordinate. Control cells incubated with Alexa 488-conjugated secondary antibody are shown in the top panel. (B) Immunoprecipitation of biotin-labeled D2. Cells (5 x 105) were labeled with biotin, lysed, and immunoprecipitated with 10 µg anti-2 mAb IB4. The immunoprecipitates were analyzed by Western blotting using streptavidin conjugated to horseradish peroxidase. The integrin subunits were detected using an enhanced chemiluminescent substrate and exposed to Kodak BioMax film.   View larger version (20K): [in this window] [in a new window]   Figure 3.. Adhesion of D2- and M2-expressing HEK 293 cells to different ligands. HEK 293 cells expressing wild-type D2 () and M2 (), and mock-transfected cells (), were labeled with calcein and their adhesion to different ligands was tested. Aliquots (50 µL) of 5 x 105/mL cells in DMEM/F-12 were added to the wells coated with increasing concentrations of different ligands. After incubation for 30 minutes at 37°C, the nonadherent cells were removed by 2 washes with PBS and fluorescence was measured. The number of adherent cells was calculated by using the fluorescence of aliquots with a known number of labeled cells. Maximal adhesion to each substrate is shown as was determined from the dose-dependent curves of adhesion. Maximal adhesion to fibronectin (Fn), fibrinogen (Fg), plasminogen (Pg), Cyr61, vitronectin (Vn), P2-C, and VCAM-1 was observed at coating concentrations of 10 µg/mL, 2 µg/mL, 10 µg/mL, 2.5 µg/mL, 5 µg/mL, 50 µg/mL, and 5 µg/mL, respectively. Data are expressed as a percentage of added cells and are the mean ± SE of 3 to 6 individual experiments.   HEK 293 cells express other integrins, particularly those that belong to the 1 group21 and that are known to bind the ECM proteins. For example, integrin 51 binds fibronectin,28 41 mediates adhesion to VCAM-1,29,30 and 61 was shown recently to bind Cyr61.31 To determine the contribution of 1 integrins to adhesion mediated by the D2-expressing HEK 293 cells, we performed adhesion experiments in the presence of anti-1, anti-D, and anti-2 function-blocking antibodies. As shown in Figure 4, no inhibition of adhesion by anti-1 polyclonal antibody to Cyr61, fibrinogen, vitronectin, plasminogen, P2-C, and uncoated plastic (not shown) was detected, suggesting that cell attachment to these substrates was entirely D2-dependent. In agreement with these results, anti-D polyclonal antibody blocked cell adhesion to these proteins by about 90% (except vitronectin, to which it blocked adhesion by 55%). Nevertheless, the combination of anti-1 and anti-D (or anti-1 plus anti-2) antibodies completely blocked cell adhesion to vitronectin. In contrast, anti-1 antibody inhibited adhesion to fibronectin and VCAM-1 by about 50% to 55%, indicating that endogenous 51 and 41, respectively, on the D2-expressing cells contribute to adhesion. At the same time, anti-D alone was a poor inhibitor of cell adhesion; it did not inhibit adhesion to fibronectin and produced only about 15% inhibition of cell adhesion to VCAM-1. However, the combination of anti-1 and either anti-D or anti-2 antibodies effectively inhibited cell adhesion to these ligands, illustrating the contribution of D2. Neither control rabbit nor mouse IgG inhibited cell adhesion (not shown). Taken together, these observations indicate that D2 is capable of engaging many ECM proteins during cell adhesion and suggest that the recognition specificity of D2 is similar to that exhibited by M2. Further evidence for the similarity of ligand specificity of integrins D2 and M2 was obtained in inhibition experiments using soluble peptide P2-C. We previously reported that P2-C inhibits M2-mediated cell adhesion not only to the C domain of fibrinogen, from which this sequence is derived, but also to other fibrinogen domains32 and to many unrelated proteins (Valeryi Lishko, unpublished data, June 2002).27,33 P2-C was also an effective inhibitor of D2-mediated cell adhesion to vitronectin, fibrinogen, plasminogen, and VCAM-1 (Table 1). Whereas cell adhesion to fibronectin and Cyr61 was less sensitive to inhibition, it was blocked by a combination of P2-C and anti-1 antibody. These results clearly show that within ECM proteins, D2 binds