|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, 15 April 2006, Vol. 107, No. 8, pp. 3243-3250. Prepublished online as a Blood First Edition Paper on December 15, 2005; DOI 10.1182/blood-2005-07-2772.
IMMUNOBIOLOGY Human mast cells express multiple EP receptors for prostaglandin E2 that differentially modulate activation responsesFrom the Departments of Medicine and Pediatrics, Harvard Medical School, Boston, MA; Division of Rheumatology, Immunology and Allergy, Brigham and Women's Hospital, Boston, MA; and Partners Asthma Center, Boston, MA.
Prostaglandin E2 (PGE2) blocks mast-cell (MC)-dependent allergic responses in humans but activates MCs in vitro. We assessed the functions of the EP receptors for PGE2 on cultured human MCs (hMCs). hMCs expressed the EP3, EP2, and EP4 receptors. PGE2 stimulated the accumulation of cyclic adenosine monophosphate (cAMP), and suppressed both Fc  RI-mediated eicosanoid production and tumor necrosis factor- (TNF-) generation. PGE2 also caused phosphorylation of extracellular signal-regulated kinase (ERK), exocytosis, and production of prostaglandin D2 (PGD2), as well as leukotriene C4 (LTC4) when protein kinase A (PKA) was inhibited. An EP3 receptor-selective agonist, AE-248, mimicked PGE2-mediated ERK phosphorylation, exocytosis, and eicosanoid formation. Selective agonists of both EP2 and EP4 receptors (AE1-259-01 and AE-329, respectively) stimulated cAMP accumulation. No selective agonist, alone or in combination, was as effective as PGE2. AE-248, AE1-259-01, and AE-329 all inhibited FcRI-mediated TNF- generation, while AE1-259-01 blocked eicosanoid production. PGE2 caused the expression of inducible cAMP early repressor (ICER) by a pathway involving PKA and ERK. Thus, while PGE2 activates MCs through EP3 receptors, it also counteracts FcRI-mediated eicosanoid production through EP2 receptors and PKA, and blocks cytokine transcription. These functions explain the potency of PGE2 as a suppressor of early- and late-phase allergic responses.
Mast cells (MCs) initiate inflammatory responses to infectious organisms and allergens. In allergic diseases, MCs are activated by cross-linkage of their high-affinity Fc receptors for immunoglobulin (Ig) E (Fc RI), releasing preformed proteases and biogenic amines, and generating leukotriene C4 (LTC4), the parent molecule of the cysteinyl leukotrienes (cysLTs), and prostaglandin D2 (PGD21-3). Aspirin-exacerbated respiratory disease (AERD) is characterized by nasal polyposis, asthma, and MC activation in response to challenge with nonselective inhibitors of cyclooxygenase (COX).4,5 MC activation follows allergen challenge in the lungs or nose of susceptible individuals, inducing tissue swelling, bronchconstriction, and vascular leakage (early-phase response [EPR]).6 In vitro, FcRI-induced MC activation also initiates transcription through the actions of nuclear factor  B (NF-B), nuclear factor of activated T cells (NF-AT) and activator protein-1 (AP-1) transcription factors, resulting in sustained cytokine and chemokine generation.7 MC activation recruits leukocytes to allergen-challenged tissues, resulting in sustained swelling and inflammation (late-phase response [LPR]) in a significant proportion of susceptible individuals.8 Mediator generation by MCs stimulated through toll-like receptors (TLRs) also plays an important role in protective innate immunity.9-11 Thus, whether activated through stimulation of FcRI, idiosyncratic mechanisms, or pattern recognition receptors, MCs provide eicosanoids and inducible cytokines for inflammatory responses in vivo, benefiting the host in protective immunity, but also potentially inducing exacerbations of allergic diseases. PGE2, a functionally versatile eicosanoid, acts at 4 divergent G protein-coupled receptors (GPCRs), called the EP1, EP2, EP3, and EP4 receptors (reviewed in Kobayashi and Narumiya12). PGE2 can amplify inflammatory gene expression and promote tissue pathology in colon cancer13 and in mouse models of arthritis.14 In contrast, PGE2 strongly suppresses allergic respiratory mucosal inflammation. Inhalation of PGE2 before allergen challenge prevents both EPR and LPR in subjects with asthma,15 and decreases the levels of PGD2 that are detected in the bronchoalveolar lavage fluid after allergen challenge.16 In AERD, PGE2 inhalation prevents bronchconstriction induced by challenge with nonselective COX inhibitors and abrogates the characteristic rise in urinary levels of LTE4, the end product of the cysLTs.5,17,18 Collectively, these observations suggest that PGE2 inhibits MC activation in the respiratory tract. Although PGE2 reportedly suppresses mediator release by some MC subtypes in vitro by raising intracellular levels of cyclic adenosine monophosphate (cAMP),19,20 it also enhances mediator release from mouse MCs.21-23 The mechanisms and EP receptor subtypes responsible for PGE2-mediated inhibition of MC activation are incompletely understood.
