Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 15 April 2006, Vol. 107, No. 8, pp. 3167-3172.
Prepublished online as a Blood First Edition Paper on December 27, 2005; DOI 10.1182/blood-2005-09-3918.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2005-09-3918v1
107/8/3167    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Astermark, J.
Right arrow Articles by Lefvert, A.-K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Astermark, J.
Right arrow Articles by Lefvert, A.-K.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Immunobiology
Right arrow Free Research Articles
Right arrow Clinical Trials and Observations
Right arrowRelated Article in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY

Polymorphisms in the IL10 but not in the IL1beta and IL4 genes are associated with inhibitor development in patients with hemophilia A

Jan Astermark, Johannes Oldenburg, Anna Pavlova, Erik Berntorp, Ann-Kari Lefvert, for the MIBS Study Group

From the Department for Coagulation Disorders, Malmö University Hospital, Malmö, Sweden; Institute of Transfusion Medicine and Immunohaematology, University Clinic, Frankfurt; Institute of Experimental Haematology and Transfusion Medicine, University Clinic Bonn, Germany; and Immunological Research Laboratory, Center for Molecular Medicine and Department of Medicine, Karolinska Institute, Stockholm, Sweden.


    Abstract
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results
 Discussion
 Appendix
 References
 
The aim of the Malmö International Brother Study (MIBS) is to evaluate host genetic factors associated with the development of inhibitory antibodies in patients with hemophilia. Factor VIII gene mutations and genetic polymorphisms of the IL1beta, IL4, and IL10 genes, known to influence antibody production in autoimmune diseases, were analyzed in 164 patients (124 with severe, 26 with moderate, and 14 with mild disease) in 78 unrelated families with hemophilia A. Seventy-seven (47%) patients in 54 families had a history of inhibitors (57 high responding, 20 low responding). Inversions were found in 36 families (75 patients). There was no association between the development of inhibitor and the IL1beta Taq I RFLP alleles in exon 5 or the –590 C/T single nucleotide polymorphism (SNP) in the promoter region of IL4. There was, however, a strong association between an allele with 134 bp in one of the CA repeat microsatellites, IL10G, located in the promoter region of the IL10 gene, and the development of inhibitor (odds ratio [OR], 4.4; 95% confidence interval [95% CI], 2.1-9.5; P < .001). The association was consistent in the subgroup of families with severe hemophilia and inversions. IL10 is the first gene located outside the causative factor VIII gene mutation to be associated with inhibitor development.


    Introduction
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results
 Discussion
 Appendix
 References
 
Inhibitory antibodies to factor VIII develop in 10% to 15% of all patients with hemophilia A and in 25% to 30% of patients with the severe form of the disease after exposure to factor VIII concentrates.1,2 Often the inhibitors become a longstanding problem that seriously affects quality of life and requires costly medical intervention.3,4 Genetic and environmental risk factors for inhibitor development have been evaluated, usually without consistent results.5,6 Except for some local outbreaks of inhibitors caused by neoantigenicity of a modified factor VIII molecule, no environmental risk factors have been unequivocally associated with inhibitor development. On the other hand, studies of related subjects have provided evidence for the major importance of genetic determinants.7,8 We have previously reported an overall concordance of 78.3% between siblings in 249 families with severe hemophilia A and a higher frequency of inhibitors in African Americans compared with white persons.8 Among the genetic factors, an association between large rearrangements of the factor VIII and IX genes and a higher risk for inhibitors has been described.9-12 However, most patients with null mutations, including the intron 22 inversion, do not develop inhibitory antibodies. For example, the concordance rate for inhibitor development between siblings in families with intron 22 inversion was found to be only 40%.13 It is obvious that other genetic markers influencing the immune response to replacement therapy in patients with hemophilia remain to be identified, and the aim of Malmö International Brother Study (MIBS) is to characterize these factors.8,13

