Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 15 March 2006, Vol. 107, No. 6, pp. 2440-2445.
Prepublished online as a Blood First Edition Paper on December 1, 2005; DOI 10.1182/blood-2005-03-1139.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figure
Right arrow All Versions of this Article:
2005-03-1139v1
107/6/2440    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamanaka, K.-i.
Right arrow Articles by Kupper, T. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamanaka, K.-i.
Right arrow Articles by Kupper, T. S.
Related Collections
Right arrow Immunobiology
Right arrow Neoplasia
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

IMMUNOBIOLOGY

Skin-derived interleukin-7 contributes to the proliferation of lymphocytes in cutaneous T-cell lymphoma

Kei-ichi Yamanaka, Rachael Clark, Benjamin Rich, Rebecca Dowgiert, Kazuki Hirahara, Daniel Hurwitz, Michio Shibata, Nina Mirchandani, David A. Jones, Deborah S. Goddard, Sara Eapen, Hitoshi Mizutani, and Thomas S. Kupper

From the Harvard Skin Disease Research Center, Department of Dermatology, Brigham and Women's Hospital, Boston, MA; Department of Dermatology, Mie University, Graduate School of Medicine, Japan; and Biostatistics Core Facility, Dana Farber Harvard Cancer Center, Department of Biostatistics, Dana-Farber Cancer Institute, Boston, MA.


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Cutaneous T-cell lymphomas (CTCLs) are malignancies of T cells that have a special affinity for the skin. We have previously reported that much of the T-cell receptor repertoire is altered in CTCL, and both malignant and nonmalignant clones are numerically expanded, presumably in response to T-cell trophic cytokines. We therefore examined levels of the T-cell trophic cytokines IL-2, IL-4, IL-7, IL-12, IL-13, and IL-15 in plasma in 93 CTCL patients and healthy controls. Only IL-7 levels were elevated in CTCL. We next looked at lesional skin from patients with CTCL and found elevated levels of IL-7 mRNA. Explant cultures of normal and lesional CTCL skin biopsies revealed significantly more IL-7 protein production in CTCL skin. Additionally, cultures of CTCL skin released greater numbers of T cells than normal skin; this was blocked by the addition of an IL-7 neutralizing antibody. Finally, these cultures induced proliferation of normal peripheral skin-homing T cells that were added to the cultures. These observations led us to postulate that IL-7 produced by skin cells contributes to the survival and proliferation of T cells within skin lesions and is likely the source of elevated circulating IL-7 in CTCL. (Blood. 2006;107:2440-2445)


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Cutaneous T-cell lymphomas (CTCLs) are a heterogeneous group of lymphoproliferative disorders of the skin1 and are regarded as a subset of extranodal non-Hodgkin T-cell lymphomas of skin-homing memory T cells.2 Among CTCL patients with peripheral blood involvement, there are greater numbers of T cells expressing the skin-homing cutaneous lymphocyte antigen (CLA) and the chemokine receptor CCR4 than are present in healthy donors.3 Furthermore, the CCR4 ligand CCL17 is highly expressed on the endothelial cells in CTCL skin lesions.3 These findings, together with the increased expression of E selectin and ICAM-1 in CTCL lesions,4,5 suggest that the appropriate microenvironment exists for the entry of skin-homing T cells into CTCL lesions.3 These malignant T cells may be found singly or collectively within the epidermis and admixed with an infiltrate of mononuclear cells within the papillary dermis underlying the involved epidermis.

We recently reported that in all cases of advanced CTCL, and many cases of early disease, there is a significant disruption of the diversity of the T-cell repertoire in peripheral blood.6 T-cell receptor beta-variable (BV) spectratyping revealed diminished complexity in many BV families,6 and this correlated with diminished T-cell receptor excision circle (TREC) levels.7 Both observations are consistent with the idea that some normal T cells are being removed from circulation and other T cells are proliferating to fill the space that this removal creates in the T-cell compartment. The idea that there may be a proliferative stimulus in the peripheral blood of CTCL patients led us to examine peripheral blood plasma for the presence of T-cell trophic cytokines Patients and healthy controls were studied, and plasma levels of interleukin-2 (IL-2), IL-4, IL-7, IL-12, IL-13, and IL-15 were measured. In preliminary studies, only IL-7 was reproducibly increased in patients with CTCL as compared with healthy controls.

It has been appreciated for many years that resident cells of skin, including keratinocytes and fibroblasts, can produce a wide variety of cytokines.8-11 One such cytokine is IL-7. IL-7 is a single-chain 25-kDa molecule that is important for both T- and B-cell growth and development.12-18 It is unique in its ability to both increase the generation of naive T cells by the thymus12-16 and promote the survival of mature T cells19-22 in the blood and lymph nodes, thus maintaining homeostasis in the T-cell compartment. IL-7 increases the survival of T cells in part by increasing the expression of antiapoptotic factor Bcl-2.23 Interestingly, elevated levels of plasma IL-7 have been found in conditions of T-cell depletion, including after chemotherapy and HIV infection,24-26 and IL-7 levels are inversely correlated with CD4 levels.24,25 These studies support the notion that increased production of IL-7 may be a homeostatic mechanism for regulating T-cell proliferation and possibly thymic output.24,25 IL-7 is also involved in the growth and survival of Sézary cells.27,28 Because CTCL cells may remain restricted to the skin during the course of the disease, locally produced IL-7 may be important for the survival of T cells.