We explored the mechanisms and receptors by which PGE2 modulates activation responses of cord blood-derived human MCs (hMCs). hMCs express EP2,EP3, and EP4 receptors, and respond to PGE2 and receptor-selective analogs with anticipated biochemical signatures and signaling events. In contrast to the results of earlier studies of human lung MCs, PGE2 does not suppress Fc
Reagents
PGE2, PGD2, LTD4, the EP2/EP3 dual receptor antagonist AH6809 (EC50 = 50 µM) and the EP2 receptor selective agonist butaprost (Ki Derivation and priming of hMCs
hMCs were derived from cord-blood mononuclear cells cultured in the presence of stem-cell factor (SCF; 100 ng/mL), IL-6 (50 ng/mL), and IL-10 (10 ng/mL) (all from R&D Systems, Minneapolis, MN), as previously described,30 and studied when they reached more than 95% purity based on staining with toluidine blue (6-9 weeks). For Fc Flow cytometry Expression of EP receptor proteins was assessed on fixed, permeabilized hMCs as described.33 Polyclonal antibodies (Abs) against each EP receptor (Cayman Chemical) and a monoclonal Ab against Kit (Pharmingen, San Diego, CA) were used at 2 µg/sample. The EP3 receptor Ab was raised against a peptide sequence (amino acids 308-327) common to all isoforms of this receptor. Reverse transcriptase-polymerase chain reaction (RT-PCR) Total RNA was extracted from hMCs at 6 to 8 weeks of culture with TRI Reagent (Molecular Research, Cincinnati, OH). RNA samples were primed with oligo(dT) and reverse transcribed using an RT kit (Clontech, Palo Alto, CA). Primer sequences for the amplification of the EP1, EP2, and EP4 receptors34 are as follows, reading from the 5' to the 3' direction: EP1, sense ATCTGCTGGAGGCCAATGCTGGTGT, antisense TCGTTGGGCCTCTGGTTGTGCTT; EP2, sense CCTGGCCGTGCTGCCTGTCATCTAT, antisense CCATGGACACCCTTTCCCTCTCCT; and EP4, sense TTTGCAGGCCATCCGAATTGCTTCT, antisense CCTGCCTCCAAGGCCATTTTCACTGG. Because the human EP3 receptor gene gives rise to several splice variants,35,36 we designed primers for the selective amplification of each. Splice variants I to IV were amplified using a common sense strand primer (CTGAACCAGATCTTGGATCC) with the following isoform-specific antisense primers: EP3-I, TCACCATCATAAGCTTATAC; EP3-II, TACGAATGGCAGACTCAACA; and EP3-III and EP3-IV, TCATGGAGCTTCCAGTGATG. Specific primer pairs were used to amplify EP3-V (sense CAGAGGTTTCCCAGAGAGGAAGGCGTGG, antisense TCCTGGACCTGC CTCCATGCATGACAAA) and EP3-VI (sense GAGATGGGGCCTGATGGAAG, antisense TCATGGAGCTTCCAGTGATG). Primers for human glyceraldehyde-3-phosphate dehydrogenase (Clontech) were run as positive controls. PCR was performed in a Perkin-Elmer Thermal Cycler with 0.4 units of Taq polymerase (Perkin-Elmer, Shelton, CT) for 35 cycles (94°C x 1 minute, 94°C x 30 seconds, 56°C x 2 minutes, and 72°C x 4 minutes). Genomic DNA and non-reverse-transcribed RNA were used as positive and negative control templates, respectively. The PCR products were resolved on ethidium bromide-stained 1.5% agarose gels. The analyses for each receptor were repeated 8 times with RNA harvested from the cells of different donors. Calcium mobilization Changes in the concentration of cytostolic free Ca++ were assessed by two methods. First, a fluorescence imaging plate reader (FLIPR)-based calcium-imaging assay was used to determine the optimal dosing range for PGE2-mediated calcium flux. hMCs (8 weeks old) were washed into Hanks balanced salt solution (HBSS) containing 1% bovine serum albumin (BSA), 20 mM HEPES, and 2.5 mM probenecid at a density of 1.3 x 106 cells/mL and loaded with 2 µM Fluo-4 (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol. The plates were then placed into a FLIPR (Molecular Devices) to monitor cell fluorescence (ex = 488 nm, EM = 540 nm) before and after the addition of various agonists. Triplicate samples of cells were stimulated with PGE2 (0.01-10 µM) or similar concentrations of PGD2 or LTD4 as negative and positive controls. The susceptibility of PGE2-mediated calcium flux to interference by PTX (4- to 12-hour treatment with 100 ng/mL) and the ability of EP receptor-selective agonists to elicit this response were tested with Fura-2 AM (Molecular Probes, Eugene, OR)-loaded hMCs using a fluorescence spectrophotometer (Hitachi F-4500; Hitachi, Greenville, SC) using excitation at 340 and 380 nm to monitor cytosolic free Ca++ as previously described.30 Cell activation for mediator secretion
