|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, 1 April 2006, Vol. 107, No. 7, pp. 2694-2701. Prepublished online as a Blood First Edition Paper on December 15, 2005; DOI 10.1182/blood-2005-03-0970.
HEMATOPOIESIS The Notch ligand delta-1 is a hematopoietic development cofactor for plasmacytoid dendritic cellsFrom Institut National de la Santé et de la Recherche Médicale (INSERM) U362, Villejuif, France; Université Paris-Sud 11, Villejuif, France; Institut Gustave Roussy, Villejuif, France; and Généthon, Evry, France.
Plasmacytoid dendritic cells (pDCs) play an important role in innate and adaptive immunity, prompting interest in mechanisms controlling the production of this lineage of cells. Notch signaling via one of the Notch ligands, delta-like 1 (delta-1), influences the hematopoietic development of several lymphoid and myeloid lineages, but whether or not delta-1 affects the formation of pDCs is unknown and was tested here. Human CD34+ progenitor cells were cultured onto delta-1–expressing OP9 stroma in the presence of flt-3 ligand and IL-7, and this efficiently generated BDCA-2+ CD123+ CD4+ CD11c– cells with the characteristic morphology of pDCs, expressing toll-like receptor-9 (TLR9), pre-T  mRNAs, and secreting CpG-induced IFN-. Delta-1 augmented the numbers of BDCA-2+ cells produced without affecting their proliferation, and the effect was blocked by  -secretase inhibition. The development of pDCs was stroma-, delta-1–, and cytokine-dependent and could be induced from committed lymphoid progenitor cells, which responded to delta-1 by opposite changes in pDC- and B-cell production. Our results identify delta-1 as a novel factor enhancing pDC hematopoiesis and delineate a new role for Notch signaling in lymphopoiesis by showing its opposite effect on pDC and B lineage determination.
Dendritic cells (DCs) constitute a complex system of antigen-presenting cells (APCs) providing the immune system with multiple possibilities for antimicrobial and antiviral host defenses (recently reviewed by Colonna et al1). Within this system, plasmacytoid DCs (pDCs) are distinguished from so-called conventional DCs by the expression of specific microbial pattern recognition receptors and by the unique ability to secrete high levels of type I interferon (IFN) in response to viruses. Being immature precursor cells, pDCs poorly stimulate T cells and may be tolerogenic but, once activated, they can direct various types of T-cell responses depending on associated pathogenic or inflammatory signals. In humans, pDCs are recognized by expression of the C-type lectin BDCA-2, BDCA-4/neuropilin-1, CD4, and high levels of the IL-3R chain (CD123). They have low levels of major histocompatibility complex (MHC) class II antigens and lack expression of CD1a or CD11c, which are found on conventional DCs.2 Several lymphoid transcripts are expressed in pDCs, such as pre–T-cell receptor (pre-TCR) chain,  5, IgH D-J gene rearrangements, and Spi-B, and not found in most conventional DCs.3 Altogether, pDCs constitute a distinct and important component of innate and adaptive immunity. They have been implicated not only in viral defenses but also in autoimmunity as well as immune regulations occurring in solid tissue and bone marrow (BM) transplantation.1,4 Delineating the molecular mechanisms that contribute to the production of pDCs could therefore provide new insights into the physiopathology and therapies of such conditions. The hematopoietic development of DC lineages seems strikingly flexible compared with other leukocytes. Recent studies have formally established that pDCs, like conventional DCs, have diverse origins and can arise from progenitor cells engaged toward lymphoid or myeloid differentiation programs.5-8 One challenge is to identify the soluble factors and cell-contact–dependent signals that regulate the development of specific DC progenitor cells. The cytokine flt-3 ligand (FL) has emerged as a major regulator of pDC development in vivo and in vitro.8-10 