sequences that contain recognition information resembling that of the M2 recognition peptide P2-C. View this table: [in this window] [in a new window]   Table 1.. Effect of fibrinogen peptide P2-C on adhesion of the D2-expressing HEK 293 cells to different ligands   D2 on macrophages mediates adhesion and migration to various ECM proteins To extend our findings with transfected cells, we examined the ability of macrophage cell line IC-21 to bind various ECM proteins. As assessed by flow cytometry analyses (Figure 5A), unstimulated cultured cells express both integrins M2 and D2, with the latter receptor being expressed at a slightly higher level (1.3-fold). IC-21 cells adhered strongly and in a concentration-dependent manner to various ECM proteins (not shown). To determine a relative contribution of the integrins on macrophages to this adhesion process, we examined the effect of antibodies directed against anti-M and anti-D integrin subunits. Table 2 shows that individual antibodies exerted partial inhibition of adhesion. However, the combination of 2 antibodies effectively inhibited adhesion to selected ECM proteins by 45% to 65%. In parallel experiments, natural macrophages elicited by thioglycollate injection and isolated from the mouse peritoneal cavities efficiently adhered to the ECM proteins in an D2-dependent manner and no inhibition of adhesion by control rabbit or rat IgG was detected (not shown). View this table: [in this window] [in a new window]   Table 2.. Inhibition of IC-21 cell adhesion to various ECM proteins by anti-D and anti-M antibodies   View larger version (34K): [in this window] [in a new window]   Figure 4.. Effect of function blocking antibodies on adhesion of the D2-expressing HEK 293 cells. Calcein-labeled D2-expressing HEK 293 cells were preincubated for 20 minutes at 22°C with anti-1 polyclonal antibody 1950 (1:500 dilution), 20 µg/mL anti-D polyclonal antibody, or with combinations of anti-1 with either anti-D or anti-2 mAb IB4 (20 µg/mL). Cells were added to microtiter wells coated with various ligands at concentrations that produce maximal adhesion, and cell adhesion was determined as described in Figure 3. Data are expressed as a percentage of control (adhesion in the absence of antibodies) and are the mean ± SE of 3 individual experiments performed in triplicate in each experiment.   Previous studies demonstrated that M2 is capable of promoting leukocyte migration to several ECM proteins, including fibrinogen and fibronectin.21,34 To examine whether D2 can support leukocyte migration, we have examined the ability of vitronectin, as a representative ECM protein, to mediate migration of IC-21 cells. As shown in Figure 5B, cells efficiently migrated toward vitronectin and this process depended on both D2 and M2 because anti-D polyclonal antibody and anti-M mAb M1/70 blocked the response. View larger version (26K): [in this window] [in a new window]   Figure 5.. Expression of D2 and M2 on the surface of IC-21 macrophage cell line and their role in macrophage migration. (A) The level of D2 and M2 expression was assessed by flow cytometry with mAb 1/70, which recognizes mouse M2, and polyclonal anti-D antibody, which recognizes both human and mouse D integrin subunits. Control cells are shown as open histograms. (B) IC-21 cells were analyzed for their ability to migrate to 10 µg/mL vitronectin either in the absence or in the presence of blocking polyclonal anti-D and anti-M mAb M1/70. Cells were preincubated with 2.5 µg/mL of each antibody for 20 minutes before their addition to the upper chamber of Transwell plates. In control samples, cells were pretreated with 2.5 µg/mL of each rabbit or rat IgG. Cells were allowed to migrate toward vitronectin for 18 hours at 37°C and the extent of cell migration was assessed as described in "Materials and methods."   