IL-4-primed hMCs were passively sensitized with human myeloma IgE (2 µg/mL; Chemicon, Tecaluma, CA) overnight on the fourth day of priming. The cells were washed and resuspended in fresh medium at a concentration of 1 x 106 cells/mL, except for the samples used for analysis of exocytosis, which were suspended at a 10 x 106/mL. For studies of exocytosis, samples of 2 x 106 hMCs were challenged with anti-IgE (1 µg/mL; Calbiochem) or medium alone. In some experiments, PGE2, AE-248, AE-329, AE1-259-01, DMSO, or butaprost were added just before activation. The cells were maintained in the presence of SCF (100 ng/mL) throughout to promote optimal viability. Activation was stopped on ice. Supernatants were separated from the pellets by centrifugation at 200g in an Eppendorf microcentrifuge at 4°C. The content of
For eicosanoid production, triplicate samples of 1 x 105 cells were stimulated with various doses of PGE2 or its mimics (0.01-10 µM) or DMSO (1:1000), with and without anti-IgE (1 µg/mL) in the wells of 96-well flat-bottom plates. Supernatants were collected at 30 minutes and stored at -20° C until further analysis with specific enzyme-linked immunosorbent assays (ELISAs) to detect cysLTs (LTC4, LTD4, and LTE4; Cayman Chemical) and PGD2 (Amersham, Arlington Heights, IL). In some experiments, the selective inhibitor of PKA, H89 (10 µM), was added to the cells 30 minutes before activation. The assay for PGD2 did not detect PGE2 at concentrations as high as 10 µM. For cytokine generation, sensitized, primed hMCs were challenged with Staphylococcus aureus peptidoglycan (PGN) (10 µg/mL; Sigma), anti-IgE (1 µg/mL), or medium alone in the presence or absence of agonists or controls as described for eicosanoids. Supernatants were collected at 6 hours and frozen at -70°C until further analysis with ELISAs for TNF- cAMP measurements Triplicate samples of 2 x 105 hMCs were stimulated with various agonists or antagonists for 10 minutes as described previously.25 cAMP was measured with a commercial Biotrack cAMP ELISA kit (Amersham). The mean cAMP values for triplicate samples of cells stimulated with each agonist were compared with values from unstimulated cells, and the data expressed as absolute values. SDS-polyacrylamide gel electrophoresis immunoblotting Samples of 2 x 105 hMCs were stimulated for various intervals with each agonist. Reactions were stopped on ice and the cells were lysed in a buffer containing 1% sodium dodecyl sulfate (SDS), 1% Triton X-100, 1 mM EDTA, 1 mM EGTA, 0.2 mM PMSF, 5 µg/mL leupeptin, and 1 µg/mL pepstatin in 10 mM Tris (pH 8.0). Western blotting was performed as previously described.25 Dilutions (1:2000) of primary antibodies specific for the active, phosphorylated forms of ERK-1/ERK-2, c-Jun NH2-terminal kinase (JNK), and p38 mitogen-activated protein kinase (MAPK) were used. The same blots were stripped and probed again with rabbit polyclonal antibodies that detect total ERK-1/ERK-2, p38, and JNK at dilutions of 1:2,000. All anti-MAPK antibodies were purchased from Cell Signaling Technologies (Beverly, MA). ICER was detected with a rabbit polyclonal antiserum that recognizes all forms of cAMP response element modulator (CREM), including ICER (provided by Dr Carlos Molina, University of New Jersey Medical School) at a concentration of 1:5000.38 Real-time PCR
Samples of 5 to 10 x 106 primed, sensitized hMCs were stimulated for 2 hours with anti-IgE or medium alone, all in the presence of SCF at a constant concentration of 100 ng/mL, with or without PGE2. The expression of TNF- Statistics Data are expressed as means ± SEM from at least 3 experiments except where otherwise indicated. Because quantities of eicosanoids and cytokines generated by hMCs from different donors varied widely, the data for some analyses were converted to percentages of the control (the samples not treated with PGE2 or EP receptor-selective agonists). Differences between treatment groups were determined with the Student t test, with P values less than .05 considered significant. A Q test was used to eliminate outlying experiments.
