Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 15 April 2006, Vol. 107, No. 8, pp. 3279-3287.
Prepublished online as a Blood First Edition Paper on November 8, 2005; DOI 10.1182/blood-2005-08-3087.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2005-08-3087v1
107/8/3279    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Scherr, M.
Right arrow Articles by Eder, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Scherr, M.
Right arrow Articles by Eder, M.
Related Collections
Right arrow Neoplasia
Right arrow Signal Transduction
Right arrow Gene Expression
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

NEOPLASIA

Enhanced sensitivity to inhibition of SHP2, STAT5, and Gab2 expression in chronic myeloid leukemia (CML)

Michaela Scherr, Anuhar Chaturvedi, Karin Battmer, Iris Dallmann, Beate Schultheis, Arnold Ganser, and Matthias Eder

From the Hannover Medical School, Department of Hematology, Hemostaseology and Oncology, Hannover; and III Medical Clinic, University Hospital of Mannheim, University of Heidelberg, Mannheim, Germany.


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Although targeting the BCR-ABL tyrosine kinase activity by imatinib mesylate has rapidly become first-line therapy in chronic myeloid leukemia (CML), drug resistance suggests that combination therapy directed to a complementing target may significantly improve treatment results. To identify such potential targets, we used lentivirus-mediated RNA interference (RNAi) as a tool for functional genomics in cell lines as well as primary normal and CML CD34+ cells. In a conditional cell culture model, we demonstrate that RNAi-mediated reduction of SHP2, STAT5, and Gab2 protein expression inhibits BCR-ABL-dependent but not cytokine-dependent proliferation in a dose-dependent manner. Similarly, colony formation of purified primary CML but not of normal CD34+ colony-forming cells is specifically reduced by inhibition of SHP2, STAT5, and Gab2 expression, respectively. In addition, coexpression of both anti-BCR-ABL and anti-SHP2 shRNAs from a single lentiviral vector induces stronger inhibition of colony formation as compared to either shRNA alone. The data indicate that BCR-ABL expression may affect the function of normal signaling molecules. Targeting these molecules may harbor significant therapeutic potential for the treatment of patients with CML.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The treatment of BCR-ABL+ chronic myeloid leukemia (CML) with the selective tyrosine kinase inhibitor imatinib mesylate has recently evolved as a new paradigm for molecular-defined anticancer therapy.1 Although superior to conventional drugs such as {alpha}-interferon and cytarabine (ara-C) in chronic-phase CML,2 drug resistance, especially in advanced disease, due to mutations in the BCR-ABL kinase domain led to the development of second-generation ATP- or substrate-competitive inhibitors that seem to overcome imatinib resistance for many but not all mutations.3-6 Independent of this rapid progress, imatinib mesylate, and perhaps second-generation inhibitors as well, are not believed to cure CML, indicating some limitations of this exciting therapeutic approach.7

On the other hand, BCR-ABL gene expression has been targeted by RNA interference (RNAi) in cell culture models and in primary CML cells.8-12 Anti-BCR-ABL RNAi inhibits proliferation of BCR-ABL+ cell lines and reduces BCR-ABL mRNA levels in primary CML cells. Interestingly, anti-BCR-ABL RNAi can cooperate with imatinib in inducing cell death in BCR-ABL+ cell lines,10,12 and stable anti-BCR-ABL RNAi can inhibit colony formation of primary CML progenitors in semisolid cultures.12 However, long-term RNAi in primary hematopoietic cells has only been achieved by viral gene transfer strategies, and currently there is no means suitable for clinical application to induce RNAi in hematopoietic cells.

To search for alternative therapeutic targets in CML for potential combination therapy with selective kinase inhibitors, we analyzed the function of SHP2, STAT5, and Gab2 on BCR-ABL-mediated cell proliferation. We considered the constitutive tyrosine phosphorylation of all 3 targets in BCR-ABL+ cells as a biochemical surrogate marker for their potential contribution to BCR-ABL signaling. SHP2-encoded at the PTPN11 locus is an SH2-domain containing hematopoietic protein tyrosine phosphatase, which is involved in full activation of the ERK/MAP kinase pathway by cytokine and receptor tyrosine kinase (RTK) signal transduction.13 In addition, SHP2 can regulate Src family kinases14 and PI-3K activity on RTK and Mpl-receptor signaling.15,16 PTPN11 mutations have been described in Noonan syndrome,17 juvenile myelomonocytic leukemia (JMML),18 and adult acute myeloid leukemia (AML),19 and overexpression of wild-type SHP2 has recently been described in adult leukemia including CML.20 STAT5 belongs to a family of transcription factors that undergo tyrosine phosphorylation on stimulation by several hematopoietic cytokine receptors. STATs subsequently homodimerize, translocate to the nucleus, and activate target gene transcription.21,22 STAT5 has been linked to BCR-ABL-dependent proliferation,23,24 to antiapoptotic signals,25 and to cell cycle regulation via cyclin D2.26 Gab2 is an adaptor protein that associates with several SH2-domain containing proteins, including SHP2, in a phosphotyrosine-dependent manner.27 Importantly, Gab2 has been shown to be essential for transformation by BCR-ABL in murine myeloid cells.28

To analyze the function of SHP2, STAT5, and Gab2 in primary hematopoietic cells we established lentivirus-mediated anti-SHP2, anti-STAT5, and anti-Gab2 RNAi as a tool for reverse genetics in cell lines and CD34+ cells. Using murine TonB cells as a model for inducible BCR-ABL expression that allows the analysis of target gene function in BCR-ABL as compared to cytokine-driven cell proliferation, we demonstrate differential, reversible, and, as shown for Gab2, dose-dependent inhibition of BCR-ABL but not IL-3-dependent cell proliferation. Interestingly, RNAi against BCR-ABL and STAT5, but not against SHP2 and Gab2, reduces cell survival in this model. In primary cells, we demonstrate that colony formation of lentivirally transduced CML CD34+ progenitors is more sensitive to inhibition of SHP2, STAT5, and Gab2 expression than that of normal CD34+ progenitors. This differential sensitivity to RNAi is very similar to that observed in the cell culture model. Finally, the combination of anti-BCR-ABL and anti-SHP2 RNAi cooperates in inhibiting colony formation of CML colony-forming units (CFUs). These data demonstrate for the first time that stable RNAi triggered on lentiviral gene transfer can be used to identify potential targets different from the BCR-ABL tyrosine kinase activity for therapeutic intervention in primary hematopoietic cells. They further suggest that combined molecular targeting of leukemia specific and nonspecific signaling molecules may harbor significant potential for anti-BCR-ABL therapy.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
shRNA synthesis and construction of H1-shRNA expression cassettes