Cytokines are more or less directly involved in the antibody-mediated immune response and therefore have the potential to be determinants for the immune response. IL-1 is a multifunctional proinflammatory cytokine affecting most immunomodulatory cells.14,15 Two agonists (IL-1{alpha} and IL-1beta) and one receptor antagonist (IL-1R{alpha}) belong to this family. In addition to its proinflammatory actions, IL-1 also acts as an adjuvant during antibody production.16 Associations with autoimmune diseases and high antibody production have been described for polymorphisms in the IL1beta gene, the most important of which is the TaqI restriction fragment length polymorphism (RFLP) 13.4-kb allele in exon 5, referred to as allele 2 (A2).17,18 This A2 allele is associated with high spontaneous IL-1beta production. IL-4 is essential for the generation of TH2 cells and for total immunoglobulin and IgE production. Polymorphisms in the IL4 gene, including a single nucleotide polymorphism (SNP) at position –590 in the promoter region, seem to be primarily associated with atopy and allergic disorders but are also associated with certain autoimmune and inflammatory conditions.19 IL-10 is an important anti-inflammatory cytokine, and it exerts a broad spectrum of activities. IL-10 also enhances the in vitro production of all types of immunoglobulins by peripheral blood mononuclear cells (PBMCs) in patients with systemic lupus erythematosus (SLE), and the serum concentration of IL-10 is correlated with disease activity in these patients.20,21 In addition, a 134-bp–long variant of a CA repeat microsatellite in the promoter region of the IL10 gene is associated with autoantibody concentrations in SLE, myasthenia gravis, and Wegener granulomatosis and with the concentration of the monoclonal immunoglobulin in multiple myeloma.22-24 In the present study, we evaluated whether polymorphisms of these 3 cytokine genes may also confer susceptibility to inhibitor development in patients with hemophilia.


    Patients, materials, and methods
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results
 Discussion
 Appendix
 References
 
Subjects

Centers participating in MIBS were given a standardized questionnaire to accrue data from siblings with severe (factor VIII:C, less than 1%), moderate (factor VIII:C, 1%-5%), and mild (factor VIII:C, greater than 5%-40%) hemophilia A. Patient date of birth, ethnicity, disease severity, treatment history, and inhibitor history, including peak titer and current titer in Bethesda units (BU/mL), were collected. A high-responding inhibitor was defined as a historical peak titer greater than 5 BU/mL, and a low-responding inhibitor was defined as one with a peak titer of 5 BU/mL or less.25 Approval was obtained from the Lund University institutional review board for these studies. Informed consent was provided according to the Declaration of Helsinki.

Methods

Standard methods for the analyses of the factor VIII gene were used and included Southern blot and long-range polymerase chain reaction (PCR) for inversion analysis, PCR and mutation screening methods (eg, single-stranded conformation polymorphism [SSCP]), denaturing gradient gel electrophoresis (DGGE), denaturing high-performance liquid chromatography (DHPLC), and direct DNA sequencing.26 Factor VIII and IX clotting activity were measured according to standard techniques. Inhibitory antibodies were quantified according to the original Bethesda method and the Nijmegen modified assay.27,28