In this study, we investigated plasma IL-7 levels in 93 CTCL patients and further measured lesional IL-7 mRNA expression levels in skin lesions from 10 CTCL patients; both were compared with normal plasma and skin, respectively. In addition, we cultured explants of normal and CTCL skin on specialized matrices that we have previously shown to support the survival of resident cells in normal skin.29 These cultures were assayed for IL-7 protein and the ability of the conditioned medium to support T-cell growth. Our results show that IL-7 is significantly increased in the plasma of CTCL patients and that CTCL skin contains mRNA for IL-7 and produces protein identical to that of IL-7. This IL-7 was shown to be functional, because its presence demonstrably enhanced T-cell growth and blocking IL-7 reversed this property. In summary, we have analyzed IL-7 production in CTCL and normal skin and investigated its possible role in production and proliferation of lesional lymphocytes.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Patients and healthy donors

Patients with CTCL who provided informed consent were recruited from the Cutaneous Oncology Clinic at the Dana-Farber Cancer Institute. Ninety-three patients with CTCL (51 men and 42 women; median age, 61 years; range, 19-94 years) were recruited for analysis of peripheral blood. The subject profiles were as follows: stage I (35 men and 28 women; median age, 59.5 years; range, 19-90 years), stage II (6 men and 2 women; median age, 66.5 years; range, 31-82 years), stage III (8 men and 7 women; median age, 63 years; range, 30-94 years), stage IV (2 men and 5 women; median age, 65 years; range, 50-78 years). Diagnoses were based on clinical criteria as well as on histologic and immunohistologic assessment of skin specimens. CTCL was classified according to the TNM (primary tumor, regional nodes, metastasis) classification. Blood specimens obtained from 20 healthy volunteers (10 men and 10 women; median age, 40 years; range, 24-53 years) were also studied for comparison.

After participants provided informed consent, biopsy samples were taken from skin lesions of 18 CTCL patients (10 men and 8 women; median age, 62 years; range, 29-94 years) under local lidocaine anesthesia. None of the patients had received ultraviolet treatment, systemic drug therapy, or topical corticosteroids for at least 3 weeks before the investigation. Ten normal human skin samples were obtained as discarded tissue from cutaneous surgeries and were cut into 6 x 6 mm pieces, the same size as the biopsy specimens from CTCL patients. All studies using blood and skin biopsy samples were approved by the Dana-Farber Cancer Institute Institutional Review Board.

Plasma preparation

Plasma samples were isolated from heparinized venous blood by density gradient centrifugation over Ficoll (Histopaque; Sigma, St Louis, MO). All plasma samples were stored at -80°C prior to use.

Quantification of cytokines

Cytokine levels in plasma and skin culture supernatants were measured by quantitative sandwich enzyme-linked immunosorbent assay (ELISA). IL-2, IL-4, IL-7, IL-12, IL-13, and IL-15 ELISAs were purchased from R&D Systems (Minneapolis, MN). Samples were thawed at room temperature and assayed in duplicate. The reproducibility of the ELISA was assessed through the incorporation of a control plasma sample in each assay.

Quantification of levels of cytokine mRNA

For quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) analysis, biopsy specimens from 10 CTCL patients and 10 healthy donors were snap-frozen in liquid nitrogen until use. After the specimen was homogenized, total RNA was extracted using the Clontech RNA purification kit (Clontech, Palo Alto, CA), according to the manufacturer's instructions; 2 to 5 µg total RNA (A260/A280 = 1.7 to 2.0) was reverse transcribed with oligo-dT primers and Powerscript Reverse Transcriptase (Clontech) in a final volume of 20 µL; 1 µL of the cDNA was amplified by PCR in a final volume of 50 µL with SYBR Green PCR Core reagents (Biosystems, Warrington, United Kingdom) and 1 M of primers. Samples were screened for the expression of beta-actin as a housekeeping gene. The primer pairs specific for IL-7 and for beta-actin were as follows (5'-3'): IL-7, TGTTGAACTGCACTGGCCAG and GCAACTGATACCTTACATGG30; beta-actin, GTGGGGCGCCCCAGGCACCA and CTCCTTAATGTCACGCACGATTTC. A series of standard dilutions of a plasmid were used to quantify cytokines and enzyme. Specific signals for all transcripts were readily detected in human normal fibroblasts. Standard dilutions are amplified with pGEM-T Easy Vector Systems (Promega, Madison, WI) from the PCR amplifiers above. PCR was conducted with 40 cycles, which were within the linear amplification range for PCR reactions. For all of these samples, PCR was conducted twice. The specificity of the PCR products was confirmed by sequence analysis.