The DI-domain mediates ligand binding We next sought a molecular basis for ligand recognition by D2. Because the I-domain is responsible for ligand binding in other integrins, and in cell adhesion studies polyclonal antibodies raised against the recombinant DI-domain inhibited cell adhesion, we examined the ability of the isolated DI-domain to interact with various proteins. Furthermore, because previous studies demonstrated that the length of the C-terminal 7 helix regulates the activation state of the MI-domain35 and based on the homology between the MI- and DI-domains, we have produced 2 recombinant proteins. The first, "active" DI-domain, encompasses residues Pro128-Lys314 and the second, "nonactive," spans the Pro128-Ala323 sequence. The DI-domains were expressed in E coli and purified from soluble fractions of cell lysates (Figure 6). The capacity of DI-domains to bind selected ECM proteins and other ligands was tested using SPR. The protein ligands were coupled to the chip, and the SPR profiles across a range of the DI-domain concentrations flowed over protein surfaces were determined. A representative set of SPR sensograms for binding of the active DI-domain to vitronectin immobilized on the CM5 chip is shown in Figure 7. The maximal responses achieved at equilibrium for each DI-domain concentration (Figure 7 inset) were used to determine the dissociation constant (Kd). The active DI-domain bound to all ligands tested, with Kd values in the range between about 0.3 to 8 µM (Table 3). It is noteworthy that the DI-domain bound ICAM-3 and VCAM-1, its 2 established ligands.1,6 Among proteins tested, Cyr61 appears to exhibit the highest affinity for the active DI-domain (Kd 0.29 ± 0.07 µM). No binding of the nonactive DI-domain was detected. View this table: [in this window] [in a new window]   Table 3.. Dissociation constants of I-domains for protein ligands   View larger version (16K): [in this window] [in a new window]   Figure 6.. SDS-PAGE of generated I-domains. The I-domains were isolated from soluble fractions of E coli lysates and purified using affinity chromatography, and their purity was assessed by SDS-PAGE on a 12.5% gel under reducing conditions followed by staining with Coomassie blue.   The Lys244-Lys260 sequence in the DI-domain is responsible for ligand recognition We previously reported that the MI-domain sequence Lys245-Arg261 is involved in binding of many unrelated ligands by M2 and, thus, defines its multiligand binding properties.10 The high extent of homology between M(Lys245-Arg261) and the DI-domain sequence Lys244-Lys260 (Figure 1) suggests that the latter segment may be involved in recognition of multiple ligands by D2. To investigate the role of this segment, we generated a chimeric protein in which the D(Lys244-Lys260) was grafted into the corresponding position of the LI-domain, the most closely related I-domain but one that does not bind many ligands. To exclude the possibility that this manipulation may cause activation of the chimeric protein enabling it to bind ligands with unusual specificity, the LI-domain was expressed in the fixed active conformation. In this protein, originally described by Lu et al,19 Lys287 and Lys294 in the C-terminal part of the LI-domain were substituted to Cys, which resulted in the protein, on the formation of the disulfide bond, being locked in a constitutively active conformation. The D(Lys244-Lys260) segment was inserted into the framework of this active LI-domain. The control L- and chimeric I-domains were purified from E coli lysates and were homogeneous as assessed by SDS-PAGE (Figure 6). The ligand-binding properties of isolated proteins were compared by SPR. No binding of the control LI-domain to all proteins tested, except its ligand ICAM-3,36 was detected. In contrast, the chimeric I-domain was capable of binding various ligands immobilized to the surfaces of CM5 chips. The Kd values of interactions between the chimera and different proteins, as determined from the equilibrium portions of the SPR sensograms, were found to be in the range of about 1 to 8 µM (Table 3). Thus, the insertion of the DI-domain segment changed the specificity of the LI-domain and converted it into the DI-domain-binding protein. Although it did not impart the full binding activity, the affinities of ligands for the chimeric protein were comparable with those found with the wild-type DI-domain. For example, Cyr61 was the most preferred ligand for the chimera. Thus, these data demonstrate that the Lys244-Lys260 segment within the DI-domain is largely responsible for its multiligand-binding properties. View larger version (20K): [in this window] [in a new window]   Figure 7.. Analyses of the DI-domain binding to vitronectin by SPR. Representative profiles of the SPR responses for DI-domain binding (concentrations ranging from 0.05 to 3 µM) to vitronectin coupled to the CM5 chip. The "active" DI-domain (Pro128-Lys314) in HBS-P buffer supplemented with 1 mM MgCl2 was used. RU indicates response units. The inset shows a dose-dependent saturable binding of the DI-domain to vitronectin.      