Seven DNA oligonucleotides corresponding to positions 237 to 255, 291 to 309, 594 to 612, 614 to 632, 651 to 669, 714 to 732, and 1569 to 1587, of the sequence of the human PTPN11 gene (GenBank accession no. NM_002834 [GenBank] ), 6 DNA oligonucleotides corresponding to positions 357 to 376, 371 to 389, 487 to 505, 534 to 552, 620 to 638, and 1005 to 1023 of the sequence of the human Gab2 gene (GenBank accession no. AB018413 [GenBank] ), as well as 7 DNA oligonucleotides corresponding to positions 837 to 855, 938 to 956, 1151 to 1169, 1243 to 1261, 1367 to 1385, 1460 to 1478, and 1652 to 1670 of the sequence of the human STAT5 gene (GenBank accession no. NM_003152 [GenBank] ), were subjected to BLAST-homology search and thereafter chemically synthesized including overhang sequences from a 5' BglII and a 3' SalI restriction site for cloning purposes (BioSpring, Frankfurt, Germany). The numbering of the first nucleotide of the shRNAs (italics) refers to the ATG start codon. The oligonucleotide sequences of the effective shRNAs used in this study were as follows: FP237SHP2: 5'-GATCCCGTATTACATGGAACATCACTTCAAGAGAGTGATGTTCCATGTAATACTTTTTTGGAAG-3'; RP237SHP2: 5'-TCGACTTCCAAAAAAAGTATTACATGGAACATCACTCTCTTGAAGTGATGTTCCATGTAATACGGG-3'; FP594SHP2: 5'-GATCCCGAAGAATCCTATGGTGGAATTCAAGAGATTCCACCATAGGATTCTTCTTTTTTGGAAG-3'; RP594SHP2: 5'-TCGACTTCCAAAAAAAGAAGAATCCTATGGTGGAATCTCTTGAATTCCACCATAGGATTCTTCGGG-3'; FP714SHP2: 5'-GATCCCGACCACAGATAAAGTCAAATTCAAGAGATTTGACTTTATCTGTGGTCTTTTTTGGAAG-3'; RP714SHP2: 5'-TCGACTTCCAAAAAAAGACCACAGATAAAGTCAAATCTCTTGAATTTGACTTTATCTGTGGTCGGG-3'; FPgab620: 5'-GATCCCGGAGTGCCAGCTTCTCTCATTCAAGAGATGAGAGAAGCTGGCACTCC TTTTTTGGAAG-3'; RPgab620: 5'-TCGACTTCCAAAAAAAGGAGTGCCAGCTTCTCTCATCTCTTGAATGAGAGAAGCTGGCACTCCGGG-3'; FP STAT5-1151: 5'-GATCCCGTACTTCATCATCCAGTACTTCAAGAGAGTACTGGATGATGAAGTACTTTTTTGGAAG-3'; RPSTAT5-1151: 5'-TCGACTTCCAAAAAAGTACTTCATCATCCAGTACTCTCTTGAAGTACTGGATGATGAAGTACGGG-3'.


Figure 1
View larger version (16K):
[in this window]
[in a new window]
 
Figure 1.. Gene silencing mediated by lentivirus-encoded shRNAs in K562 cells. (A) The shRNA is transcribed from a human H1-RNA promoter inserted into the U3 region of the lentiviral {Delta}3'-LTR. The vector encodes RFP as a marker gene driven by the SFFV-LTR promoter and harbors a cPPT/CTS sequence. 5'-LTR indicates HIV-1 5'-LTR; {Delta}3'-LTR, HIV-1 self-inactivating (SIN) 3'-LTR; GA, deleted gag sequence; RRE, Rev responsive element; SD, splice donor site; SA, splice acceptor site; {Psi}, packaging signal, SFFV-LTR of spleen focus-forming virus. (B) SHP2, STAT5, and Gab2 mRNA levels were measured by real-time RT-PCR 4 days after lentiviral transduction and normalized in comparison to GAPDH expression. The shRNAs are indicated on top of each bar. mRNA expression of SHP2 (left), STAT5 (middle), and Gab2 (right) in control dcH1-GL4-SR-transduced cells was set to 100% (average of 3 independent experiments). (C) For immunoblotting, cells were transduced with control dcH1-GL4-SR (lane 2), dcH1-b3a2_1-SR (lane 3), anti-SHP2 shRNAs 237, 594, and 714 (top: lanes 4-6), anti-STAT5 shRNA (middle, lane 4), and anti-Gab2 shRNA (bottom, lane 4) and lysed 6 days after transduction, respectively. Lane 1 shows untransduced K562 cells. The immunoblots were probed with anti-SHP2, anti-STAT5, and anti-Gab2 antibodies, respectively, and reprobed with anti-ERK2 antibody as loading control. (D) Number of K562 cells negative for trypan blue after lentiviral transduction with different shRNAs is shown (averages from 3 experiments). One milliliter with 104/mL cells was plated, cultures were split and fed twice a week, and calculated cell numbers are indicated. Triangles depict transduction with dcH1-GL4-SR (control), and circles show transduction with viruses dcH1-b3a2_1-SR, dcH1-237SHP2-SR, dcH1-Gab2-SR, and dcH1-STAT5-SR, respectively.