Preparation of keratinocyte and fibroblast cell cultures from skin biopsy

Keratinocytes were isolated by incubation of healthy-control skin specimens in 2.4 U/mL dispase II (Roche, Indianapolis, IN) overnight at 4°C; subsequent removal of the epidermis sheet with tweezers was followed by incubation for 5 minutes at 37°C in PBS containing 0.25% trypsin and 0.1% EDTA. Keratinocytes were grown in Keratinocyte-SFM (Gibco, Carlsbad, CA) supplemented with 75 µg/mL bovine pituitary extract (Gibco), 0.2 ng/mL EGF (Gibco), 0.3 mM CaCl2, and 100 IU/mL penicillin and 100 µg/mL streptomycin (PCN/Strep). Fibroblasts were isolated by mincing healthy-donor dermal skin fragments and incubating the fragments in HBSS with 2.5 mg/mL trypsin and 5 mg/mL collagenase for 1 hour. Fibroblasts were cultured in DMEM/F12 (Gibco) supplemented with 15% FCS (Sigma), 10 ng/mL EGF, and PCN/Strep.29 Third-passage samples from normal keratinocytes and fibroblasts were used to quantify cytokine mRNA. After cells were harvested for 2 days, they were washed twice with PBS and collected, and mRNA was purified as described above.

Preparation of 3-dimensional skin explant cultures

To analyze cytokines produced by skin in a culture condition that mimics lymphocyte-tissue interactions in the skin, we developed a 3-dimensional skin explant culture system (detailed by Clark et al29). Briefly, 9 x 9 x 1.5 mm Cellfoam matrices (Cytomatrix, Woburn, MA) were autoclaved and incubated in a solution of 100 µg/mL rat tail collagen I (BD Biosciences, Bedford, MA) in PBS for 30 minutes at 37°C. A punch biopsy was taken from lesional CTCL skin or from normal discarded skin, subcutaneous fat was removed, and the tissue was minced into explants approximately 2 x 2 x 2 mm. Three skin explants were placed on the surface of each matrix, and the culture was maintained in Iscove modified medium (Mediatech, Herndon, VA) with 10% heat-inactivated fetal bovine serum (FBS) (Sigma), PCN/Strep, and 3.5 µL/L beta-mercaptoethanol. The culture was maintained for 5 weeks, and one half of the skin-culture supernatant was collected and replaced 3 times weekly. The produced T cells were collected once a week for up to 5 weeks. In this system, keratinocytes and dermal fibroblasts grow and spread into Cellfoam matrices, and skin-residing T cells are observed to spill out of the matrices into the culture wells. Skin lesions themselves are simulated for more than 5 weeks. We also cultured these skin explants with anti-human IL-7 neutralizing antibody or recombinant human IL-7, IL-4, and/or IL-13; anti-IL-7 antibody (25 ng/mL) or recombinant IL-7, IL-4, and IL-13 (25 ng/mL) were mixed in the culture medium from day 1. Eight CTCL skin samples and 8 control samples were collected for this experiment.

T-cell proliferation

CFSE (5 (and 6)-carboxyfluorescein diacetate, succinimidyl ester) was purchased from Molecular Probes (Eugene, OR). Peripheral blood mononuclear cells were obtained from discarded donated blood separated by density gradient centrifugation over Ficoll. T cells were purified with magnetic bead selection using the pan-T-cell isolation kit (Miltenyi Biotec, Auburn, CA). CLA-positive subsets were isolated by subsequent incubation of T cells with fluorescein isothyocyanate (FITC)-conjugated anti-human CLA antibody (BD Pharmingen, San Diego, CA) followed by anti-FITC microbeads and magnetic selection. Positively selected cells were collected as the CLA-positive enriched fraction. These cells were then washed with ice-cold PBS and labeled by CFSE (final concentration, 1 µM) in PBS. Cells were incubated for 15 minutes at 37°C, washed once, and incubated again for 30 minutes at 37°C in Iscove modified medium. Cells were resuspended to a concentration of 1 x 106 in 40 µL in Iscove modified medium. Cellfoam matrices colonized with either normal or CTCL skin cells were transferred to empty tissue culture wells, and CFSE (carboxyfluorescein diacetate succinimidyl ester)-labeled CLA-positive T cells were injected into the matrices and incubated for 1 hour at 37°C. Finally, 2 mL Iscove modified medium was added carefully, and the culture was incubated at 37°C for 1 week. One half of the medium was removed and replaced every other day, and produced T cells were collected on day 7. Cells were acquired in a FACScan, and CFSE levels were analyzed using CellQuest software (both Becton Dickinson, Mountain View, CA). We also cultured the skin explant with anti-human IL-7 neutralizing antibody (25 ng/mL) from day 1.

Statistical analyses

Linear regression models were fitted to the plasma IL-7 data from all patients. The models included the log10 of the plasma IL-7 levels as the dependent variable and age, sex, and stage as the independent variables. The Wilcoxon-Mann-Whitney test was used to evaluate differences in mRNA expression levels, IL-7 concentration in the supernatant from skin explants and normal skin cells, and T-cell yields between CTCL and healthy-control skin samples.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Plasma cytokine levels

Plasma cytokine levels of 93 patients and 20 controls were measured by ELISA. Levels of IL-2, IL-4, IL-12, and IL-13 were all below the level of detection. In contrast, IL-7 and IL-15 were both detectable in plasma of most patients and controls. There was no significant difference in the circulating levels of IL-15 between healthy controls and CTCL patients (data not shown). However, IL-7 values from plasma were elevated in patients with CTCL, and these results were further analyzed. The log transform, when applied to the plasma IL-7 data, made the data symmetric. Therefore, a linear regression model was fitted to the log10 of plasma IL-7 data, with age, sex, and stage as covariates (Figure 1 and Table 1). All stages of CTCL showed significant differences compared with the healthy cohort, but no significant differences were seen for age and sex. A multiple comparison procedure was used to determine the differences between the stages; however, no significant differences were seen. Therefore, patients with staging data were combined into a single group and compared with the group of healthy volunteers. The linear regression model was fitted again with the following covariates: age, sex, and presence or absence of disease, defined as CTCL versus normal. The results are shown in Figure 1. Only the patients' identity as CTCL versus normal was a significant covariate.