Discussion Top Abstract Introduction Materials and methods Results Discussion References   In the present study, we have analyzed the ligand-binding properties of leukocyte integrin D2. The following conclusions are drawn form these analyses: (1) D2 is capable of binding proteins that are either the constituents of the ECM, such as fibronectin, or become ECM-associated during the inflammatory response, including fibrinogen, vitronectin, Cyr61, and plasminogen; (2) within D2, the DI-domain is responsible for its ligand binding function; and (3) the DI-domain segment Lys244-Lys260 contributes to binding of multiple ligands. Thus, these studies identify the new ligands for D2 and establish this integrin as a multiligand receptor. They also provide insights into the mechanism by which this integrin is capable of recognizing unrelated proteins. The important finding of this study is that the recognition specificity of D2 closely resembles that exhibited by the major leukocyte integrin M2 (Mac-1). Among integrin family members, M2 has the broadest specificity and has the capacity to bind multiple ligands that belong to different protein families. Protein ligands for M2 include numerous ECM proteins (fibronectin, laminin, collagen, Cyr61), blood proteins (fibrinogen, kininogen, C3bi, factor X), proteases (elastase, plasminogen, MMP-9), and so forth. Based on the overlapping specificities of M2 and D2 in recognition of many ECM proteins, it is reasonable to assume that D2 is capable of interacting with many other M2 ligands. For example, the finding that D2-expressing cells adhere to plastic, which represents a hallmark of M2, lend further support to the idea that both integrins have very similar binding properties. Ligand binding by the DI-domain was found to be regulated by its conformation; whereas the DI-domain with its C-terminus truncated (Pro128-Lys314) was active, the protein with an extended C-terminal end (Pro128-Ala323) manifested negligible ligand binding. Regulation of ligand binding by the C-terminal part has been described for the I-domains of other 2 integrins, including L2, M2, and X2.19,35,37 The high-affinity form of the MI-domain can be generated by unlocking the C-terminal Ile316 from a hydrophobic socket either by mutation or truncation the 7 C-terminal helix at Lys315.35 The fact that the DI-domain contains an invariable Ile in the 311LKEKIFA317 sequence, which is highly homologous to the M 312LREKIFA318, and the observation that truncation of the DI-domain at Lys314 converts it into the active form, suggest that the DI-domain undergoes conformational changes similar to those of the MI-domain. The I-domains of the M, L, and X subunits have been crystallized in both "open" and "closed" conformations that correspond to the high- and low-affinity states, respectively.37-39 Although the 3-dimensional structure of the DI-domain is not solved, its high homology to M and X I-domains and similar regulation of ligand binding by conformation of the C-terminus suggests that the DI-domain can exist in the "open" and "closed" conformations. Thus, our findings with the I-domain of D2 supports the general mechanism by which the 2 integrins are activated. We have previously demonstrated the M segment Lys245-Arg261 is involved in binding of many unrelated ligands and thus serves as a consensus recognition site.10 A homologous segment in the DI-domain, Lys244-Lys,260 was found to fulfill a parallel function. Grafting this segment into the corresponding position of the LI-domain imparted to the chimeric protein the ability to bind numerous ECM proteins and plastic. The binding activity of the chimeric I-domain, based on the estimated