Expression and function of EP receptors We used RT-PCR to determine the profile of EP receptor mRNAs expressed by hMCs. Bands corresponding to the predicted sizes of the EP2 and EP4 receptors were detected in mRNA samples from all 8 donors tested (as shown for 1 donor, Figure 1A). All 8 donors showed both the EP3-II splice variant and at least one Gi-linked EP3 variant (5 showed EP3-I, 4 showed the EP3-IV, 4 showed EP3-VI, and none showed EP3-V transcript). EP1 receptor transcripts were detected in the RNA from the cells of only 1 donor (not shown). All of the primer sets yielded bands of the expected sizes from the positive control DNA template, and no products were detected from the negative control template (Figure 1). The EP2, EP3, and EP4 receptor proteins were all detected by flow cytometry (n = 3 as shown for 1 experiment; Figure 1B), while the EP1 receptor protein was not detected in the cells from any of these donors. IL-4 priming of the hMCs did not alter the profile or the level of EP receptor mRNA or proteins expressed (not shown). Virtually all of the cells showed high-level cytofluorographic expression of Kit (Figure 1B), confirming the identity of the EP receptor-positive cells as hMCs. In a FLIPR assay, PGE2 (0.1-10 µM), but not PGD2, induced a calcium flux (an expected signature of both EP1 and EP3 receptors; Figure 2A). Subsequently, fluorescence spectrophotometry was used to measure calcium flux in hMCs following treatment with or without PTX. The cells from 8 donors were tested in this assay, and 3 exhibited calcium flux to PGE2 (1-10 µM); this flux was completely blocked by treatment of the cells with PTX (Figure 2B). LTD4-mediated calcium flux occurred in every donor and was unaffected by PTX. Of the receptor-selective reagents, only the EP3 receptor-selective agonist AE-248 (10 µM) stimulated calcium flux, and was much weaker than PGE2 at the same concentration (n = 2, data not shown). Priming of the cells with IL-4 did not change the strength of PGE2-induced calcium flux.
Stimulation of hMCs with PGE2 (1 µM) rapidly (5 minutes) induced phosphorylation of ERK-2 and ERK-1, with ERK-2 being expressed more strongly (Figure 2C). ERK was also phosphorylated in response to stimulation of the hMCs with the EP3 receptor-selective agonist AE-248 at 1 µM, but not with the EP1, EP2, and EP4 receptor-selective agonists at the same concentration (n = 4 as shown for a single experiment; Figure 2C). ERK phosphorylation in response to stimulation with both PGE2 (Figure 2C) and AE-248 (not shown) was completely blocked by pretreatment of the cells with PTX or with the MEK inhibitor UO126 (5 µg/mL), but was unaffected by treatment with H89 (10 µM, n = 3, not shown). p38 and JNK were constitutively phosphorylated and not affected by PGE2 or its analogs.