View this table:
[in this window]
[in a new window]
 
Table 1.. Statistical analysis of plasma IL-7 levels

 


Figure 1
View larger version (14K):
[in this window]
[in a new window]
 
Figure 1.. Levels of IL-7 in plasma from patients with CTCL. Plasma samples were collected from 93 CTCL patients and 20 healthy controls. IL-7 levels were measured by ELISA. IL-7 levels were significantly higher in plasma samples from patients with CTCL. *P < .001; **P < .01.

 


Figure 2
View larger version (10K):
[in this window]
[in a new window]
 
Figure 2.. Expression of IL-7 mRNA. Expression in normal and CTCL skin (A) and in normal keratinocytes and fibroblasts (B) was analyzed by quantitative PCR. The data are shown as a relative quantification of IL-7 mRNA expression levels divided by levels of beta-actin mRNA. Expression of IL-7 mRNA was significantly higher in CTCL skin lesions than in samples of normal skin (A). *P < .001.

 
Expression of IL-7 mRNA in skin

We next studied the expression of IL-7 mRNA by quantitative PCR analysis. Figure 2A shows the levels of mRNA expression in normal skin (n = 10) and CTCL lesional skin (n = 10). The nonparametric 2-sided Wilcoxon-Mann-Whitney test was used to compare the cytokine levels of CTCL lesions with those of normal skin samples; the 2-sided P values were less than .001. These data demonstrate that the message for IL-7 is constitutively expressed at a low level in human normal skin but at a significantly higher level in CTCL skin lesions. We found no statistically significant differences between the expression of IL-7 by keratinocytes and fibroblasts cultured from normal skin (P = .382) (Figure 2B); thus, the source of IL-7 in CTCL skin is obscure.

IL-7 concentration in supernatants from CTCL and normal skin explant cultures

Supernatants from 3-dimensional skin explant culture systems were collected at week 3 and analyzed for IL-7 production by ELISA. The 2-sided Wilcoxon-Mann-Whitney test was used to assess the differences between 8 healthy controls and 8 CTCL patients. The IL-7 concentration in medium conditioned by CTCL explants was significantly higher than in healthy controls (P < .001) (Figure 3). Lesional lymphocytes in CTCL produce T helper (Th) 2 cytokines, and we reasoned that the production of these in situ might increase the levels of IL-7 present. However, levels of IL-7 from normal skin explant cultures, treated with or without Th2 cytokines, were never as high as those observed in CTCL samples. In addition, we found no detectable levels of IL-2 and IL-15 in skin explant cultures from either normal or CTCL skin (data not shown).

Production of T cells by skin matrix explant cultures

We have reported elsewhere that skin explants cultured on matrices gradually release large numbers of skin-resident T cells into the medium over a period of weeks.29 We harvested and counted the T cells produced by skin matrix cultures from both healthy and CTCL patients once each week. The 2-sided Wilcoxon-Mann-Whitney test was used to assess the differences between 8 healthy controls and 8 CTCL patients. The number of T cells released from CTCL skin matrices was significantly higher than that released from normal skin cultures (P < .001). Normal skin cultures treated with the Th2 cytokines IL-4 and IL-13 did not produce more T cells; however, as we expected, normal skin cultures treated with recombinant human IL-7 released increased numbers of T cells. These cultures released T cells at levels close to those seen in CTCL skin explants. We hypothesized that IL-7 produced by the CTCL explant cultures could be responsible for the increased number of T cells observed. Consistent with our hypothesis, the addition of anti-human IL-7 neutralizing antibody to CTCL skin matrix significantly decreased the T-cell yield from these cultures (Figure 4).


Figure 3
View larger version (10K):
[in this window]
[in a new window]
 
Figure 3.. IL-7 concentration in supernatants from skin explant cultures. Normal and CTCL skin explants were cultured under various conditions. The concentration of IL-7 in the supernatant was analyzed by ELISA. IL-7 levels were significantly higher in CTCL samples than in healthy controls. Treatment with the Th2 cytokines IL-4 and/or IL-13 did not significantly increase IL-7 production.

 
Proliferation of normal T cells induced by CTCL skin cells

The data obtained thus far suggested that CTCL skin is an environment that supports proliferation of T cells. To test the comparative ability of normal and CTCL skin explant cultures to support proliferation of a relevant population of normal T cells, we labeled normal peripheral blood CLA-positive T cells with CFSE and incubated them for 1 week in matrices colonized with either normal or CTCL skin cells. CD3+ CLA+ CFSE+ lymphocytes incubated in CTCL skin matrices divided up to 3 times during the culture period (Figure 5, open histograms, bold line); this cellular division of T cells could be blocked significantly by addition of antibodies to IL-7 (open histograms, broken line). Normal skin matrices did not support the proliferation of T cells (solid histograms). Similar results were obtained in 3 independent experiments.