Kd, was only 2- to 3-fold lower than that of the wild-type DI-domain, indicating that D (Lys244-Lys260) is centrally involved in recognition of various ligands. Nevertheless, because grafting of the D segment did not restore the binding function completely, other regions of the DI-domain could contribute to binding. Taken together, the D2 characteristics, including promiscuity in ligand binding, regulation of ligand binding by conformation of the C-terminal portion of the DI-domain, and the role of the highly conserved D(Lys244-Lys260) segment as a consensus docking site, closely recapitulate the properties of M2. Because the D2-expressing cells adhered to the fibrinogen P2-C peptide and soluble P2-C inhibited cell adhesion to the ECM proteins, these observations are consistent with the conclusion that the structural features of ligands permissive for their binding by D2 and M2 are similar. The P2-C peptide duplicates sequence 383TMKIIPFNRLTIG395, which is the binding site for M2 in the C-domains of fibrinogen.18,24 Because P2-C inhibits M2-mediated cell adhesion not only to fibrinogen but also to other ligands,27,33 it is believed that this peptide contains critical structural information required for M2 binding. Furthermore, the results presented here suggest that recognition of multiple ligands by the DI-domain may also depend on sequences typified by P2-C. However, despite the requirements for the "P2-C"-like recognition component and the overall similarity in the ligand repertoire, some proteins appear to be preferred M2 ligands, whereas others are recognized better by D2. For example, the capacity of fibrinogen to support M2-mediated adhesion was higher than that of D2 (Figure 3) and recombinant MI-domain bound more strongly to fibrinogen than the DI-domain (not shown). On the other hand, Cyr61 was superior to all other ligands in binding by the DI-domain (Table 3) and its binding by the DI-domain was about 2-fold higher than by the MI-domain (not shown). At present, the critical determinants responsible for differential binding by D and M I-domains remain to be determined. On D2-expressing HEK293 cells, both D2 and 1 integrins contribute to adhesion to selected ECM proteins. We found that cell adhesion to fibronectin, vitronectin, and VCAM-1 could be blocked only by the combination of anti-1 and anti-D (or anti-2) antibodies. Indeed, fibronectin and VCAM-1 are well-characterized ligands for 1 integrins 51 and 41, respectively. Moreover, integrin v1 on HEK293 cells can bind both vitronectin and fibronectin. Previously, we have demonstrated the same contribution of 1 integrins to adhesion of the M2-expresing cells.21 In contrast, adhesion of the D2-expressing cells to such proteins as fibrinogen, Cyr61, and plastic was entirely D2 dependent with little contribution from 1 integrins. Although integrins 51 and 61 have been shown to bind fibrinogen and Cyr61, respectively,31,40 both proteins appear to be the preferred ligands for D2 on the D2-expressing cells. The finding that D2 and M2 have analogous recognition specificity suggests that they may fulfill a common function. Our previous studies with integrin M2 provided insights into how the M2 ability to bind ECM proteins may control cell migration and adhesion. We demonstrated that the progressive increase of M2 on the cell surface led to increased adhesion to fibronectin and, as a consequence, inhibited cell migration mediated by 1 integrins.21 Based on these studies, we proposed that owing to the nonselective nature of M2 binding to ECM proteins and its ability to be progressively up-regulated on the surface of neutrophils, M2 serves as a brake in neutrophil migration at the site of inflammation. Given the similarity in the ligand-binding profiles of M2 and D2, one is tempted to speculate that D2 can perform similar functions. The observations that D2 is strongly up-regulated within atherosclerotic plaques and that its levels are gradually increased on monocyte differentiation to macrophages in the presence of oxidized LDL,2 the major mediator of atherosclerosis, seem to fit this hypothesis. However, a marked distinction between M2 and D2 is that M2 expression in neutrophils involves translocation