 
The noncomplementary 9-nt-loop sequences are underlined, and each sense oligonucleotide harbors a stretch of T as a pol III transcription termination signal. Corresponding oligonucleotides were annealed and inserted 3' of the H1-RNA promoter into the BglII/SalI-digested pBlueScript-derived pH1-plasmid to generate pH1-SHP-237, pH1-SHP-594, pH1-SHP-714, pH1-gab620, and pH1-STAT5-1151 as described.29 These shRNAs are complementary to both the human and murine target mRNAs. Plasmids pH1-GL4 (control), pH1-121GFP, pH1-beta-GMR, and pH1-b3a2_1 expressing an shRNA covering the fusion sequence of the b3a2-variant of the BCR-ABL gene have been described earlier.9,12,29,30

Construction of lentiviral vectors

pdc-SR (pdc: plasmids resulting in double-copy proviruses) were used to generate lentiviral transgenic plasmids containing H1-siRNA expression cassettes located in the U3 region of the {Delta}3'-long terminal repeat (LTR).29 To generate the lentiviral pdcH1-siRNA-SR plasmid, the pH1-SHP237, pH1-SHP594, pH1-SHP714, pH1-gab620, and pH1-STAT5-1151 plasmids were digested with SmaI and HincII and the resulting DNA fragments (360 nt) were blunt-end ligated into the SnaBI site of the pdc-SR to generate pdcH1-SHP237-SR, pdcH1-SHP594-SR, pdcH1-SHP714-SR, pdcH1-gab620-SR, and pdcH1-STAT5-1151-SR, respectively (Figure 1A). All lentiviral constructs encode RFPEXPRESS as reporter gene.

To generate an H1-shRNA tandem expression cassette, pH1-b3a2_1 DNA was digested with EcoRI followed by filling in the staggered termini with DNA polymerase I (Klenow), treatment with bacterial alkaline phosphatase, and gel purification. Next, the pH1-SHP237 expression cassette was digested with BamHI and XhoI followed by a DNA polymerase I fill-in reaction. The resulting DNA fragment (~360 nucleotides) was blunt-end ligated into the linearized pH1-b3a2_1 plasmid to generate pH1-b3a2-SHP237. To generate the lentiviral pdcH1-b3a2-SHP237-SR plasmid, the pH1-b3a2-SHP237 plasmid was digested with BamHI and XhoI followed by a DNA polymerase I fill-in reaction and the resulting DNA fragment (~700 nucleotides) was blunt-end ligated into the SnaBI site of pdc-SR (Figure 6A). The isolated clone was verified by DNA sequencing.

Cell culture

293T and BHK-21 cells were grown at 37°C in Dulbecco modified Eagle medium (DMEM), 10% FCS, and 2 mM L-glutamine. K562 cells were maintained in RPMI 1640 with 10% FCS. Murine TonB (TonB) cells derived from the BaF3 cell line were cultured as described.31

CD34+ cells from patients with CML in first chronic phase were isolated at the time of initial diagnosis as described.32 Purification resulted in 98% or more purity. G-CSF-primed CD34+ cells were harvested by leukapheresis from 6 healthy volunteers, purified to at least 98% CD34+ content by magnetic cell sorting (Clini MACS, Miltenyi Biotech, Bergisch Gladbach, Germany). Informed consent from the patients and volunteers was obtained in accordance with the Declaration of Helsinki.

Preparation of recombinant lentiviral supernatants and lentiviral transduction

VSV.G-pseudotyped lentiviral particles were generated by calcium phosphate cotransfection of 293T cells, and viral supernatants were concentrated as previously described.32 dcH1-shRNA-SR lentiviral preparations were titered in triplicate by serial dilutions of the concentrated vector stocks on 1 x 105 K562 cells in 24-well plates. The number of RFP+ cells was analyzed 72 hours after transduction by fluorescence-activated cell sorting (FACS) analysis (FACS Calibur, Becton Dickinson, Heidelberg, Germany), and the titers were averaged and typically ranged between 5 and 10 x 107 IU/mL.

Lentiviral supernatants were used to transduce (1) K562, (2) TonB, (3) normal CD34+, and (4) CD34+ CML cells as recently described.32 K562 and normal and CML CD34+ cells were transduced with a multiplicity of infection (MOI) of approximately 4 and 2, respectively. TonB cells were transduced with an MOI of 4 in the presence of muIL-3 (10 ng/mL). Doxycycline (1 µg/mL) was added 2 days after transduction to half of the cells. On day 4 cultures were washed 3 times and resuspended either in the presence of murine IL-3 or with doxycycline in the absence of IL-3. Addition of doxycycline either 2 or 4 days after lentiviral transduction gave identical results.

Colony assays of transduced CD34+ CML and normal CD34+ cells were performed as described earlier.12,30 Then, 5 x 104 to 1 x 105 CD34+ cells were lentivirally transduced, and 1 x 103 cells were plated per methylcellulose culture. Cultures were stimulated with human GM-CSF and IL-3 at either 20 and 10 ng/mL (high stimulation) or 0.2 and 0.1 ng/mL (low stimulation), respectively. In parallel experiments, methylcellulose colony assays of transduced normal and CML CD34+ cells were stimulated with human SCF, G-CSF, and thrombopoietin (Tpo) at either 20 and 10 ng/mL and 10 U/mL (high stimulation) or 0.2 and 0.1 ng/mL and 0.1 U/mL (low stimulation), respectively. Colonies derived from transduced CFUs were identified by fluorescence microscopy.

Real-time RT-PCR

Cytoplasmic RNA was isolated using RNeasy mini-spin columns (Qiagen, Hilden, Germany) from 1 x 106 K562 cells. RNA was reverse transcribed into cDNA in a total volume of 20 µL using the MMLV-reverse transcriptase (Invitrogen, Groningen, Netherlands) and random hexamer primers under standard conditions. Real-time TaqMan reverse transcriptionpolymerase chain reaction (RT-PCR) of BCR-ABL and GAPDH was performed as described previously.9,33 Quantitative RT-PCR of SHP2, Gab2, and STAT5 expression in K562 was analyzed using the following primers: SHP2-FP, 5'-CCCACATCAAGATTCAGAACACT-3'; SHP2-RP, 5'-GCCCGTGATGTTCCATGTAA-3'; Gab2-FP, 5'-GCCGGCACAATACAGAATTCA-3'; Gab2-RP, 5'-GTGAGGCTGCCCTTGGTGT-3'; STAT5-FP, 5'-TGCCATTGACTTGGACAATCC-3'; and STAT5-RP, 5'-AAACCCATCTTCCCCCACC-3'.