Figure 4
View larger version (12K):
[in this window]
[in a new window]
 
Figure 4.. Production of T cells by skin matrix explant cultures. CTCL and normal skin explants were cultured under various conditions, and T-cell production was assayed. The number of T cells produced from CTCL skin explants was significantly higher than from normal skin explants. Normal skin explants treated with Th2 cytokines IL-4 and/or IL-13 did not produce more T cells. Normal skin explants treated with recombinant human IL-7 produced more T cells than untreated cultures. The addition of anti-human IL-7 neutralizing antibody to CTCL skin explants decreased the numbers of T cells produced.

 


Figure 5
View larger version (14K):
[in this window]
[in a new window]
 
Figure 5.. Proliferation of normal blood CLA-positive T cells incubated in matrices colonized with skin cells from CTCL lesions or normal skin. CFSE-labeled CLA-positive T cells were isolated from peripheral blood and incubated for 1 week in matrices colonized with skin cells from either CTCL or normal skin. T cells were analyzed by flow cytometry. CD3+ CLA+ CFSE+ lymphocytes divided up to 3 times in CTCL skin matrices (open histograms, bold line); this cellular division of T cells could be blocked significantly by addition of antibodies to IL-7 (open histograms, broken line). Normal skin matrices did not support cell proliferation (filled histograms).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
In this study, we measured the levels of T lymphotropic cytokines in the plasma of healthy controls and a large population of CTCL patients. Of 6 cytokines measured, only IL-7 showed statistically significant and reproducible elevations in patients with CTCL. These elevations were found at all stages, and in fact stage was not a significant covariate. We further demonstrated that increased levels of IL-7 mRNA were present in lesional CTCL skin as compared with normal skin and that explants of CTCL skin released more IL-7 into the medium than did normal skin explants. In parallel, CTCL explant cultures resulted in the release of many more T cells from skin than normal explants. Importantly, this yield of T cells from CTCL explants could be reduced significantly if antibodies to IL-7 were added. Finally, we demonstrated that CTCL explant cultures could support the presumably antigen-independent proliferation of normal skin-homing memory T cells, while normal skin explants could not. This too could be blocked by antibodies to IL-7. Taken together, these data point to production of IL-7 by CTCL skin as an important feature of this disease.

IL-7 is thought to be produced predominately by epithelial and stromal cells in the thymus, lymph nodes, and bone marrow31-33 and is a critical factor in both B- and T-cell development.12-18,34,35 Furthermore, it enhances both thymic and extrathymic lymphopoesis in the context of diseases that result in lymphopenia. IL-7 treatment can induce the expansion of naive T cells without antigenic stimulation36,37 or differentiation into memory T cells.38,39

We reported previously that the diversity of the T-cell repertoire in CTCL is significantly contracted6 despite the presence of relatively normal absolute T-cell counts.40,41 We have postulated that this contraction of the T-cell repertoire contributes to the immune suppression and significant infection-related mortality that characterizes advanced disease. We also reported that the levels of TRECs in patients with CTCL were decreased, even in early-stage disease.7 Especially in patients with advanced-stage CTCL, TREC levels in normal nonmalignant T cells were clearly reduced, a finding consistent with the interpretation that many normal T cells had been removed from the T-cell compartment and that the remaining cells had expanded clonally to fill the empty space created by their removal.7 These results led us to consider the presence of IL-7 and other T-cell trophic cytokines in CTCL patients. Plasma levels of IL-2, IL-4, IL-7, IL-12, IL-13, and IL-15 were examined in CTCL patients and healthy controls. Only IL-7 and IL-15 could be reproducibly measured in the plasma of patients and controls. While IL-15 levels did not differ between patients and controls, plasma IL-7 levels were significantly higher in CTCL patients than in healthy controls. This increase appeared to be independent of stage, although there was a trend toward higher levels in patients with stage II and III disease. We next investigated whether CTCL skin could be the source of the increased circulating levels of IL-7 in these patients. Using a sensitive and specific quantitative PCR assay, we found higher levels of IL-7 mRNA in CTCL skin than in normal skin.

Because cytokine mRNA expression and protein production do not always correlate, we felt it was necessary to measure cytokine protein production in CTCL skin. Direct quantitative IL-7 protein measurements from skin were impractical, so we employed a 3-dimensional matrix skin explant culture system to simulate intact normal and CTCL skin.29 Periodically, the medium conditioned by these explants was sampled and tested for cytokines including IL-7. Our results indicated that IL-7 was produced at much higher levels in CTCL explant cultures as compared with normal skin explant cultures.