Cell-to-cell interactions are generally important during developmental processes, particularly for lymphoid cells. Interactions between Notch receptors and Notch ligands constitute an evolutionarily conserved example of interactions between precursor cells and their surrounding microenvironment. Notch receptors (Notch 1-4) and their ligands (classified into 2 families of proteins: Jagged/serrate [Jagged 1 and 2] and delta [delta-like 1 (delta-1), 3, and 4]) are widely expressed in the hematopoietic system (recently reviewed by Radtke et al11). Notch signaling is a prominent regulator of the immune system essentially through marked effects on T/B lymphopoiesis and terminal T-cell differentiation.12-17 One of the Notch ligands, delta-1, is a major inducer of Notch signaling in lymphoid cells. Stromal cell lines expressing delta-1 support T-cell differentiation,18-20 facilitate T/natural killer (NK) precursor development, and block B lymphopoiesis.21,22 In contrast to lymphoid cells, much less is known about the effects of delta-1 or Notch signaling in DC development. In humans, delta-1 acts as a negative regulator of monocyte/macrophage differentiation23 and induces monocyte apoptosis specifically in the presence of M-CSF.24 Delta-1 does not seem to affect the differentiation of myeloid precursor cells into conventional DCs.23 Whether delta-1 has a role in pDC development is not known. Because delta-1 affects lymphoid progenitor cells, and because pDCs have some lymphoid characteristics, we hypothesized that delta-1 may regulate pDC formation. We adapted a culture system used for lymphoid differentiation18-20,22 based on M-CSF–deficient OP9 stromal cells and the cytokines FL and IL-7 to test if human delta-1 affected human pDC hematopoiesis. Our results show that delta-1 supports pDC formation from hematopoietic progenitor cells and is particularly efficient on committed lymphoid progenitor cells, which differentiate into pDCs while B lymphopoiesis is blocked. Our results therefore delineate a new role for this Notch ligand in lymphopoiesis.
Hematopoietic progenitor cells
Samples of umbilical cord blood (UCB) and adult BM were obtained in accordance with the French bioethics laws and the French National Bioethics Committee and with approval from the Banque de Tissus pour la Recherche scientific review committee. For BM samples, informed consent was provided in accordance with the Declaration of Helsinki. Mononuclear cells (MNCs) were isolated by density centrifugation (Lymphoprep; AbCys, Paris, France). UCB CD34+ cells were purified using magnetic-activated cell sorting and microbead-conjugated CD34 antibodies according to the manufacturer's recommendations (Miltenyi Biotec, Bergisch Gladbach, Germany) and generally cryopreserved before use. BM lymphoid progenitor cells were prepared from cryopreserved BM MNCs using flow cytometry cell sorting (MoFlo, Dako Cytomation, Trappes, France) with the following antibodies: APC-conjugated CD34 (clone 581, BD Biosciences, Le pont de Claix, France), FITC-conjugated lineage (Lin) markers (TCR Generation of OP9 stroma cell lines
The cDNA encoding human delta-1 (delta-like 1 accession AF003522
[GenBank]
- gi 10518496) was kindly provided by S. Artavanis-Taskonas (Harvard Medical School, Charlestown, MA). The open reading frame (ORF) (EcoRV-XbaI 2897 bp fragment) was cloned into the BamHI site of the multiple cloning site of the self-inactivating pWPIReGFP bicistronic HIV-1–derived lentiviral transfer vector, kindly provided by P. Salmon (University of Geneva, Switzerland) and allowing concomitant expression of human delta-1 under the control of the EF1- Coculture assay