The FAM-labeled probes were: SHP2, 5'-TGCCACTTTGGCTGAGTTGGTCC-3'; Gab2, 5'-ACCTCCCCCGCAGCCTGGC-3'; and STAT5, 5'-AGCTGCAGAAGAAGGCGGAGCA-3'.

Proliferation assay and annexin V staining

Cell proliferation was analyzed by trypan blue exclusion assay. Briefly, 1 to 5 x 104 cells/mL were grown in 24-well plates and the number of viable cells was determined after 24 hours and up to 25 days by trypan blue exclusion. In addition, lentivirally transduced TonB cells were analyzed for annexin V expression at day 6 after removal of murine IL-3 and addition of doxycycline to half of cells using the annexin-V-FLUOS staining kit (Roche, Penzberg, Germany) as recommended by the manufacturer.

Immunoblotting

Cellular lysates from K562 and TonB cells were prepared with lysis buffer (50 mM Tris-HCl, pH 7.4; 150 mM NaCl; 1% NP-40; 1% Triton X-100; 50 mM NaF; 5 mM EDTA; 1 mM PMSF; 1 mM Na2VO4), separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to Hybond enhanced chemiluminescence (ECL) nitrocellulose membrane (Amersham Biosciences, Uppsala, Sweden), and immunoblotted with polyclonal rabbit anti-SH-PTP2 antibody (C-18), polyclonal anti-STAT5a (L-20), polyclonal rabbit anti-Gab1 (H-198), and polyclonal anti-ERK2 antibody (C-14) (all antibodies from Santa Cruz Biotechnology, Heidelberg, Germany), polyclonal rabbit anti-Gab2 (Upstate Biotechnology, Dundee, United Kingdom), and polyclonal rabbit anti-STAT3 (Cell Signaling Technology, Beverly, MA), according to the manufacturer's protocol. Chemiluminescence was used for visualization using the ECL Western blotting detection reagents (Amersham Biosciences) according to the manufacturer. Densitometry was performed on scanned images using Adobe Photoshop 7.0 software.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Generation and functional evaluation of anti-SHP2, STAT5, and Gab2 shRNAs

The shRNAs targeting SHP2, STAT5, and Gab2 were rationally designed according to established rules and functionally evaluated using a transient cotransfection assay described earlier.29 This assay is based on FACS analysis of EGFP fluorescence with EGFP encoded along with the target gene on a bi-cistronic transcript. Three, one, and one of several shRNAs tested for SHP2, STAT5, and Gab2 reduced EGFP fluorescence to a similar extent as the anti-GFP shRNA used as a positive control, respectively (data not shown). The shRNAs 237, 594, and 714 for SHP2, 1151 for STAT5, and 620 for Gab2 were used in all further experiments.

To analyze the effects of shRNAs on endogenous target gene expression, lentiviral vectors encoding the respective shRNAs were generated (Figure 1A), and lentiviral supernatants were used to transduce BCR-ABL+ K562 cells at more than 98% efficiency (data not shown). All shRNAs strongly reduced target mRNA and protein expression as determined by real-time RT-PCR and immunoblotting, respectively (Figure 1B-C). The anti-SHP2 and STAT5 shRNAs reduced endogenous mRNA levels by about 90% ± 5%, whereas anti-Gab2 shRNA was slightly less efficient. In addition, protein expression was significantly reduced on expression of each shRNA (Figure 1C). Furthermore, RNAi against all 3 target genes as well as against BCR-ABL inhibited cell proliferation of K562 cells as compared to control shRNA (Figure 1D).

Enhanced sensitivity to gene silencing of SHP2, STAT5, and Gab2 in BCR-ABL-dependent cell proliferation

To specifically analyze the contribution of SHP2, STAT5, and Gab2 to BCR-ABL-mediated proliferation, TonB cells were transduced with high-titer lentiviral supernatants to induce stable RNAi against each of the 3 targets. On transduction to more than 95% (Figure 2A), TonB cells were cultured with murine IL-3 for an additional 4 days to allow for appropriate shRNA expression, and the reduction of target protein expression was determined by immunoblotting (Figure 2B). RNAi against STAT5 and Gab2 reduce STAT5 and Gab2, but not STAT3 and Gab1 protein expression, respectively. After addition of doxycycline to induce BCR-ABL expression to half of the cells and removal of IL-3 from the BCR-ABL+ cultures, the number of viable cells was determined. Anti-BCR-ABL, anti-SHP2, and anti-STAT5 shRNAs efficiently inhibit BCR-ABL-mediated (Figure 2D) but not IL-3-mediated (Figure 2C) cell proliferation with no difference to control shRNAs in this condition. In contrast, the anti-Gab2 shRNA was less effective, causing approximately 75% reduction in cell proliferation. Interestingly, readdition of murine IL-3 to BCR-ABL cultures with reduced target gene expression induces cell recovery as shown in Figure 2E.

To analyze the effects of anti-Gab2 shRNA, which was found to be less effective than anti-SHP2 and anti-STAT5 shRNAs, in more detail, we isolated several independent TonB-Gab2 shRNA clones by limiting dilution and analyzed 3 isolates according to their RFP fluorescence (Figure 3A). Immunoblotting reveals some correlation between RFP fluorescence and inhibition of Gab2 protein expression as determined by densitometry with 67%, 58%, and 30% reduction of Gab2 protein expression in clones with a mean fluorescent intensity (MFI) of about 1500, 500, and 100, respectively (Figure 3B). As shown in Figure 3C, reduction of Gab2 protein expression correlates to inhibition of BCR-ABL-mediated, but not IL-3-mediated proliferation in a dose-dependent manner.