CTCL is thought to be a Th2 disease, and clonal CTCL cells produce Th2 cytokines.42-45 To assess whether Th2 cytokines produced by clonal CTCL cells can stimulate IL-7 production by resident skin cells, we incubated normal skin explant cultures with the Th2 cytokines IL-4 and/or IL-13. We found no production of IL-7 at levels comparable to those observed in CTCL explant cultures (Figure 3), suggesting that these T-cell cytokines do not stimulate skin cells in the explant cultures to produce IL-7. When fibroblasts and keratinocytes from CTCL lesions were grown in 2-dimensional culture in the absence of lymphocytes, these cultures produced only low levels of IL-7 (data not shown). Subsequent addition of autologous CD3+ T cells to these 2-dimensional CTCL skin cell cultures did not restore IL-7 production (data not shown). These results suggest that close cell-to-cell interactions between lymphocytes and skin-construct fibroblasts and keratinocytes in a 3-dimensional arrangement might be required for efficient production of IL-7. We have reported previously that explants of skin placed on the Cellfoam 3-dimensional matrices produce significant numbers of T cells that maintain a CLA+ CCR4+ skin-homing phenotype.29 CTCL skin explant cultures produced 8-fold more cells than cultures of normal skin (Figure 4). Treatment of normal skin explant cultures with IL-4 and/or IL-13 did not significantly increase T-cell yields. However, treatment of normal skin explants with IL-7 increased T-cell production to levels observed in CTCL skin. Last, addition of anti-human IL-7 neutralizing antibody to CTCL explants dramatically decreased the number of cells produced (Figure 4). Interestingly, when we cultured psoriasis skin on the same matrix, IL-7 levels in the supernatant were as low as those from normal skin explants, and the number of T cells produced from psoriasis skin explants was similar to that from normal skin explants (data not shown).

These data demonstrate that skin-derived IL-7 can promote the proliferation of lymphocytes in CTCL skin lesions. To confirm that CTCL skin-derived IL-7 can induce the proliferation of skin-homing T cells, we added CLA-positive T cells from peripheral blood to matrices colonized with skin cells from either normal or CTCL skin. Skin-homing T cells present in normal skin also express high levels of CLA.3,46 Our data clearly demonstrated that IL-7 produced in CTCL skin can support the proliferation of CLA-positive T cells derived from peripheral blood, a process that can be inhibited by antibody to IL-7 (Figure 5). We performed the same experiment with psoriasis skin; however, we did not detect any proliferation for the CLA-positive T cells cultured on the psoriasis skin explants. Thus, the contribution of IL-7 to lymphocyte proliferation appears to be unique to CTCL skin. In conclusion, in CTCL skin lesions where T cells may remain restricted to the skin throughout the course of the disease, local production of IL-7 can strongly influence their survival and proliferation.


    Acknowledgements
 
The authors thank Dr Abrar Qureshi, Marianne Tawa, and Carrie E. Wechsler for sample collection and Nancy K. Voynow for critical reading of this manuscript. Samples of normal human skin were graciously provided by Dr Thomas Cochran of the Boston Center for Plastic Surgery.


    Footnotes
 
Submitted March 21, 2005; accepted September 4, 2005.

Prepublished online as Blood First Edition Paper, December 1, 2005; DOI 10.1182/blood-2005-03-1139.

Supported by a Specialized Program of Research Excellence (SPORE) in Skin Cancer from the National Cancer Institute/National Institutes of Health (NCI/NIH).

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Thomas S. Kupper, Harvard Skin Disease Research Center, Harvard Institutes of Medicine, 77 Ave Louis Pasteur, Boston, MA, 02115; e-mail: tskupper{at}rics.bwh.harvard.edu.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Qin JZ, Zhang CL, Kamarashev J, Dummer R, Burg G, Dobbeling U. Interleukin-7 and interleukin-15 regulate the expression of the bcl-2 and c-myb genes in cutaneous T-cell lymphoma cells. Blood. 2001;98: 2778-2783.[Abstract/Free Full Text]

  2. Robert C, Kupper TS. Inflammatory skin diseases, T cells, and immune surveillance. N Engl J Med. 1999;341: 1817-1828.[Free Full Text]

  3. Ferenczi K, Fuhlbrigge RC, Pinkus J, Pinkus GS, Kupper TS. Increased CCR4 expression in cutaneous T cell lymphoma. J Invest Dermatol. 2002;119: 1405-1410.[CrossRef][Medline] [Order article via Infotrieve]

  4. Fivenson DP, Douglass MC, Nickoloff BJ. Cutaneous expression of Thy-1 in mycosis fungoides. Am J Pathol. 1992;141: 1373-1380.[Abstract]

  5. Uccini S, Ruco LP, Monardo F, La Parola IL, Cerimele D, Baroni CD. Molecular mechanisms involved in intraepithelial lymphocyte migration: a comparative study in skin and tonsil. J Pathol. 1993;169: 413-419.[CrossRef][Medline] [Order article via Infotrieve]

  6. Yawalkar N, Ferenczi K, Jones DA, et al. Pro-found loss of T-cell receptor repertoire complexity in cutaneous T-cell lymphoma. Blood. 2003;102: 4059-4066.[Abstract/Free Full Text]

  7. Yamanaka K, Yawalkar N, Jones DA, et al. Decreased T-cell receptor excision circles in cutaneous T-cell lymphoma. Clin Cancer Res. 2005;11: 5748-5755.[Abstract/Free Full Text]

  8. Heufler C, Topar G, Grasseger A, et al. Interleukin 7 is produced by murine and human keratinocytes. J Exp Med. 1993;178: 1109-1114.[Abstract/Free Full Text]

  9. Mohamadzadeh M, Takashima A, Dougherty I, Knop J, Bergstresser PR, Cruz PD Jr. Ultraviolet B radiation up-regulates the expression of IL-15 in human skin. J Immunol. 1995;155: 4492-4496.[Abstract]

  10. Bonifati C, Trento E, Cordiali-Fei P, et al. Increased interleukin-7 concentrations in lesional skin and in the sera of patients with plaque-type psoriasis. Clin Immunol Immunopathol. 1997;83: 41-44.[CrossRef][Medline] [Order article via Infotrieve]