Cocultures were initiated by seeding 2 x 104 to 3 x 104 CD34+ cells per well of a 24-well plate into which OP9-Del1 or OP9-C cells were seeded the day before at 28 000/cm2. Culture medium (0.5 mL per well of R10 medium) consisted of RPMI 1640 supplemented with 10% FCS (Hyclone, Logan, UT), L-glutamine, and penicillin/streptomycin (Gibco BRL, Life Technologies, Paisley, Scotland) that was supplemented with recombinant human FL and human interleukin-7 (IL-7) (5 ng/mL each; R&D Systems, Minneapolis, MN) unless otherwise indicated. In some experiments, Flow cytometric analysis Directly conjugated mouse anti–human monoclonal antibodies (mAbs) included APC-conjugated CD19 (clone SJ25-C1, Caltag Laboratories), HLA-DR (clone TU36, Caltag Laboratories), CD14 (clone TuK4, Caltag Laboratories), PE-conjugated CD56 (clone B159, BD Biosciences), CD1a (clone VIT6B, Caltag Laboratories), CD11c (clone BU15, Caltag Laboratories), CD4 (clone S3.5, Caltag Laboratories), FITC-conjugated CD3 (clone S4.1, Caltag Laboratories), and isotype control mAbs. BDCA-2 FITC, CD123 PE, BDCA-4 APC, and BDCA-1 FITC were from Miltenyi Biotec. Cells were stained with mAbs for 30 minutes on ice and washed twice with PBS, 0.2% BSA, and 0.02% NaN3. Cellular staining was measured on a FACSCalibur instrument (BD Biosciences), and data were analyzed using CellQuest software, with results expressed as percentages of cells staining above background staining obtained with irrelevant mAbs. Stromal cells and dead cells were excluded from analysis. For cell-cycle experiments, DNA content was detected using Hoechst 33342 DNA binding dye (Molecular Probes, Eugene, OR). Cells were resuspended at 1 x 106/mL in HBSS, 10% FCS, 1 g/L glucose, 2 mM Hepes, and 10 µg/mL Hoechst 33342 during 90 minutes at 37°C. Cells were washed and labeled with directly conjugated BDCA-2 FITC antibodies. Simultaneous analysis of DNA content and surface phenotype was performed on a dual laser LSR instrument (UV 488 nm; BD Biosciences). RT-PCR Total RNA was extracted from 5 x 105 total cocultured cells using Wizard SV total RNA isolation system (Promega, Madison, WI) and was reverse transcribed using random hexamers according to the manufacturer's instructions (SuperScript first strand synthesis system for reverse transcriptase–PCR; Invitrogen, Paisley, Scotland).
PCR primers sequences were as follows: TLR9 F: TTATGGACTTCCTGCTGGAGGTGC; TLR9 R: CTGCGTTTTGTCGAAGACCA; pre-T In vitro activation
For in vitro activation, 2 x 105 to 5 x 105 total cocultured cells were transferred to a well of a 24-well tissue culture plate in R10 medium supplemented or not with a mixture of recombinant human CD40L trimer (1 µg/mL; a kind gift from Immunex) and IL-1 Statistical analysis The statistical analysis of data was performed by the paired t test using 95% confidence interval for significance.
Delta-1 induces human CD34+ cells to differentiate into pDCs To examine the effects of human delta-1 on pDC hematopoiesis, we compared how M-CSF–deficient OP9 stromal cells expressing or not expressing this molecule affected growth and differentiation of multipotent hematopoietic progenitor cells in cultures supplemented with FL and IL-7. In this system, UCB CD34+ cells grew and differentiated over time. In 20 days, total cell numbers expanded 98-fold ± 57-fold on OP9-Del1 cells, which was higher than 61-fold ± 52-fold on OP9-C stroma (n = 17 experiments, P < .001). Flow cytometric analyses were performed at different time points to monitor hematopoietic differentiation through the expression of mature cell markers on cultured cells. Representative kinetics studies showed that BDCA-2, a marker of pDCs, was readily detected after 1 week in both OP9-Del1 and OP9-C cultures and was expressed, as expected, on a well-defined population lacking the CD14 antigen (Figure 1A). The percentage of BDCA-2+ cells was significantly higher in OP9-Del1 cultures than in control cultures as measured at day 10 (15% ± 6% versus 7% ± 2%) and at day 20 (14% ± 10% versus 9% ± 8%) in a total of 13 separate experiments (Figure 1B). Over time, higher total numbers of BDCA-2+ cells were generated in OP9-Del1 cultures compared with control (Figure 1B). In approximately 3 weeks, we calculated that a single CD34+ cell yielded in theory 18 BDCA-2+ cells in the OP9-Del1 system, compared with 6 BDCA-2+ cells in control cultures.