Figure 2
View larger version (31K):
[in this window]
[in a new window]
 
Figure 2.. Lentivirus-mediated gene silencing in transduced TonB cells. (A) Dot blots of RFP fluorescence and side scatter (SSC) from TonB cells transduced with dcH1-GL4-SR, dcH1-b3a2-SR, dcH1-237SHP2-SR, dcH1-STAT5-SR, and dcH1-Gab2-SR 4 days after lentiviral transduction in the presence of IL-3. (B) For immunoblotting, TonB cells transduced with control dcH1-GL4-SR (lane 2), dcH1-121gfp-SR (lane3), dcH1-b3a2_1-SR (lane 4), or with anti-STAT5 shRNA, anti-Gab2, or anti-SHP2 shRNA (lane 5 in each blot), respectively, were lysed 4 days after transduction. Lane 1 shows untransduced TonB cells. The immunoblots were probed with anti-SHP2, anti-Gab2, anti-STAT5, anti-STAT3, and anti-Gab1 antibodies as indicated, and reprobed with anti-ERK2 antibody as loading control. (C) Number of trypan blue-negative TonB cells was determined starting 4 days after lentiviral transduction with different shRNAs (set day 0 on x-axis, average from 3 independent experiments) in the presence of IL-3. Triangles depict transduction with dcH1-GL4-SR or mock-transduced cells (control), and the almost identical cell number at day 14 was set 100%. Circles show cell numbers of TonB cells transduced with viruses encoding dcH1-b3a2_1-SR, dcH1-237SHP2-SR, dcH1-Gab2-SR, and dcH1-STAT5-SR as indicated. In a different set of experiments anti-GFP shRNAs were included as an additional control with almost identical results as shown. (D) Number of trypan blue-negative TonB cells was determined in the presence of doxycycline to induce BCR-ABL expression and in the absence of IL-3 (average from 3 independent experiments). Labeling as in panel C. (E) Number of trypan blue-negative TonB cells from cultures shown in panel D after readdition of IL-3 after 4 days (set day 0 on x-axis, averages from 3 experiments). Labeling as in panel C.

 
Reduced viability of TonB cells with decreased STAT5 expression

To analyze whether the decrease in viable cell number of BCR-ABL-expressing TonB cells with reduced target gene expression is due to reduced cell survival, the proportion of apoptotic cells was determined by annexin V staining at day 6 of suspension culture (Figure 4). We did not perform parallel propidium iodide staining because lentivirally transduced TonB cells highly express RFP as indicated in Figure 4. Whereas about 5% of annexin V+ cells were found in IL-3-supplemented cultures independent of reduction of the respective target gene, RNAi against both BCR-ABL and STAT5, but not against SHP2 and Gab2, resulted in a higher proportion of annexin V+ cells (42% and 43% in BCR-ABL as compared to 5%-8%, respectively, in IL3 condition).


Figure 3
View larger version (11K):
[in this window]
[in a new window]
 
Figure 3.. Gab2-dependent inhibition of BCR-ABL-mediated cell proliferation. (A) The histogram of RFP fluorescence from 3 independent TonB-Gab2 shRNA clones is shown with high (black line), medium (light gray line), and low (dark gray line) RFP fluorescence. (B) Cellular lysates from the 3 TonB-Gab2 shRNA clones were subjected to immunoblotting with anti-Gab2 and anti-ERK2 antibodies as loading control as indicated. (C) Number of trypan blue-negative TonB-Gab2 shRNA cells in the presence of IL-3 (left) or doxycycline in the absence of IL-3 (right). Triangles depict cell numbers of a control TonB-GL4 shRNA clone with high RFP expression, which was set to 100% on day 14.

 
Specific inhibition of colony formation of transduced CML progenitors by anti-SHP2, anti-STAT5, and anti-Gab2 shRNAs

To analyze the impact of SHP2, STAT5, and Gab2 on colony formation of normal and CML CD34+ progenitors, purified CD34+ cells were transduced with lentiviruses encoding control or specific shRNAs. To eliminate potential effects of different transduction rates in primary cells on the number of RFP+ colonies, we plated CD34+ cells for each transfection in the presence of optimal or suboptimal concentrations of IL-3 plus GM-CSF. In initial studies we found that colony formation of CD34+ CML cells in early chronic phase is inhibited by both reduction in cytokine stimulation and increase of imatinib concentration although there are some differences between individual CML samples (data not shown). These data indicate that colony formation of CML progenitor cells depends on signaling from both the oncoprotein and cytokine receptors. Therefore, the ratio of transduced, that is, RFP+ colonies under different cytokine stimulation indicates the functional relevance of the respective RNAi-target for CFU colony formation of normal and CML cells, respectively (Table 1).


View this table:
[in this window]
[in a new window]
 
Table 1.. Effects of lentivirally encoded shRNAs on colony formation of CML CD34+ cells and normal CD34+ cells

 


Figure 4
View larger version (33K):
[in this window]
[in a new window]
 
Figure 4.. Effects of different cell culture conditions on TonB cells with reduced target gene expression. Lentivirally transduced RFP+ TonB cells were stained for annexin V expression either in the presence of IL-3 (left) or in the presence of doxycycline to induce BCR-ABL and in the absence of IL-3 (right) after 6 days. Dot blots show RFP fluorescence on the y-axis and annexin V-FITC staining on the x-axis.