DNA extraction and PCR reactions

Genomic DNA was extracted from EDTA-preserved blood using a kit (Qiagen genomic tip; Kebo Lab, Stockholm, Sweden). IL1beta TaqI RFLP, IL4 –590 SNP, and IL10G microsatellites were essentially determined as previously described.17,18,22,23,29,30 The oligonucleotides 5'GTTGTCATCAGACTTTGACC3' and 5'TTCAGTTCATATGGACCAGA3' were used to amplify the region containing the TaqI polymorphic site within exon 5 of the IL1beta gene.17 Amplification was performed using a thermal cycler (PHC-3 Dri-Block; Techne, Cambridge, United Kingdom). TaqI digestion of the 249-bp PCR product resulted in 2 fragments of 135 and 114 bp (allele 1) or remained intact (allele 2).18 The primers used to amplify the IL4 gene were previously described by Noguchi et al.29 A mismatch was introduced in the forward primer with a T at position 594 altered to G, creating a restriction site for the enzyme AvaII. The following primers were used: forward, 5'TAA ACT TGG GAG AAC ATG GT3'; reverse, 5'TGG GGA AAG ATA GAG TAA TA3'. The digestion of IL4 PCR products was performed using 1.5 U AvaII and 10 µL PCR product in a 20-µL final volume reaction, incubated at 37°C overnight. Genotyping for the dinucleotide microsatellite IL10G was performed by the use of PCR and a fluorescence-based technique.22,23 Primers for the highly polymorphic microsatellites IL10G were designed as 5'TetGTCCTTCCCCAGGTAGAGCAACACTCC3' and 5'CTCCCAAAGAAGCCTTAGTAGTGTTG3'.30 A fluorescent dye was introduced in the 5' end of the forward primers. A mixture of PCR products and internal size standard (Gene Scan 350-TAMRA; Perkin Elmer, Norwalk, CT) was loaded onto 5% denaturing polyacrylamide gel (Long Ranger) in the ABI 377 sequencer. Data were analyzed with the GeneScan 672 (version 1.0) and the Genotyper software (version 2.1; Perkin Elmer). Alleles were named after the lengths of PCR products.22,23

Statistical analysis

Chi-square analysis was used for evaluation of the frequency of alleles in patients with and without a history of inhibitory antibodies. For observed numbers lower than 5, Fisher exact test was used instead. All P values were 2-sided; P less than .05 was considered to indicate statistical significance.


    Results
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results
 Discussion
 Appendix
 References
 
The numbers of patients and families with no history of inhibitors and a history of high-responding (HR) and low-responding (LR) inhibitors are shown in Tables 1 and 2. Median age was 24 years (range, 3-79 years). Seventy-seven (47%) of the 164 subjects enrolled had a history of inhibitors. They were members of 54 unrelated inhibitor families. Thirty-four of these families were discordant and 20 were concordant with respect to inhibitor development. In 24 families, no inhibitor was reported in the siblings. Seven families (4 inhibitor concordant, 3 inhibitor discordant) included 3 or 4 siblings with hemophilia.


View this table:
[in this window]
[in a new window]
 
Table 1.. Characteristics of the study cohort with respect to inhibitor status

 


View this table:
[in this window]
[in a new window]
 
Table 2.. Concordance and discordance in the 78 MIBS families with respect to inhibitor development

 
Factor VIII gene mutations

The type of causative factor VIII mutation was characterized in all families, and these data, together with the polymorphisms of the IL1beta, IL4, and IL10 genes and the inhibitor history in each sibling, are summarized in Table 3. Seventy-one patients with intron 22 inversion and 4 patients with intron 1 inversion were identified in 36 unrelated families. Forty (53.3%) of these patients belonging to 28 families had experienced inhibitors. Siblings were concordant with respect to inhibitors in 11 families and discordant in 17 families. In the 42 families without inversions, the following types of mutation were identified: nonsense mutations in 5 families, a large deletion in 1 family, missense mutations in 21 families, a splice site mutation in 1 family, and small deletions/insertions in 12 families (Table 3). In 2 families, no mutation was identified. Fourteen mutations were novel and not previously described in the HAMSTeRS database (Table 3). Among these novel mutations, 10 were associated with inhibitors; in 3 families, all siblings developed inhibitors (Leu184Pro, Trp382X, Trp1108X). Among the 6 mutations previously described and associated with inhibitors, only the Arg2163His mutation was not associated with inhibitors in our cohort.