  11. Grone A. Keratinocytes and cytokines. Vet Immunol Immunopathol. 2002;88: 1-12.[CrossRef][Medline] [Order article via Infotrieve]

  12. Vella A, Teague TK, Ihle J, Kappler J, Marrack P. Interleukin 4 (IL-4) or IL-7 prevents the death of resting T cells: stat6 is probably not required for the effect of IL-4. J Exp Med. 1997;186: 325-330.[Abstract/Free Full Text]

  13. Schluns KS, Kieper WC, Jameson SC, Lefrancois L. Interleukin-7 mediates the homeostasis of naive and memory CD8 T cells in vivo. Nat Immunol. 2000;1: 426-432.[CrossRef][Medline] [Order article via Infotrieve]

  14. Tan JT, Dudl E, LeRoy E, et al. IL-7 is critical for homeostatic proliferation and survival of naive T cells. Proc Natl Acad Sci U S A. 2001;98: 8732-8737.[Abstract/Free Full Text]

  15. Vivien L, Benoist C, Mathis D. T lymphocytes need IL-7 but not IL-4 or IL-6 to survive in vivo. Int Immunol. 2001;13: 763-768.[Abstract/Free Full Text]

  16. Rathmell JC, Farkash EA, Gao W, Thompson CB. IL-7 enhances the survival and maintains the size of naive T cells. J Immunol. 2001;167: 6869-6876.[Abstract/Free Full Text]

  17. Namen AE, Schmierer AE, March CJ, et al. B cell precursor growth-promoting activity. Purification and characterization of a growth factor active on lymphocyte precursors. J Exp Med. 1988;167: 988-1002.[Abstract/Free Full Text]

  18. Namen AE, Lupton S, Hjerrild K, et al. Stimulation of B-cell progenitors by cloned murine interleukin-7. Nature. 1988;333: 571-573.[CrossRef][Medline] [Order article via Infotrieve]

  19. Kondrack RM, Harbertson J, Tan JT, McBreen ME, Surh CD, Bradley LM. Interleukin 7 regulates the survival and generation of memory CD4 cells. J Exp Med. 2003;198: 1797-1806.[Abstract/Free Full Text]

  20. Li J, Huston G, Swain SL. IL-7 promotes the transition of CD4 effectors to persistent memory cells. J Exp Med. 2003;198: 1807-1815.[Abstract/Free Full Text]

  21. Kieper WC, Tan JT, Bondi-Boyd B, et al. Overexpression of interleukin (IL)-7 leads to IL-15-independent generation of memory phenotype CD8+ T cells. J Exp Med. 2002;195: 1533-1539.[Abstract/Free Full Text]

  22. Seddon B, Tomlinson P, Zamoyska R. Interleukin 7 and T cell receptor signals regulate homeostasis of CD4 memory cells. Nat Immunol. 2003;4: 680-686.[CrossRef][Medline] [Order article via Infotrieve]

  23. Kim K, Lee CK, Sayers TJ, Muegge K, Durum SK. The trophic action of IL-7 on pro-T cells: inhibition of apoptosis of pro-T1, -T2, and -T3 cells correlates with Bcl-2 and Bax levels and is independent of Fas and p53 pathways. J Immunol. 1998;160: 5735-5741.[Abstract/Free Full Text]

  24. Fry TJ, Connick E, Falloon J, et al. A potential role for interleukin-7 in T-cell homeostasis. Blood. 2001;97: 2983-2990.[Abstract/Free Full Text]

  25. Napolitano LA, Grant RM, Deeks SG, et al. Increased production of IL-7 accompanies HIV-1-mediated T-cell depletion: implications for T-cell homeostasis. Nat Med. 2001;7: 73-79.[CrossRef][Medline] [Order article via Infotrieve]

  26. Boulassel MR, Smith GH, Gilmore N, et al. Interleukin-7 levels may predict virological response in advanced HIV-1-infected patients receiving lopinavir/ritonavir-based therapy. HIV Med. 2003;4: 315-320.[CrossRef][Medline] [Order article via Infotrieve]

  27. Dalloul A, Laroche L, Bagot M, et al. Interleukin-7 is a growth factor for Sezary lymphoma cells. J Clin Invest. 1992;90: 1054-1060.[Medline] [Order article via Infotrieve]

  28. Dobbeling U, Dummer R, Laine E, Potoczna N, Qin JZ, Burg G. Interleukin-15 is an autocrine/paracrine viability factor for cutaneous T-cell lymphoma cells. Blood. 1998;92: 252-258.[Abstract/Free Full Text]

  29. Clark RA, Chong BF, Mirchandani N, et al. A novel method for the isolation of skin resident T cells from normal and diseased human skin. J Invest Dermatol. In press.