 
As expected, both control shRNAs had no effect on the ratio of transduced RFP+ colonies from CML or normal CFUs under reduced cytokine stimulation (Table 1). In contrast, anti-BCR-ABL shRNA reduced colony formation of transduced CMLs but not normal CFUs under low cytokine stimulation. All 3 anti-SHP2 as well as the anti-STAT5 and anti-Gab2 shRNAs tested reduced the ratio of transduced CML-derived colonies to about 35%, 25%, and 57%, respectively. In contrast, all shRNAs tested had no or only weak (STAT5) effects on normal transduced progenitors (Table 1). The results on differential sensitivity of normal and CML CFUs to silencing of SHP2, STAT5, and Gab2 are summarized in Figure 5A. Finally, normal and CML CD34+ cells were grown in cultures containing high and low concentrations of SCF/G-CSF/Tpo, and anti-beta-GMR shRNA against the common beta-chain of the receptors for IL-3, GM-CSF, and IL-5 was used as an additional control in this set of experiments (Figure 5B). Again, anti-SHP2, anti-STAT5, and anti-Gab2 shRNAs specifically inhibit colony formation by CML but not normal CFUs. Furthermore, anti-beta-GMR RNAi had no impact on colony formation of CD34+ cells when cultures were stimulated with cytokines that induce signaling independent of beta-GMR.30 In initial studies individual colonies from 2 CML samples (labeled as A and B) were picked and analyzed for the presence of the BCR-ABL translocation by fluorescence in situ hybridization (FISH). All colonies analyzed were found BCR-ABL+.

Combinatorial RNAi targeting BCR-ABL and SHP2

We next studied the effects of simultaneously silencing 2 target genes as a model for combination treatment of CML cells. We constructed a lentiviral plasmid with 2 H1-shRNA expression cassettes in the {Delta}3'-LTR as schematically shown in Figure 6A. Lentiviral supernatants were generated with titers similar to all lentiviral preparations described. On transduction of K562 cells with lentiviruses expressing either anti-BCR-ABL or anti-SHP2 shRNA alone or both shRNAs from a single vector, the double anti-BCR-ABL plus anti-SHP2 shRNA vector reduced mRNA and protein levels of both target genes with similar efficacy as compared to the respective single shRNA lentiviruses (Figure 6B-C and data not shown). In addition, cell proliferation of transduced K562 cells was inhibited by all 3 viral preparations (Figure 6D).

To analyze combined effects of anti-BCR-ABL and anti-SHP2 shRNAs on CML progenitors, purified CD34+ CML cells were transduced with anti-BCR-ABL and anti-SHP2 shRNA or with lentiviral vectors encoding both shRNAs alone. As shown in Figure 6E, both anti-BCR-ABL and anti-SHP2 shRNA separately reduced the ratio of RFP+ colonies with comparable efficacy as observed before. However, the coexpression of anti-BCR-ABL and anti-SHP2 shRNAs completely blocked colony formation of transduced CML progenitors at suboptimal cytokine concentrations in all 3 samples tested.


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
In CML targeting BCR-ABL tyrosine kinase activity is now well established as an efficient and leukemia-specific therapeutic strategy. Accordingly, second-generation tyrosine kinase inhibitors that provide activity against multiple imatinib-resistant BCR-ABL point mutants have been developed and their function and target specificity are currently under investigation.3-6


Figure 5
View larger version (27K):
[in this window]
[in a new window]
 
Figure 5.. Effects of lentivirus-mediated RNAi on colony-formation of normal and CML CD34+ cells. (A) The diagram shows the relative ratio of RFP+ colonies under low as compared to high cytokine stimulation (IL-3 + GM-CSF) for normal (left) and CML (right) CD34+ progenitor cells. (B) The diagram shows the relative ratio of RFP+ colonies under low as compared to high cytokine stimulation (SCF + G-CSF + TPO) for normal (left) and CML (right) CD34+ progenitor cells as described. The specific RNAi target is indicated on top of each bar. Controls include GL4 and GFP shRNAs.

 
An alternative approach to improve drug therapy for CML may focus on the identification of target molecules other than BCR-ABL itself that are required for proliferation of CML cells. Several individual signaling cascades are activated by BCR-ABL, such as signals linked to Ras, PI3-K/Akt, c-Myc, STAT5, and reactive oxygen species, and their functional relevance has been described using forward and reverse genetics in cell culture and murine stem cell transplantation models (for reviews, see Sattler and Griffin34 and Van Etten35). However, functional analysis of individual signaling molecules in primary normal as well as leukemic cells has not yet been accomplished, mostly because suitable genetic tools were not available.

We here describe the use of lentivirus-mediated RNAi in primary cells to identify potential therapeutic targets in CML. We selected SHP2, STAT5, and Gab2 based on their constitutive tyrosine phosphorylation in BCR-ABL+ cell lines, suggesting some functional role for aberrant signaling. All 3 belong to different functional classes of proteins (tyrosine phosphatase, transcription factor, adaptor protein) and are linked to 2 independent signaling pathways in BCR-ABL+ cells. We generated 3 different anti-SHP2 shRNAs that all gave identical results indicating the specificity of anti-SHP2 RNAi. In contrast, we could only isolate one shRNA each for STAT5 and Gab2, respectively, and we cannot formally exclude any potential off-target effects for these genes. However, we found similar effects both in murine and human cells, and the expression of the related STAT3 and Gab1 genes was not affected by the respective shRNAs.

Our TonB cell model with inducible BCR-ABL expression clearly demonstrates that different cell culture conditions, that is, IL-3- versus BCR-ABL-driven proliferation, strongly affect cellular responses to RNAi against all 3 targets in genetically identical cells. In the context of BCR-ABL expression, cells display a marked but reversible inhibition of proliferation (Figure 2) that may depend on the actual level of protein expression as shown for Gab2 in 3 independent TonB-Gab2 shRNA clones (Figure 3). Interestingly, reduction of BCR-ABL and STAT5 expression reduces cell viability in the absence of IL-3, whereas RNAi against SHP2 and Gab2 had no effect on cell survival at the time point tested in this study. These data are in line with earlier reports describing apoptotic effects of a dominant-negative STAT5 mutant in BaF3 cells,36 but mainly reduction of BCR-ABL-mediated proliferation in Gab2-/- myeloid cells.28 Finally, overexpression and functional relevance of nonmutated SHP2 in adult leukemia including CML has been described in a recent study by Xu et al.20 In view of these data it is important to note that the mechanisms causing enhanced sensitivity to RNAi in BCR-ABL+ cells are most likely different for each target and need to be characterized individually.