View this table:
[in this window]
[in a new window]
 
Table 3.. Characteristics of all 164 enrolled siblings in 78 unrelated MIBS families with severe hemophilia A

 
IL1beta

Frequencies of IL1beta TaqI genotypes in patients with and without inhibitory antibodies are summarized in Table 4. Genotype A2/A2 was found in 28 (17.1%) of the patients, 22 of whom had severe hemophilia A. Among these 28 patients, 16 (57.1%) had experienced an inhibitor and 12 had not (42.9%; not significant [NS]). Corresponding figures for the A1/A2 genotype were 26 (44.1%) and 33 (55.9%; NS) of 59 patients. No significant association between the A2 allele and the development of inhibitors was seen. Inhibitory antibodies were described in 42 of 87 patients with allele A2 (48.3%) compared with 35 (45.5%) of 77 patients without this allele (NS). The prevalences of genotype A2/A2 and allele A2 were higher than previously described in a Swedish white population.18


View this table:
[in this window]
[in a new window]
 
Table 4.. Frequencies of IL1beta TaqI genotypes and allele A2

 
IL4

IL4 genotypes identified in the cohort are summarized in Table 5. No significant associations between the genotypes or the individual C- and T-alleles were found. The most common genotype, CC, was found in 97 (59.1%) of the patients, of whom 45 (46.4%) had a history of inhibitors. The CT genotype was found in 45 (27.4%) patients, of whom 23 (51.1%; NS) had inhibitors. Corresponding figures for the TT genotype were 22 (13.4%) and 9 (40.9%; NS), respectively. Altogether, inhibitors were described in 32 (47.8%) of 67 with the T-allele to be compared with 45 (46.4%) of 97 patients without this allele (NS). The prevalence of genotypes and alleles were comparable to those described in a white population.29


View this table:
[in this window]
[in a new window]
 
Table 5.. Frequencies of IL4 genotypes and allele T

 
IL10

The frequency of allele 134 in the microsatellite IL10G is shown in Table 6. The allele was identified in 44 of 164 (26.8%) patients with hemophilia A. Thirty-two of these 44 (72.7%) patients developed inhibitors (25 HR, 7 LR) compared with 45 (37.5%) of the 120 patients without the allele (32 HR, 13 LR). Among all 77 patients with a history of inhibitors, allele 134 was found in 32 (41.6%) patients compared with 12 (13.8%) of 87 inhibitor-negative patients (P < .001). This corresponds to an odds ratio (OR) of 4.4 with a 95% confidence interval (95% CI) of 2.1 to 9.5. A significant association between allele 134 and the development of inhibitors was also found in a subgroup analysis of patients with severe hemophilia A—that is, in 26 (41.3%) of 63 patients with inhibitors and in 7 (11.5%) of 61 patients without inhibitors, corresponding to an OR of 5.4 (95% CI, 2.1-13.7; P < .001). Fourteen (87.5%) of 16 patients with an inversion and allele 134 had inhibitors compared with 26 (44.1%) of 59 patients with an inversion but not the IL10 allele (OR, 8.9; 95% CI, 1.9-42.6; P = .002). Among the patients with moderate and mild hemophilia, the allele was identified in 6 (42.9%) of 14 patients with inhibitors and in 5 (19.2%) of 26 patients without inhibitors, corresponding to an OR of 3.2 (P = .147). Similar to the polymorphisms of the IL1beta gene, the prevalence of allele 134 was higher than that described in a Swedish white cohort.23


View this table:
[in this window]
[in a new window]
 
Table 6.. Frequencies of allele 134 bp in the IL10G microsatellite

 
Among the 34 inhibitor discordant families, only one family was identified in whom the subject without allele 134 had developed an inhibitor, whereas the brother who was allele 134 positive had not (Table 3). This is a family with moderate hemophilia, and the inhibitor developed in adulthood after more than 100 exposure days (EDs) during hepatitis C treatment with interferon and ribavirin. It is a low-responding inhibitor, and the patient achieved successful tolerization with immune tolerance induction therapy. Among the other families, 12 others were also discordant with regard to allele 134, but the allele was only found in the sibling who had developed an inhibitor. In the remaining inhibitor-discordant families, either both or none of the siblings were allele 134 positive.