of the integrin from pre-existing internal pools in response to chemotactic stimuli,41 whereas D2 up-regulation requires de novo synthesis in the presence of atherogenic stimuli.2 Such a difference in up-regulation of 2 integrins seems to be consistent with a model in which M2 is readily available in the acute inflammatory response, whereas D2 may be required for chronic inflammation. A recent report suggests that not only the recruitment of monocytes, but also their retention within atherosclerotic lesions, contributes to plaque development.42 Whether integrin D2 increases monocyte adhesiveness and thus contributes to their retention in the evolving plaque remains to be established. In summary, these studies establish leukocyte integrin D2 as a multiligand receptor capable of binding diverse ECM proteins with a specificity overlapping that of M2, the most promiscuous member of the integrin family. Given the capacity of M2 to initiate a multitude of cellular responses in neutrophils, one can expect that D2 plays important roles in monocyte/macrophage biology.    Acknowledgements   We are grateful to Dr S. Lam for a generous gift of Cyr61. We thank Tim Burke for critical reading of the manuscript and helpful suggestions. We acknowledge the Molecular Biotechnology Core Lab for making the Biacore 3000 available for these studies.    Footnotes   Submitted June 28, 2005; accepted October 6, 2005. Prepublished online as Blood First Edition Paper, October 20, 2005; DOI 10.1182/blood-2005-06-2509. Supported by the National Institutes of Health (T.P.U.) and the American Heart Association (T.P.U. and V.P.Y.). The Biacore 3000 was purchased through a Shared Instrumentation Grant RR016789-01A1 from the National Institutes of Health. V.P.Y. and T.P.U. designed research, V.P.Y. performed research, S.P.Y. contributed to analyses of Biacore data, and V.P.Y. and T.P.U. wrote the article. The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734. Reprints: Tatiana P. Ugarova, Department of Molecular Cardiology (M/C NB-50), Cleveland Clinic Foundation, 9500 Euclid Ave, Cleveland, OH 44195; e-mail: ugarovt{at}ccf.org.    References Top Abstract Introduction Materials and methods Results Discussion References   Van der Vieren M, Le Trong H, St.John T, Staunton DE, Gallatin WM. A novel leukointegrin, d2, binds preferentially to ICAM-3. Immunity. 1995;3: 683-690.[CrossRef][Medline] [Order article via Infotrieve] Noti JD. Expression of the myeloid-specific leukocyte integrin gene CD11d during macrophage foam cell differentiation and exposure to lipoproteins. Int J Mol Med. 2002;10: 721-727.[Medline] [Order article via Infotrieve] Todd RF3, Arnaout MA, Rosin RE, Crowley CA, Peters WA, Babior BM. Subcellular localization of the large subunit of Mo1 (mo1 alpha; formerly gp110), a surface glycoprotein associated with neutrophil adhesion. J Clin Invest. 1984;74: 1280-1290. Borregaard N, Miller LJ, Springer TA. Chemoattractant-regulated fusion of a novel, mobilizable intracellular compartment with the plasma membrane in human neutrophils. Science. 1987;237: 1204-1206.[Abstract/Free Full Text] Gray JL, Shankar R. Down regulation of CD11b and CD18 expression in atherosclerotic lesion-derived macrophages. Am Surg. 1995;61: 674-679.[Medline] [Order article via Infotrieve] Van der Vieren M, Crowe DT, Hoekstra D, et al. The leukocyte integrin alpha D beta 2 binds VCAM-1: evidence for a binding interface between I domain and VCAM-1. J Immunol. 1999; 163: 1984-1990.[Abstract/Free Full Text] Grayson MH, Van der Vierren, V, Sterbinsky SA, et al. alphadbeta2 integrin is a ligand for vascular cell adhesion molecule-1. Int Arch Allergy Immunol. 1999;118: 263-264.[CrossRef][Medline] [Order article via Infotrieve] Getz GS. Immune function in atherogenesis. J Lipid Res. 2005;46: 1-10.[Abstract/Free Full Text] Humphries MJ. Integrin structure. Biochem Soc Trans. 2000;28: 311-340.[Medline] [Order article via Infotrieve] Yakubenko VP, Lishko VK, Lam SCT, Ugarova TP. A molecular basis for integrin M2 in ligand binding promiscuity. J Biol Chem. 2002;277: 48635-48642.[Abstract/Free Full Text] Lee J-O, Rieu P, Arnaout MA, Liddington R. Crystal structure of the A domain from the subunit of integrin CR3 (CD11b/CD18). Cell. 1995;80: 631-638.