Stimulation of the cells with PGE2 dose-dependently induced the accumulation of cAMP for every donor tested (n = 3 as shown for 1 representative experiment; Figure 3A). The EP2 receptor-selective agonist AE1-259-01 modestly stimulated cAMP accumulation at concentrations of 0.1, 1, and 10 µM (n = 5, Figure 3B). A second EP2 receptor agonist, butaprost, weakly stimulated cAMP accumulation, reaching significance at 10 µM (210 ± 6 vs 158 ± 10 fmol for buffer treated cells; P = .03, n = 3, data not shown). The EP4 receptor-selective agonist AE-329 also induced cAMP accumulation at 1 and 10 µM (Figure 3B). cAMP values in cell samples stimulated with AE-248 at 10 µM tended to be higher than controls, but did not reach significance (P = .08 relative to unstimulated controls, n = 5). The EP1 receptor-selective agonist D1-004 was inactive (n = 3, not shown). Even at the highest doses tested, none of the selective agonists stimulated as much cAMP accumulation as PGE2, and various combinations of the selective agonists did not additively stimulate cAMP over a wide concentration range (0.01-1 µM, n = 3, not shown). The EP4 receptor-selective antagonist AE-208 (10 µM) abrogated cAMP accumulation in response to 10 µM AE-329, but its effect on cAMP accumulation occurring in response to PGE2 (1 µM) was not significant (P = .054, n = 4, Figure 3C). The EP2/EP3 receptor-selective antagonist AH6809 (50 µM) blocked cAMP accumulation in response to 1 and 10 µM PGE2 by 69% ± 6% and 42% ± 16%, respectively, but failed to block cAMP accumulation in response to AE-329 (mean ± Effects of PGE2 on exocytosis and eicosanoid production
PGE2 at doses as high as 10 µM failed to attenuate Fc
Primed hMCs generated both LTC4 (as determined by the detection of cysLTs) and PGD2 when stimulated by Fc
Cytokine generation and ICER induction
Primed hMCs generated IL-5 and TNF- At 0.1-10 µM, PGE2 dose-dependently induced ICER expression (Figure 7A), peaking at 2 to 3 hours after stimulation (Figure 7B). This effect was partly mimicked by stimulation of the cells with forskolin at 200 µM (Figure 7D). AE1-259-01 and AE-329 both also induced ICER expression at 1 µM (Figure 7B,D), while the EP3 receptor-selective agonist AE-248 did not strongly induce ICER expression. Pretreatment of the cells with either UO126 or H89 (5 µg/mL and 10 µM) tended to attenuate the PGE2-induced expression of ICER (P = .08 and .06 relative to PGE2 alone, n = 4, as shown for 1 experiment; Figure 7C). Combined treatment with H89 and UO126 totally abrogated ICER induction, and pretreatment with either AH6809 or AE-208 modestly reduced ICER induction (n = 2, Figure 7D; as shown for 1 experiment, Figure 7C). H89, but not UO126, attenuated ICER induction by AE1-259-01 (n = 3, not shown). Treatment of the cells with 8-pCPT-2'-O-Me-cAMP did not induce ICER expression (n = 2, not shown).
Both COX-1- and COX-2-dependent synthetic pathways mediate PGE2 production in models of experimentally induced allergic pulmonary disease in mice.39,40 The abrogation of functional COX-1 or COX-2 activity through genetic39 or pharmacologic40 approaches amplifies mucosal inflammation, eosinophilia, and airway hyperresponsiveness in such models by enhancing cytokine generation by T-helper cells.41 Because MCs are an apparent target of the protective effects of PGE2 against provocative challenges in humans with asthma15,16 and AERD,17 we used well-characterized nontransformed hMCs derived in vitro to better define the EP receptors contributing to the effects of PGE2 on mediator release, and to determine whether PGE2 might also activate hMCs in certain contexts. EP receptors induce differential signaling events through specific patters of G protein utilization. Heterologously expressed EP2 and EP4 receptors both use Gs proteins to stimulate adenylyl cyclase and induce accumulation of cAMP,42 with EP2 receptors being more potent. We detected both of these receptors at the protein and mRNA levels (Figure 1), and showed that both were functional based on the cAMP accumulation induced by the selective agonists AE1-259-01 and AE-329 (Figure 3). The complete blockade of AE-329-induced cAMP accumulation by the EP4 receptor antagonist AE-208 (Figure 3C) confirmed the specificity of this agonist at 10 µM, and the functionality of the receptor. However, the failure of AE-208 to significantly suppress PGE2-induced cAMP stimulation suggests a more dominant role for EP2 receptors in this response, also reflected by inhibition by AH6809. Despite reported nanomolar range potency on EP transfectants,26,27 none of the selective agonists, alone or in various combinations, approached the efficacy of PGE2 itself. We speculate that primary cells that express comparatively low levels of individual EP receptor proteins (Figure 1) may require the assembly of ligand-induced, hetero-oligomeric complexes between different EP receptors to amplify PGE2-dependent signaling events, as reported for other coexpressed GPCRs.43 Such complexes may not be efficiently induced by the selective agonists. We also cannot exclude the potential existence of previously unrecognized EP receptors among the orphan GPCRs.