Because CD34+ cells decreased similarly over time in both OP9-Del1 and OP9-C cultures, the results suggested that delta-1 enhanced the differentiation of hematopoietic progenitor cells into BDCA-2+ cells or, alternatively, that delta-1 expanded committed cells. Comparisons of cell-cycle analyses on BDCA-2+ cells produced in OP9-Del1 or OP9-C cultures showed identical distribution of cells in the various phases of the cell cycle and, in particular, no augmentation of cells in G2-M in cells produced on OP9-Del1 stroma (Figure 2). These results argue against an effect of delta-1 on BDCA-2+ cell expansion and support the interpretation of enhanced hematopoietic differentiation of CD34+ cells into the BDCA-2+ cell lineage. BDCA-2+ cells generated onto OP9-Del1 displayed characteristic pDC features
The entire population of cells expressing BDCA-2 that was produced onto OP9-Del1 stroma also displayed high levels of CD123 as well as BDCA-4 and CD4, intermediate levels of HLA-DR, and lack of expression of CD11c, CD1a, and CD14 antigens (Figures 1A and 3A). Overall, this is a cell-surface phenotype that defines so-called circulating precursors of pDCs.1,2 As a confirmation, and to exclude trivial artifacts from dying OP9 cells, we purified cells coexpressing the human-specific CD45 marker with BDCA-2 and CD123 from OP9-Del1 cocultures. We found that such cells displayed the characteristic morphology of immature pDCs, with small size and a high nucleus-cytoplasm ratio (Figure 3B). The molecular signature of pDCs was evident in OP9-Del1 cocultures with the detection of transcripts for pre-TCR
pDCs express specific microbial pattern recognition receptors such as TLR9 for recognition of DNA with high CpG content. Conventional DCs express TLRs 2 to 5 for recognition of bacterial products such as peptidoglycan or of poly I:C, which mimics viral double-stranded RNA.28 Activation of the bulk of cultured cells with various stimuli consisting of TLR ligands or of inflammatory stimuli confirmed the existence of a functional response via TLR9 because CpG oligonucleotides induced the secretion of high levels of IFN-
Effects of delta-1 on other hematopoietic lineages of cells Multiple types of hematopoietic cells were generated in the OP9 coculture system, including cells of lymphoid lineages. Delta-1 significantly decreased CD19+ CD10+ B-cell differentiation because, at day 20, the percentages of CD19+ B cells in OP9-Del1 cultures were 1% ± 1% versus 6% ± 3% in OP9-C cultures (P = .02, n = 5) and, overall, approximately 3 times fewer CD19+ cells were produced in OP9-Del1 cultures compared with controls (P = .05) (Figure 4). In opposition, the production of CD56+ cells, putatively NK cells, was significantly augmented by delta-1 both in proportion (11% ± 5% versus 4% ± 1%, P = .04, n = 5) and total numbers of cells, because approximately 3.5 times more CD56+ cells were produced in 3 weeks onto OP9-Del1 stroma compared with controls (P = .03, n = 5) (Figure 4). T lymphocytes were not examined in these experiments. However, separate studies in our laboratory showed that our OP9-Del1 cells support the differentiation of murine lineage-negative bone marrow progenitor cells into CD3+ CD8+ T cells in 3 weeks, as expected from prior reports.18 Furthermore, our OP9Del1 cells support the differentiation of human CD34+ CD38– UCB progenitor cells into CD7+ CD3+ human T cells after more than 3 weeks of culture, as reported19,20 (Supplemental Figure S1, available on the Blood website; click on the Supplemental Figure link at the top of the online article). As for myeloid cells, monocytic cells expressing CD14 were produced in small proportions, which were significantly reduced by delta-1, as shown in Figures 1 and 4. For instance, at day 20, CD14+ cells represented, on average, 2% ± 1% of cells in OP9-Del1 cultures versus 11% ± 7% in OP9-C cultures (P < .001, n = 13 experiments). We also identified populations of CD1a+ cells that were generated in these cultures (Figure 4). In the absence of other T-cell markers, the population of CD1a+ CD14– cells most likely represented conventional DCs rather than immature T cells. Indeed, such CD1a+ cells also coexpressed BDCA-1, CD11c, and high levels of HLA-DR antigens, which are characteristic DC markers (data not shown). Besides, we also observed CD1a+ CD14+ cells, resembling the intermediate cells generated during DC differentiation from CD14+ cells.29 There was no statistically significant effect of delta-1 on the numbers of