  30. Benjamin D, Sharma V, Knobloch TJ, Armitage RJ, Dayton MA, Goodwin RG. B cell IL-7. Human B cell lines constitutively secrete IL-7 and express IL-7 receptors. J Immunol. 1994;152: 4749-4757.[Abstract]

  31. Peschon JJ, Morrissey PJ, Grabstein KH, et al. Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice. J Exp Med. 1994;180: 1955-1960.[Abstract/Free Full Text]

  32. Moller P, Bohm M, Czarnetszki BM, Schadendorf D. Interleukin-7. Biology and implications for dermatology. Exp Dermatol. 1996;5: 129-137.[CrossRef][Medline] [Order article via Infotrieve]

  33. Fry TJ, Mackall CL. Interleukin-7: from bench to clinic. Blood. 2002;99: 3892-3904.[Free Full Text]

  34. Abdul-Hai A, Or R, Slavin S, et al. Stimulation of immune reconstitution by interleukin-7 after syngeneic bone marrow transplantation in mice. Exp Hematol. 1996;24: 1416-1422.[Medline] [Order article via Infotrieve]

  35. Bolotin E, Smogorzewska M, Smith S, Widmer M, Weinberg K. Enhancement of thymopoiesis after bone marrow transplant by in vivo interleukin-7. Blood. 1996;88: 1887-1894.[Abstract/Free Full Text]

  36. Soares MV, Borthwick NJ, Maini MK, Janossy G, Salmon M, Akbar AN. IL-7-dependent extrathymic expansion of CD45RA+ T cells enables preservation of a naive repertoire. J Immunol. 1998;161: 5909-5917.[Abstract/Free Full Text]

  37. Webb LM, Foxwell BM, Feldmann M. Putative role for interleukin-7 in the maintenance of the recirculating naive CD4+ T-cell pool. Immunology. 1999;98: 400-405.[CrossRef][Medline] [Order article via Infotrieve]

  38. Hassan J, Reen DJ. IL-7 promotes the survival and maturation but not differentiation of human post-thymic CD4+ T cells. Eur J Immunol. 1998;28: 3057-3065.[CrossRef][Medline] [Order article via Infotrieve]

  39. Boise LH, Minn AJ, June CH, Lindsten T, Thompson CB. Growth factors can enhance lymphocyte survival without committing the cell to undergo cell division. Proc Natl Acad Sci U S A. 1995;92: 5491-5495.[Abstract/Free Full Text]

  40. Wu CJ, Chillemi A, Alyea EP, et al. Reconstitution of T-cell receptor repertoire diversity following T-cell depleted allogeneic bone marrow transplantation is related to hematopoietic chimerism. Blood. 2000;95: 352-359.[Abstract/Free Full Text]

  41. Raaphorst FM, Schelonka RL, Rusnak J, Infante AJ, Teale JM. TCRBV CDR3 diversity of CD4+ and CD8+ T-lymphocytes in HIV-infected individuals. Hum Immunol. 2002;63: 51-60.[CrossRef][Medline] [Order article via Infotrieve]

  42. Dummer R, Heald PW, Nestle FO, et al. Sezary syndrome T-cell clones display T-helper 2 cytokines and express the accessory factor-1 (interferon-gamma receptor beta-chain). Blood. 1996;88: 1383-1389.[Abstract/Free Full Text]

  43. Nickoloff BJ, Fivenson DP, Kunkel SL, Strieter RM, Turka LA. Keratinocyte interleukin-10 expression is upregulated in tape-stripped skin, poison ivy dermatitis, and Sezary syndrome, but not in psoriatic plaques. Clin Immunol Immunopathol. 1994;73: 63-68.[CrossRef][Medline] [Order article via Infotrieve]

  44. Rook AH, Vowels BR, Jaworsky C, Singh A, Lessin SR. The immunopathogenesis of cutaneous T-cell lymphoma. Abnormal cytokine production by Sezary T cells. Arch Dermatol. 1993;129: 486-489.[Abstract/Free Full Text]

  45. Vowels BR, Lessin SR, Cassin M, et al. Th2 cytokine mRNA expression in skin in cutaneous T-cell lymphoma. J Invest Dermatol. 1994;103: 669-673.[CrossRef][Medline] [Order article via Infotrieve]

  46. Fuhlbrigge RC, Kieffer JD, Armerding D, Kupper TS. Cutaneous lymphocyte antigen is a specialized form of PSGL-1 expressed on skin-homing T cells. Nature. 1997;389: 978-981.[CrossRef][Medline] [Order article via Infotrieve]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Cancer Res.Home page
M. H. Vermeer, R. van Doorn, R. Dijkman, X. Mao, S. Whittaker, P. C. van Voorst Vader, M.-J. P. Gerritsen, M.-L. Geerts, S. Gellrich, O. Soderberg, et al.
Novel and Highly Recurrent Chromosomal Alterations in Sezary Syndrome
Cancer Res., April 15, 2008; 68(8): 2689 - 2698.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
L. S. de Paiva, A. Nobrega, G. O. De Melo, E. A. Hayashi, V. Carvalho, P. M. Rodrigues e Silva, M. Bellio, G. P. Teixeira, V. Rumjanek, S. S. Costa, et al.
Selective blockade of lymphopoiesis induced by kalanchosine dimalate: inhibition of IL-7-dependent proliferation
J. Leukoc. Biol., April 1, 2008; 83(4): 1038 - 1048.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figure
Right arrow All Versions of this Article:
2005-03-1139v1
107/6/2440    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamanaka, K.-i.
Right arrow Articles by Kupper, T. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamanaka, K.-i.
Right arrow Articles by Kupper, T. S.
Related Collections
Right arrow Immunobiology
Right arrow Neoplasia
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2006 by American Society of Hematology         Online ISSN: 1528-0020