Figure 6
View larger version (22K):
[in this window]
[in a new window]
 
Figure 6.. Combinatorial RNAi targeting BCR-ABL and SHP2. (A) Schematic representation of the lentiviral transgene plasmid encoding anti-SHP2 and anti-Bcr-Abl shRNAs. (B) Target mRNA levels were measured by real-time RT-PCR 4 days after lentiviral transduction of K562 cells and normalized in comparison to GAPDH expression. The shRNA encoded by the respective lentivirus is indicated on the top of each bar. (C) Immunoblot of K562 cells transduced with anti-BCR-ABL and an anti-SHP2 plus anti-BCR-ABL shRNA-encoding lentivirus. Cells transduced with control dcH1-GL4-SR (lane 2), dcH1-b3a2_1-SR (lane 3), and b3a2_237SHP2 (lane 4) were lysed 6 days after transduction. Lane 1 shows untransduced K562 cells. The top panel shows an immunoblot with anti-SHP2-specific antibody, and the bottom panel the same membrane reprobed with anti-ERK2 antibodies as loading control. (D) Effects of anti-b3a2, anti-SHP2, and anti-b3a2 plus SHP2 shRNAs on proliferation of K562 cells. Numbers of trypan blue-negative cells are shown after transduction with lentiviruses encoding single (dcH1-GL4-SR, dcH1-b3a2-SR, dcH1-237SHP2-SR) or combined (b3a2-237SHP2) shRNAs as indicated (results from 2 experiments). One milliliter with 104/mL cells was plated, cultures were split and fed twice a week, and calculated cell numbers are indicated. Triangles depict transduction with control virus dcH1-GL4-SR, and circles show transduction with viruses encoding dcH1-b3a2_1-SR, dcH1-237SHP2-SR, and dcH1-b3a2-237SHP2, respectively. (E) Effects of lentivirus-mediated shRNAs on colony formation of CML CD34+ cells. The diagram shows the relative ratio of RFP+ colonies under low as compared to high cytokine stimulation (GM-CSF + IL-3) as in Figure 5.The specific RNAi target is indicated on top of each bar. No RFP+ colonies were found under low cytokine concentration.

 
Very similar to the results seen in the TonB model, primary CML-derived CD34+ colony-forming cells display a higher sensitivity to silencing of SHP2, STAT5, and Gab2 as compared to normal CFUs (Table 1; Figure 5). In our study, we excluded potential effects due to different transduction efficacies by comparing colony formation of transduced and genetically identical CFUs under high and low cytokine stimulation for each sample. Using 2 different cytokine combinations, namely, GM-CSF plus IL-3 and G-CSF plus Tpo plus SCF, we found that primary purified CD34+ CML progenitors are more sensitive to inhibition of gene expression as compared to normal CD34+ CFUs under both conditions tested (Figure 5). Interestingly, data from several BCR-ABL-positive and -negative leukemic cell lines did not reflect the effects of gene silencing observed in normal CD34+ progenitor cells because such cell lines were found to display similar sensitivity to silencing of SHP2, Gab2, and STAT5, respectively (data not shown). Furthermore, anti-SHP2-, anti-Gab2, and anti-STAT5 RNAi inhibits BCR-ABL-driven cell proliferation to a similar extent as leukemia-specific anti-BCR-ABL RNAi.

As described earlier for K562 cells expressing anti-BCR-ABL shRNAs, clonal evolution of lentivirally transduced and shRNA-expressing cells may occur during prolonged periods of cell culture with selection of cells with reduced amounts of gene silencing.12 Interestingly, using our newly developed lentiviral vector capable of expressing 2 different shRNAs, namely, anti-BCR-ABL and anti-SHP2, from a single provirus, we could prevent clonal selection and outgrowth of lentivirally transduced K562 cells (data not shown). In addition, RNAi targeting both BCR-ABL and SHP2 completely blocked colony formation of transduced CML progenitors under low cytokine stimulation, suggesting cooperative effects between silencing of BCR-ABL and SHP2 expression. These data indicate that combined inhibition of target gene expression may indeed be a useful strategy to delay or completely suppress clonal evolution of BCR-ABL+ cells.

In our study, we analyzed colony formation of CD34+ normal and chronic-phase CML progenitor cells in vitro. However, lentiviral transfer of shRNA expression cassettes may provide a strategy to study gene function in more immature cells as well. This could be of some importance because imatinib mesylate seems unable to kill very immature CML progenitor or stem cells.7,37 Identification of CML-specific potential therapeutic targets in such cells may substantially improve drug therapy in CML in the future.

In summary, our data identify SHP2, STAT5, and Gab2 as bona fide candidates for molecularly defined therapeutic approaches in CML. Based on these results, specific small molecules may potentially be developed in the future. However, because signaling molecules usually integrate several upstream signals and may deliver more than one downstream effect by interacting with several signaling components, the identification and specific targeting of individual protein-protein interactions is likely to be required for effective molecularly defined treatment strategies. Alternatively, RNAi itself may be used as a direct therapeutic approach as soon as strategies to trigger stable RNAi in primary cells become available for clinical application. Such options may use either repeated application of RNAi triggers or single-time gene transfer strategies with improved viral vectors in the future. Independent of the potential tool, our data demonstrate that the combined targeting of a leukemia-specific molecule (eg, by imatinib mesylate or anti-BCR-ABL shRNA) and nonspecific molecules (anti-SHP2, anti-STAT5, and anti-Gab2 shRNA) may be highly effective and specific for therapeutic intervention in CML and perhaps other BCR-ABL+ leukemias.


    Acknowledgements
 
We thank T. Hirano (University of Osaka) and B. Neel (Harvard Medical School) for providing us with the human Gab2 and the human SHP2 cDNA, respectively; George Daley (MIT, Cambridge, MA) for providing us with the TonB cell line; and M. Morgan for critical reading of the manuscript.


    Footnotes
 
Submitted August 3, 2005; accepted October 26, 2005.