    Discussion
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results
 Discussion
 Appendix
 References
 
In this study, we found a highly significant association between an allele with 134 bp in the CA repeat microsatellite IL10G and the development of inhibitory antibodies against factor VIII, whereas no association was found with the polymorphisms in the genes coding for IL-1beta and IL-4. The association with IL10 was consistent in the subgroup of patients with severe hemophilia and an inversion of the factor VIII gene. In the entire series, only one subject without this allele developed inhibitor, and his brother with allele 134 did not. In all other families, there was a consistent relation between the presence of allele 134 and the development of inhibitor. IL10G is located in the promoter region of the IL10 gene (that is, in a part of the gene containing several potential transcription factor binding sites). The relation of allele 134 to high antibody production has been established in autoimmune disorders and in multiple myelomas.22-24 IL-10 promotes activated B lymphocytes to produce antibodies, and results from one study on patients with multiple myeloma indicate that the effect of allele 134 is to increase the secretion of IL-10.24 Patients with the IL10G allele 134 might be "high-secretor" phenotypes who, on antigenic stimuli with the deficient coagulation factor, develop an expansion of B cell clones and ultimately inhibitor development. Whether the polymorphism in these patients is associated with a higher IL-10 secretion in vivo remains to be analyzed. Interestingly, Lozier et al31 recently described that in addition to the MHC H-2 (class II) genes in mice, linkage was established between the antibody response and polymorphic markers near other candidate immunoregulatory genes, including Il10. In addition, mice deficient in IL-10 had low antibody response to human factor IX, suggesting that IL-10 promotes the formation of high antibody concentrations.

The prevalence of IL1beta allele A2 and of IL10G allele 134 were significantly higher than previously described in a Swedish population.18,22,23 Whether this reflects differences in the ethnic composition of this study or a true genetic association in the hemophilia population remains to be determined.

The type of causative factor VIII and IX mutations is considered an important genetic determinant for inhibitor development, but the mutation itself will probably not serve as the most critical determinant for the outcome. The most common factor VIII mutation in patients with severe hemophilia A is the intron 22 inversion. This is a null mutation causing a complete rearrangement of the gene and is considered to be a high-risk mutation for the development of inhibitors. In our series of 124 patients with severe hemophilia A, an inversion was identified in 75 subjects in 36 unrelated families. Within these families, all siblings in 11 families had developed inhibitors, in 8 families none of the siblings had a history of inhibitors, and in 17 families the siblings were discordant. In agreement with this finding, we recently reported a 40% concordance for inhibitors in families with intron 22 inversion.13 The findings strengthen the concept of inhibitor formation to be a polygenic process. IL10 is the first gene located outside the causative factor gene mutation to be associated with this side effect of treatment. Functional analyses of IL-10 and other cytokines should be performed in patients after antigenic challenge. In addition, further studies of genetic markers for inhibitor development are warranted because they will be a prerequisite for the development of new and less immunogenic therapeutic approaches in the future.


    Appendix
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results
 Discussion
 Appendix
 References
 
The MIBS study group consists of the following geographic locations and investigators: Malmö, Sweden (J. Astermark, E. Berntorp); Amsterdam, The Netherlands (K. Fijn van Draat, M. Peters); Bratislava, Slovakia (A. Batorova); Bucharest, Romania (V. Uscatescu); Budapest, Hungary (L. Nemes); Gothenburg, Sweden (L. Stigendahl); Helsinki, Finland (F. Ebeling); Izmir, Turkey (K. Kavakli, C. Balkan, D. Yilmaz); La Coruna, Spain (J. Batlle); London, United Kingdom (T. Yee, C. Lee); Madrid, Spain (A. Villar, M. Morado); Oslo, Norway (G. Tjønnfjord); Santander, Spain (C. Sedano); Stockholm, Sweden (P. Petrini, S. Schulman); Toronto, Canada (M. Carcao); Utrecht, The Netherlands (M. van den Berg, E. Mauser-Bunschoten); Wabern, Switzerland (R. Kobelt); Warsaw, Poland (J. Windyga).