Splice variants of the human EP3 receptor mRNA produce multiple isoforms with identical ligand binding properties but different C-termini that confer the ability to either stimulate PTX-sensitive Gi proteins (all isoforms) or Gs proteins (EP3-II and EP3-IV isoforms),35,36 mediating opposing effects on adenyly cyclase/cAMP.44,45 The consistent expression of the EP3-II message with a combination of Gi-linked variants suggests that the EP3 receptor protein expressed by hMCs (Figure 1B) reflects more than one isoform. The modest increment in cAMP that was induced by AE-248 (Figure 3) suggests the function of the EP3-II receptor, although this effect did not reach statistical significance and only occurred at a dose potentially capable of crossover effects.27 Since cAMP elevation attenuates calcium signaling,46 concomitant Gs-induced signaling from EP3-II or other receptors may explain why EP3 receptor-dependent calcium flux was observed in only 3 of the 8 donors tested (Figure 2). Nonetheless, PTX-sensitive ERK phosphorylation in response to PGE2 and AE-248 was observed in all donors tested (Figure 2), reflecting a robust signal through the Gi-linked EP3 receptor variants responsible for the secretory events observed (Figures 4, 5).
For mediator release, we primed hMCs with IL-4 because this cytokine augments both exocytosis and eicosanoid generation.32,47 While earlier studies reported that PGE2 (by raising cAMP levels) inhibited Fc
Fc
TNF- Our data reveal that PGE2 can either induce (via EP3 receptors) or suppress (via EP2 receptors) mediator release from MCs that induce the EPR. EP2 receptor-dependent signaling is an attractive candidate to explain PGE2-dependent suppression of eicosanoid generation in allergen or aspirin challenge. Moreover, the suppressive effect of PGE2 on allergen-induced LPRs15 could in part reflect transcriptional repression through cooperative signaling from multiple EP receptors. Finally, EP3 receptor-dependent MC activation is reported to occur in the skin in a mouse model of cutaneous inflammation,21 and this may reflect both the release of histamine and PGD2. It seems likely that the pro- and anti-MC-activating effects of PGE2 reported for respectively for skin21 and lung15 reflect regional differences between MCs EP receptor expression and function.
Submitted July 13, 2005; accepted December 5, 2005.
Prepublished online as Blood First Edition Paper, December 15, 2005; DOI 10.1182/blood-2005-07-2772.
Supported by National Institutes of Health grants AI-48802, AI-52353, AI-31599, and HL-36110, and by grants from the Charles Dana Foundation and the Vinik Family Fund for Research in Allergic Diseases.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Joshua A. Boyce, Allergic Diseases Research Section, Harvard Medical School, Division of Rheumatology, Immunology, and Allergy, One Jimmy Fund Way, Smith Bldg Rm 626, Boston, MA 02115; e-mail: jboyce{at}rics.bwh.harvard.edu.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Top
Abstract
Introduction
10 µM) were purchased from Cayman Chemical (Ann Arbor, MI). EP1, EP2, EP3, and EP4 receptor-selective agonists (DI-004, AE1-259-01, AE-248, and AE-329, respectively) and an EP4 receptor-selective antagonist (AE-208) were obtained from Ono Pharmaceuticals (Osaka, Japan). These agonists are potent (Ki 
RI-dependent exocytosis, cytokine generation, and eicosanoid production, hMCs were transferred to new medium containing SCF and IL-4 (10 ng/mL, R&D Systems) for 5 days before activation.
-hexosaminidase (
range, n = 2, data not shown). PTX pretreatment failed to alter cAMP accumulation in response to any agonist (not shown). 