[CrossRef][Medline] [Order article via Infotrieve] Anderson DC. The role of 2 integrins and intercellular adhesion molecule type 1 in inflammation. In: Granger DN and Schid-Schlobein GW, eds. Physiology and Pathophysiology of Leukocyte Adhesion. New York, NY: Oxford University Press; 1995: 3-42. McGuire SL, Bajt ML. Distinct ligand binding sites in the I domain of integrin M2 that differentially affect a divalent cation-dependent conformation. J Biol Chem. 1995;270: 25866-25871.[Abstract/Free Full Text] Yakubenko VP, Solovjov DA, Zhang L, Yee VC, Plow EF, Ugarova TP. Identification of the binding site for fibrinogen recognition peptide 383-395 within the MI-domain of integrin M2. J Biol Chem. 2001;275: 13995-14003. Vuento M, Vahery A. Purification of fibronectin from human plasma by affinity chromatography under non-denaturing conditions. Biochem J. 1979;183: 331-337.[Medline] [Order article via Infotrieve] Yatohgo T, Izumi M, Kashiwagi H, Hayashi M. Novel purification of vitronectin from human plasma by heparin affinity chromatography. Cell Struct Funct. 1988;13: 281-292.[CrossRef][Medline] [Order article via Infotrieve] Deutsch DG, Mertz ET. Plasminogen: purification from human plasma by affinity chromatography. Science. 1970;170: 1095-1096.[Abstract/Free Full Text] Ugarova TP, Solovjov DA, Zhang L, et al. Identification of a novel recognition sequence for integrin M2 within the gamma-chain of fibrinogen. J Biol Chem. 1998;273: 22519-22527.[Abstract/Free Full Text] Lu C, Shimaoka M, Ferzly M, Oxvig C, Takagi J, Springer TA. An isolated, surface-expressed I domain of the integrin L2 is sufficient for strong adhesive function when locked in the open conformation with a disulfide bond. Proc Natl Acad Sci U S A. 2001;98: 2387-2392.[Abstract/Free Full Text] Yakubenko VP, Lobb RR, Plow EF, Ugarova TP. Differential induction of gelatinase B (MMP-9) and gelatinase A (MMP-2) in T-lymphocytes upon 41-mediated adhesion to VCAM-1 and the CS-1 peptide of fibronectin. Exp Cell Res. 2000; 260: 73-84.[CrossRef][Medline] [Order article via Infotrieve] Lishko VK, Yakubenko VP, Ugarova TP. The interplay between integrins M2 and 51 during cell migration to fibronectin. Exp Cell Res. 2003;283: 116-126.[CrossRef][Medline] [Order article via Infotrieve] Hilfiker A, Hilfiker-Kleiner D, Fuchs M, et al. Expression of CYR61, an angiogenic immediate early gene, in arteriosclerosis and its regulation by angiotensin II. Circulation. 2002;106: 254-260.[Abstract/Free Full Text] Fan Z, Larson PJ, Bognacki J, et al. Tissue factor regulates plasminogen binding and activation. Blood. 1998;91: 1987-1998.[Abstract/Free Full Text] Flick MJ, Du X, Witte DP, et al. Leukocyte engagement of fibrin(ogen) via the integrin receptor alphaMbeta2/Mac-1 is critical for host inflammatory response in vivo. J Clin Invest. 2004;113: 1596-1606.[CrossRef][Medline] [Order article via Infotrieve] Ugarova TP, Lishko VK, Podolnikova NP, et al. Sequence 377-395 (P2), but not 190-202(P1), is the binding site for the MI-domain of integrin M2 in the C-domain of fibrinogen. Biochemistry. 2003;42: 9365-9373.[CrossRef][Medline] [Order article via Infotrieve] Schober JM, Chen N, Grzeszkiewicz T, et al. Identification of integrin M2 as an adhesion receptor on peripheral blood monocytes for Cyr61 and connective tissue growth factor, immediate-early gene products expressed in atherosclerotic lesions. Blood. 2002;99: 4457-4465.[Abstract/Free Full Text] Lishko VK, Novokhatny V, Yakubenko VP, Skomorovska-Prokvolit H, Ugarova TP. Characterization of plasminogen as an adhesive ligand for integrins M2(Mac-1) and 51(VLA-5). Blood. 2004;104: 719-726.[Abstract/Free Full Text] Ruoslahti E. Fibronectin and its receptors. Annu Rev Biochem. 1988;57: 375-413.[CrossRef][Medline] [Order article via Infotrieve] Elices MJ, Osborn L, Takada Y, et al. VCAM-1 on activated endothelium interacts with the leukocyte integrin VLA-4 at a site distinct from the VLA-4/fibronectin binding site. Cell. 1990;60: 577-584.[CrossRef][Medline] [Order article via Infotrieve] Schwartz BR, Wayner EA, Carlos TM, Ochs HD, Harlan JM. Identification of surface proteins mediating adherence of CD11/CD18-deficient lympho-blastoid cells to cultured human endothelium. J Clin Invest. 