    Acknowledgements
 
We thank Sharyne M. Donfield for her kind assistance and comments on the manuscript.


    Footnotes
 
Submitted September 30, 2005; accepted December 1, 2005.

Prepublished online as Blood First Edition Paper, December 27, 2005; DOI 10.1182/blood-2005-09-3918.

A complete list of the members of the Malmö International Brother Study Group appears in "Appendix."

Supported by grants from Wyeth and the Research Fund at Malmö University Hospital, the European Commission Fifth Framework Programme (QLG1-CT-2001-01918), the Swedish Research Council (05646), the Foundations of the Karolinska Institutet, and the Palle Ferb Foundation.

An Inside Blood analysis of this article appears at the front of this issue.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Jan Astermark, Department for Coagulation Disorders, Malmö University Hospital, SE-205 02 Malmö, Sweden; e-mail: jan.astermark{at}med.lu.se.


    References
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results
 Discussion
 Appendix
 References
 

  1. Wight J, Paisley S. The epidemiology of inhibitors in haemophilia A: a systematic review. Haemophilia. 2003;9: 418-435.[CrossRef][Medline] [Order article via Infotrieve]

  2. Key NS. Inhibitors in congenital coagulation disorders. Br J Haematol. 2004;127: 379-391.[CrossRef][Medline] [Order article via Infotrieve]

  3. Astermark J. Treatment of the bleeding inhibitor patient. Semin Thromb Hemost. 2003;29: 77-86.[CrossRef][Medline] [Order article via Infotrieve]

  4. DiMichele D, Rivard G, Hay C, Antunes S. Inhibitors in haemophilia: clinical aspects. Haemophilia. 2004;10(suppl 4): 140-145.

  5. Vermylen J. How do some haemophiliacs develop inhibitors? Haemophilia. 1998;4: 538-542.[CrossRef][Medline] [Order article via Infotrieve]

  6. Oldenburg J, Schröder J, Brackmann HH, Muller-Reible C, Schwaab R, Tuddenham E. Environmental and genetic factors influencing inhibitor development. Semin Hematol. 2004;41(suppl 1): 82-88.[CrossRef][Medline] [Order article via Infotrieve]

  7. Gill JC. The role of genetics in inhibitor formation. Thromb Haemost. 1999;82: 500-504.[Medline] [Order article via Infotrieve]

  8. Astermark J, Berntorp E, White GC, Kroner BL, and the MIBS Study Group. The Malmö International Brother Study (MIBS): further support for genetic predisposition to inhibitor development in hemophilia patients. Haemophilia. 2001;7: 267-272.[CrossRef][Medline] [Order article via Infotrieve]

  9. Schwaab R, Brackman HH, Meyer C, et al. Haemophilia A: mutation type determines risk of inhibitor formation. Thromb Haemost. 1995;74: 1402-1406.[Medline] [Order article via Infotrieve]

  10. Tuddenhamn EGD, Mcvey JH. Genetic basis of inhibitor development in haemophilia A. Haemophilia. 1998;4: 543-545.[CrossRef][Medline] [Order article via Infotrieve]

  11. Oldenburg J, El-Maarri O, Schwaab R. Inhibitor development in correlation to factor VIII genotypes. Haemophilia. 2002;8(suppl 2): 23-29.

  12. Goodeve A. Genetic determinants of inhibitor formation in patients with hemophilia. Haematologica. 2003;88(suppl 12): 2-3.

  13. Astermark J, Oldenburg J, Escobar M, White GC 2nd, Berntorp E, and the MIBS Study Group. The Malmo International Brother Study (MIBS): genetic defects and inhibitor development in siblings with severe hemophilia A. Haematologica. 2005;90: 924-931.[Abstract/Free Full Text]

  14. Pociot F, Molvig J, Wogensen L, Worsaae H, Nerup J. A Taq 1 polymorphism in the human interleukin 1beta (IL-1beta) gene correlates with IL-1beta secretion in vitro. Eur J Clin Invest. 1992;22: 396-402.[Medline] [Order article via Infotrieve]

  15. Pociot F, Ronningen KS, Bergholdt R, et al. The Danish Study Group of Diabetes in Childhood: genetic susceptibility markers in Danish patients with type 1 (insulin-dependent) diabetes—evidence for polygenicity in man. Autoimmunity. 1992;19: 169-178.