total CD1a+ cells produced (n = 5). However, further analysis of subtypes of CD1a+ cells should be performed to determine if an effect of delta-1 exists on subsets of conventional DCs. At the functional level, cytokine secretion profiles confirmed that monocytes and conventional DCs were also generated with pDCs in the culture system. Stimulation of the cultures with the proinflammatory stimuli CD40L and IL-1 or with the TLR2 ligand PGN induced the secretion of, respectively, IL-12 and IL-8 cytokines, which were found at similar levels in OP9-Del1 and OP9-C cultures (Table 1). Both stimuli are known to activate cytokine secretion in CD1a+ interstitial DCs or Langerhans cells.28,30 The expression of mRNA for TLR4, a receptor known to be present on CD1a+ DCs and monocytes, appeared to be similar in both cultures (Figure 3C). Altogether, delta-1 significantly modulated the differentiation of hematopoietic progenitor cells into pDCs, CD14+ cells, B cells, and CD56+ lymphoid lineages in the same time frame. However, at the functional level, delta-1 did not appear to be a strong modulator of activities attributed to conventional DCs in this particular experimental setup. Hematopoiesis induced by delta-1 is Notch-, contact-, and cytokine-dependent
To confirm that delta-1 affected hematopoietic progenitor cell differentiation into pDCs through Notch signaling, we tested the effects of DAPT, an inhibitor of the
The production of pDCs is induced from lymphoid progenitor cells Because delta-1 significantly modulated pDC- and lymphoid-cell fates, we wondered if this signaling pathway could directly target a population of lymphoid progenitor cells. Several developmental origins of pDCs have been demonstrated in the murine system. In particular, BM lymphoid progenitor cells constitute one population capable of producing pDCs in vivo and in vitro in the presence of FL.5 In humans, a BM committed lymphoid progenitor-cell population (CLP) that displays T, B, DC, and NK-cell potential can be isolated on the basis of expression of CD34 and CD10 and lack of CD19 and other lineage markers.33 This lymphoid progenitor cell is more abundantly found in BM than UCB and, therefore, BM CLPs were tested here. The coculture of this CLP onto OP9-C in the presence of FL and IL-7 rapidly generated large proportions of CD19+ B cells (Figure 7), thus confirming its strong B lymphoid commitment.34 CLPs were able to produce pDCs. The presence of delta-1 strongly enhanced the proportion of BDCA-2+ CD123++ pDCs in CLP cultures (average, 43% ± 7% versus 20% ± 17% of cells in OP9-Del1 versus OP9-C cultures, n = 3 experiments) while consistently reducing B lymphoid differentiation (average, 19% ± 13% versus 41% ± 23% of cells in OP9-Del1 versus OP9-C cultures, n = 3 experiments) (Figure 7). There was little expansion, and total cell numbers produced could not be determined reliably in these experiments. These results demonstrate that pDCs can be produced directly and rapidly from a population of committed human BM lymphoid progenitor cells. Depending on the presence of delta-1, the CLPs were able to differentiate into B cells or into pDCs within the same time frame and in comparable proportions. The near complete lack of CD14+ cell production confirmed the peculiar lymphoid-restricted developmental potential of the CLPs, contrasting with the control population of CD34+ Lin– CD10– CD19– progenitor cells that comprise myeloid and multipotent hematopoietic progenitor cells (Figure 7). On such cells and at the time points examined, delta-1 had a modest effect on pDC- or B-cell formation. Therefore, at present, our results essentially show that delta-1 acts on lymphoid-committed cells to regulate pDC and B-cell lineage differentiation in opposite fashion.
This study describes the Notch ligand delta-1 as a pDC development cofactor and shows that this signal is particularly efficient at triggering the differentiation of human lymphoid progenitor cells into pDCs. Delta-1 provides a positive signal for hematopoietic development into the pDC lineage by augmenting the proportions and the absolute numbers of pDCs produced from progenitor cells without having a demonstrable effect on expansion of committed pDCs. The induction of differentiation is highly likely; however, we cannot exclude that delta-1 acts in part through enhanced survival of pDC precursors. The term "cofactor" is used because the efficiency of the delta-1 signal is dependent upon the presence of both FL and IL-7 cytokines.