1990;85: 2019-2022. Leu SJ, Lam SC, Lau LF. Pro-angiogenic activities of Cyr61 (CCN1) mediated through integrins alphavbeta3 and alpha6beta1 in human umbilical vein endothelial cells. J Biol Chem. 2002;277: 46248-46255.[Abstract/Free Full Text] Lishko VK, Yakubenko VP, Hertzberg KM, Grieninger G, Ugarova TP. The alternatively spliced EC domain of human fibrinogen-420 is a novel ligand for leukocyte integrins M2 and X2. Blood. 2001;98: 2448-2455.[Abstract/Free Full Text] Schober JM, Lau LF, Ugarova TP, Lam SC. Identification of a novel integrin M2 binding site in CCN1 (CYR61), a matricellular protein expressed in healing wounds and atherosclerotic lesions. J Biol Chem. 2003;278: 25808-25815.[Abstract/Free Full Text] Forsyth CB, Solovjov DA, Ugarova TP, Plow EF. Integrin M2-mediated cell migration to fibrinogen and its recognition peptides. J Exp Med. 2001;193: 1123-1133.[Abstract/Free Full Text] Xiong J-P, Li R, Essafi M, Stehle T, Arnaout MA. An isoleucine-based allosteric switch controls affinity and shape shifting in integrin CD11b A-domain. J Biol Chem. 2000;275: 38762-38767.[Abstract/Free Full Text] Campanero MR, Del Pozo MA, Arroyo AG, et al. ICAM-3 interacts with LFA-1 and regulates the LFA-1/ICAM-1 cell adhesion pathway. J Cell Biol. 1993;123: 1007-1016.[Abstract/Free Full Text] Vorus-Jensen T, Ostermeier C, Shimaoka M, Hommel U, Springer TA. Structure and allosteric regulation of the X2 integrin I domain. Proc Natl Acad Sci U S A. 2003;100: 1873-1878.[Abstract/Free Full Text] Ma Q, Shimaoka M, Lu C, Jing H, Carman CV, Springer TA. Activation-induced conformational changes in the I domain region of lymphocyte function-associated antigen 1. J Biol Chem. 2002; 277: 10638-10641.[Abstract/Free Full Text] Lee J-O, Bankston LA, Arnaout MA, Liddington RC. Two conformations of the integrin A-domain (I-domain): a pathway for activation? Structure. 1995;3: 1333-1340.[Medline] [Order article via Infotrieve] Suehiro K, Gailit J, Plow EF. Fibrinogen is a ligand for integrin 51 on endothelial cells. J Biol Chem. 1997;272: 5360-5366.[Abstract/Free Full Text] Kishimoto TK, Baldwin ET, Anderson DC. Inflammation: Basic Principles and Clinical Correlates. Philadelphia, PA: Lippincott Williams and Wilkins; 1999. Llorda J, Angeli V, Liu J, Trogan E, Fisher EA, Randoph GJ. Emigration of monocyte-derived cells from atherosclerotic lesions characterizes regressive, but not progressive, plaques. Proc Natl Acad Sci U S A. 2004;101: 11779-11784.[Abstract/Free Full Text] CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This article has been cited by other articles: W. M. McKillop, J. W. Barrett, S. H. Pasternak, B. M. C. Chan, and G. A. Dekaban The extracellular domain of CD11d regulates its cell surface expression J. Leukoc. Biol., October 1, 2009; 86(4): 851 - 862. [Abstract] [Full Text] [PDF] S. R. Barthel, M. W. Johansson, D. M. McNamee, and D. F. Mosher Roles of integrin activation in eosinophil function and the eosinophilic inflammation of asthma J. Leukoc. Biol., January 1, 2008; 83(1): 1 - 12. [Abstract] [Full Text] [PDF] Y. Miyazaki, M. Bunting, D. M. Stafforini, E. S. Harris, T. M. McIntyre, S. M. Prescott, V. S. Frutuoso, F. C. Amendoeira, D. de Oliveira Nascimento, A. Vieira-de-Abreu, et al. Integrin {alpha}D 2 Is Dynamically Expressed by Inflamed Macrophages and Alters the Natural History of Lethal Systemic Infections J. Immunol., January 1, 2008; 180(1): 590 - 600. [Abstract] [Full Text] [PDF] V. K. Lishko, T. Burke, and T. Ugarova Antiadhesive effect of fibrinogen: a safeguard for thrombus stability Blood, February 15, 2007; 109(4): 1541 - 1549. [Abstract] [Full Text] [PDF] This Article Abstract Full Text (PDF) All Versions of this Article: 2005-06-2509v1 107/4/1643    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Yakubenko, V. P. Articles by Ugarova, T. P. Search for Related Content PubMed PubMed Citation Articles by Yakubenko, V. P. Articles by Ugarova, T. P. Related Collections Hemostasis, Thrombosis, and Vascular Biology Phagocytes Cell Adhesion and Motility Social Bookmarking                   What's this?

	Copyright © 2006 by American Society of Hematology         Online ISSN: 1528-0020