  16. Dinarello CA. The IL-1 family and inflammatory diseases. Clin Exp Rheumatol. 2002;20(suppl 27): S1-S13.[Medline] [Order article via Infotrieve]

  17. Bioque G, Crusius JB, Koutroubakis I, et al. Allelic polymorphism in IL-1beta and IL-1 receptor antagonist (IL-1Ra) genes in inflammatory bowel disease. Clin Exp Immunol. 1995;102: 379-383.[Medline] [Order article via Infotrieve]

  18. Huang D, Pirskanen R, Hjelmstrom P, Lefvert AK. Polymorphisms in IL-1beta and IL-1 receptor antagonist genes are associated with myasthenia gravis. J Neuroimmunol. 1998;81: 76-81.[CrossRef][Medline] [Order article via Infotrieve]

  19. Rosenwasser LJ. Promoter polymorphism in the candidate genes, IL-4, IL-9, TGF-beta1, for atopy and asthma. Int Arch Allergy Immunol. 1999;118: 268-270.[CrossRef][Medline] [Order article via Infotrieve]

  20. Llorente L, Zou W, Levy Y, et al. Role of interleukin 10 in the B lymphocyte hyperactivity and autoantibody production of human systemic lupus erythematosus. J Exp Med. 1995;181: 839-844.[Abstract/Free Full Text]

  21. Houssiau FA, Lefebvre C, Vanden Berghe M, Lambert M, Devogelaer JP, Renauld JC. Serum interleukin 10 titers in systemic lupus erythematosus reflect disease activity. Lupus. 1995;4: 393-395.[Abstract/Free Full Text]

  22. Zhou Y, Giscombe R, Huang D, Lefvert AK. Novel genetic association of Wegener's granulomatosis to the interleukin-10 gene. J Rheumatol. 2002;29: 317-320.[Abstract/Free Full Text]

  23. Huang D, Zhou Y, Xia SQ, Pirskanen R, Liu L, Lefvert AK. Markers in the promoter region of interleukin-10 (IL-10) gene in myasthenia gravis: implications on diverse effects of IL-10 in the pathogenesis of the disease. J Neuroimmunol. 1999;94: 82-87.[CrossRef][Medline] [Order article via Infotrieve]

  24. Zheng C, Huang D, Liu L, et al. Interleukin-10 gene promoter polymorphisms in the multiple myeloma. Int J Cancer. 2001;95: 184-188.[CrossRef][Medline] [Order article via Infotrieve]

  25. White GC II, Rosendaal F, Aledort LM, et al. Definitions in hemophilia: recommendation of the Scientific Subcommittee on Factor VIII and Factor IX of the Scientific and Standardization Committee of the International Society on Thrombosis and Haemostasis. Thromb Haemost. 2001;85: 560.[Medline] [Order article via Infotrieve]

  26. Oldenburg J. Mutation profiling in haemophilia A. Thromb Haemost. 2001;85: 577-579.[Medline] [Order article via Infotrieve]

  27. Kasper CK, Aledort LM, Counts RB, et al. A more uniform measurement of factor VIII inhibitors. Thromb Diathes Haemorrh. 1975;34: 869-872.[Medline] [Order article via Infotrieve]

  28. Verbruggen B, Novakova I, Wessels H, Boezeman J, van den Berg M, Mauser-Bunschoten E. The Nijmegen modification of the Bethesda assay for factor VIII:C inhibitors: improved specificity and reliability. Thromb Haemost. 1995;73: 247-251.[Medline] [Order article via Infotrieve]