The effects of delta-1 are blocked by
Several recent studies have established that pDCs, like conventional DCs, have complex developmental origins. A lymphoid origin, initially postulated on the basis of lymphoid transcripts in pDCs,3 is now clearly established in the murine and human systems, because pDCs can be directly obtained by in vitro culture or by in vivo transplantation of lymphoid lineage–restricted progenitor cells.5-7 We confirm and extend these findings by showing that human CLPs effectively produce pDCs and identify delta-1 as a signal of differentiation for these cells. Delta-1 controlled a symmetric process of CLP differentiation toward pDC or B cells that occurred in a similar context and time frame and from a relatively homogeneous progenitor-cell population. Stromal contact and soluble factors played a determining role in pDC formation. The cytokine FL is known to be a major regulator of human or murine pDC development in vivo8 and in vitro.9,10,27 Flt-3 receptor is found on lymphoid and myeloid pDC progenitor cells, further supporting the relevance of using FL to generate pDCs.7,41 While the effects of FL on pDCs are well established, the enhancing activity of IL-7 had not been appreciated before. The effects of IL-7 on pDC production could be context dependent or progenitor specific. Indeed, prior studies have shown that IL-7 reduces the effects of FL on pDC development from primitive hematopoietic progenitor cells.9 The identification of human lymphoid progenitor cells as efficient precursor cells for pDCs may be an important aspect of the IL-7 response. Indeed, CLPs express the IL-7R The OP9-Del1 culture system constitutes a practical tool to efficiently produce various types of human DCs, which is useful for developmental and immune studies. So-called conventional DCs are produced in similar amounts as in control cultures based on CD1a+ cell-surface phenotype, TLR4 expression, or IL-12 production. This is consistent with prior studies showing little effect of delta-1 on this type of DC.23 A distinguishing feature of the OP9-Del1 system is its efficiency for production of pDCs based on phenotype and functional activity, because it is superior to previously reported systems. Starting with total UCB CD34+ cells, each CD34+ cell yields 18 pDCs in 3 weeks, which is 3 times the number obtained in optimized liquid cultures supplemented with thrombopoietin and FL that reportedly generate 6 pDCs per CD34+ cell in the same time frame.27 The pDCs produced onto OP9-Del1 appear to be functional as determined essentially by their cytokine production, which constitutes an underpinning mechanism for the antiviral and immunomodulatory effects of pDCs.4 However, more studies are needed to fully evaluate the immune activities induced by pDCs developed onto delta-1. This system provides an opportunity to study the role played by Notch ligands in immune responses through effects on pDCs in addition to their well-recognized roles in the regulation of lymphopoiesis and Th1 T-cell differentiation.17
The authors are grateful to Graziella Griffith for help with vector construction, Philippe Rameau for help with flow cytometry, Sonia Poirault for help with cell-cycle experiments, and Roseline Yao for help with pDC cultures. We also acknowledge Drs A. Turhan (Institut Gustave Roussy, Villejuif), P. Salmon (University of Geneva), S. Artavanis-Tsakonas (Harvard Medical School, Charlestown, MA), and Immunex (Seattle, WA) for the kind gifts of reagents. The generosity and help from the obstetrics staff at Hopital Louise Michel (Evry, France), Association Française contre les Myopathies (AFM) Tissue Bank, and Genethon tissue processing personnel are also acknowledged.
Submitted March 10, 2005; accepted November 23, 2005.
Prepublished online as Blood First Edition Paper, December 15, 2005; DOI 10.1182/blood-2005-03-0970.
Supported by INSERM, Association Francaise contre les myopathies, and Société Française d'Hématologie (A.O.).
The online version of this article contains a data supplement.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Anne Galy, Genethon, 1 bis rue de l'Internationale, 91002 Evry, France; e-mail: galy{at}genethon.fr.
  CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2006 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
, clone T10B9.1A-31, BD Biosciences; CD14, clone 3C10E12 prepared in our laboratory (ATCC, Manassas, VA); CD40 clone 5C3, BD Biosciences; CD19, clone SJ25-C1, Caltag Laboratories, Burlingame, CA; CD20, clone H147, Caltag Laboratories), and PE-conjugated CD10 (clone SJ-1B4, Caltag Laboratories). 
) or OP9-C stroma (
), and after 7 to 14 days cells were stained with BDCA-2 and Hoescht to measure cell cycle by flow cytometry. Results represent the means ± SD values of gated BDCA-2+ cells in the different phases of cell cycle obtained from 4 independent experiments. A representative histogram of the cell cycle of BDCA-2+ cells cultured onto OP9-Del1 stroma is inserted.
) or OP9-C (
) were analyzed for expression of CD1a/CD14, CD19/CD10, and CD3/CD56 markers to identify monocytes, DCs, B cells, and NK cells. (Right) The yields of CD19+, CD56+, and CD1a+ cells normalized to the input of a single CD34+ cell after 10 and 20 days of culture. Data are from 5 different experiments, and average values are indicated by an X with representation of standard deviation values.