  29. Noguchi E, Shibasaki M, Arinami T, et al. Association of asthma and the interleukin-4 promoter gene in Japanese. Clin Exp Allergy. 1998;28: 449-453.[CrossRef][Medline] [Order article via Infotrieve]

  30. Eskdale J, Gallagher G. A polymorphic dinucleotide repeat in the human IL-10 promoter. Immunogenetics. 1995;42: 444-445.[Medline] [Order article via Infotrieve]

  31. Lozier JN, Tayebi N, Zhang P. Mapping of genes that control the antibody response to human factor IX in mice. Blood. 2005;105: 1029-1035.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?

Related Article in Blood Online:

"Selfless" cytokines, fraternal discord, and inhibitors
W. Keith Hoots
Blood 2006 107: 3024-3025. [Full Text] [PDF]



This article has been cited by other articles:


Home page
NEJMHome page
K. R. Viel, A. Ameri, T. C. Abshire, R. V. Iyer, R. G. Watts, C. Lutcher, C. Channell, S. A. Cole, K. M. Fernstrom, S. Nakaya, et al.
Inhibitors of Factor VIII in Black Patients with Hemophilia
N. Engl. J. Med., April 16, 2009; 360(16): 1618 - 1627.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Krudysz-Amblo, B. Parhami-Seren, S. Butenas, K. E. Brummel-Ziedins, E. D. Gomperts, G. E. Rivard, and K. G. Mann
Quantitation of anti-factor VIII antibodies in human plasma
Blood, March 12, 2009; 113(11): 2587 - 2594.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. L. Kempton and G. C. White II
How we treat a hemophilia A patient with a factor VIII inhibitor
Blood, January 1, 2009; 113(1): 11 - 17.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. Waters, M. Qadura, E. Burnett, R. Chegeni, A. Labelle, P. Thompson, C. Hough, and D. Lillicrap
Anti-CD3 prevents factor VIII inhibitor development in hemophilia A mice by a regulatory CD4+CD25+-dependent mechanism and by shifting cytokine production to favor a Th1 response
Blood, January 1, 2009; 113(1): 193 - 203.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Lacroix-Desmazes, A.-M. Navarrete, S. Andre, J. Bayry, S. V. Kaveri, and S. Dasgupta
Dynamics of factor VIII interactions determine its immunologic fate in hemophilia A
Blood, July 15, 2008; 112(2): 240 - 249.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. C. Gouw, J. G. van der Bom, G. Auerswald, C. E. Ettinghausen, U. Tedgard, H. M. van den Berg, and for the CANAL Study group
Recombinant versus plasma-derived factor VIII products and the development of inhibitors in previously untreated patients with severe hemophilia A: the CANAL cohort study
Blood, June 1, 2007; 109(11): 4693 - 4697.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. C. Gouw, J. G. van der Bom, H. Marijke van den Berg, and for the CANAL Study group
Treatment-related risk factors of inhibitor development in previously untreated patients with hemophilia A: the CANAL cohort study
Blood, June 1, 2007; 109(11): 4648 - 4654.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Astermark, J. Oldenburg, J. Carlson, A. Pavlova, K. Kavakli, E. Berntorp, A.-K. Lefvert, and for the MIBS Study Group
Polymorphisms in the TNFA gene and the risk of inhibitor development in patients with hemophilia A
Blood, December 1, 2006; 108(12): 3739 - 3745.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
D. Lillicrap
The Role of Immunomodulation in the Management of Factor VIII Inhibitors
Hematology, January 1, 2006; 2006(1): 421 - 425.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2005-09-3918v1
107/8/3167    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Astermark, J.
Right arrow Articles by Lefvert, A.-K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Astermark, J.
Right arrow Articles by Lefvert, A.-K.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Immunobiology
Right arrow Free Research Articles
Right arrow Clinical Trials and Observations
Right arrowRelated Article in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2006 by American Society of Hematology         Online ISSN: 1528-0020