Prepublished online as Blood First Edition Paper, November 8, 2005; DOI 10.1182/blood-2005-08-3087.

Supported in part by grants of the Deutsche Forschungsgemeinschaft (SFB 566), H. W. & J. Hector-Stiftung, and Wilhelm Sanders-Stiftung.

M.S. and A.C. contributed equally to this work.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Michaela Scherr or Matthias Eder, Medizinische Hochschule Hannover, Zentrum Innere Medizin, Abteilung Hämatologie, Hämostaseologie und Onkologie, Carl-Neuberg Strasse 1, D-30623 Hannover, Germany; e-mail: m.scherr{at}t-online.de or eder.matthias{at}mh-hannover.de.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Druker BJ. Imatinib as a paradigm of targeted therapies. Adv Cancer Res. 2004;91: 1-30.[CrossRef][Medline] [Order article via Infotrieve]

  2. O'Brien SG, Guilhot F, Larson RA, et al. Imatinib compared with interferon and low-dose cytarabine for newly diagnosed chronic-phase chronic myeloid leukemia. N Engl J Med. 2003;348: 994-1004.[Abstract/Free Full Text]

  3. Shah NP, Tran C, Lee FY, Chen P, Norris D, Sawyers CL. Overriding imatinib resistance with a novel ABL kinase inhibitor. Science. 2004;305: 399-401.[Abstract/Free Full Text]

  4. Weisberg E, Manley PW, Breitenstein W, et al. Characterization of AMN107, a selective inhibitor of native and mutant Bcr-Abl. Cancer Cell. 2005;7: 129-141.[CrossRef][Medline] [Order article via Infotrieve]

  5. Gumireddy K, Baker SJ, Cosenza SC, et al. A non-ATP-competitive inhibitor of BCR-ABL overrides imatinib resistance. Proc Natl Acad Sci U S A. 2005;102: 1992-1997.[Abstract/Free Full Text]

  6. Wolff NC, Veach DR, Tong WP, Bornmann WG, Clarkson B, Ilaria RL Jr. PD166326, a novel tyrosine kinase inhibitor, has greater antileukemic activity than imatinib mesylate in a murine model of chronic myeloid leukemia. Blood. 2005;105: 3995-4003.[Abstract/Free Full Text]

  7. Ren R. Mechanisms of BCR-ABL in the pathogenesis of chronic myelogenous leukemia. Nat Rev Cancer. 2005;5: 172-183.[CrossRef][Medline] [Order article via Infotrieve]

  8. Wilda M, Fuchs U, Wossmann W, Borkhardt, A. Killing of leukemic cells with a BCR/ABL fusion gene by RNA interference (RNAi). Oncogene. 2002;21: 5716-5724.[CrossRef][Medline] [Order article via Infotrieve]

  9. Scherr M, Battmer K, Winkler T, Heidenreich O, Ganser A, Eder M. Specific inhibition of Bcr-Abl gene expression by small interfering RNA. Blood. 2003;101: 1566-1569.[Abstract/Free Full Text]

  10. Wohlbold L, van der Kuip H, Miething C, et al. Inhibition of Bcr-Abl gene expression by small interfering RNA sensitizes for imatinib mesylate (STI571). Blood. 2003;102: 2236-2239.[Abstract/Free Full Text]

  11. Li MJ, McMahon R, Snyder DS, Yee JK, Rossi JJ. Specific killing of Ph+ chronic myeloid leukemia cells by a lentiviral vector-delivered anti-bcr/abl small hairpin RNA. Oligonucleotides. 2003;13: 401-409.[CrossRef][Medline] [Order article via Infotrieve]

  12. Scherr M, Battmer K, Schultheis B, Ganser A, Eder M. Stable RNA interference (RNAi) as an option for anti Bcr-Abl therapy. Gene Ther. 2005;1: 12-21.

  13. Neel BG, Guand H, Pao L. The `Shp'ing news: SH2 domain-containing tyrosine phosphatases in cell signaling. Trends Biochem Sci. 2003;28: 284-293.[CrossRef][Medline] [Order article via Infotrieve]

  14. Zhang SQ, Yang W, Kontaridis MI, et al. Shp2 regulates SRC family kinase activity and Ras/Erk activation by controlling Csk recruitment. Mol Cell. 2004;13: 341-355.[CrossRef][Medline] [Order article via Infotrieve]

  15. Zhang SQ, Tsiaras WG, Araki T, et al. Receptor-specific regulation of phosphatidylinositol 3'-kinase activation by the protein tyrosine phosphatase Shp2. Mol Cell Biol. 2002;22: 4062-4072.[Abstract/Free Full Text]

  16. Chan RJ, Johnson SA, Li Y, Yoder MC, Feng GS. A definitive role of Shp-2 tyrosine phosphatase in mediating embryonic stem cell differentiation and hematopoiesis. Blood. 2003;102: 2074-2080.[Abstract/Free Full Text]

  17. Tartaglia M, Mehler EL, Goldberg R, et al. Mutations in PTPN11, encoding the protein tyrosine phosphatase SHP-2, cause Noonan syndrome. Nat Genet. 2001;29: 465-468.[CrossRef][Medline] [Order article via Infotrieve]

  18. Tartaglia M, Niemeyer CM, Fragale A, et al. Somatic mutations in PTPN11 in juvenile myelomonocytic leukemia, myelodysplastic syndromes and acute myeloid leukemia. Nat Genet. 2003;34: 148-150.[CrossRef][Medline] [Order article via Infotrieve]

  19. Bentires-Alj M, Paez JG, David FS, et al. Activating mutations of the Noonan syndrome-associated SHP2/PTPN11 gene in human solid tumors and adult acute myelogenous leukemia. Cancer Res. 2004;64: 8816-8820.[Abstract/Free Full Text]

  20. Xu R, Yu Y, Zheng S, et al. Overexpression of Shp2 tyrosine phosphatase is implicated in leukemogenesis in adult human leukemia. Blood. 2005;106: 3142-3149.[Abstract/Free Full Text]

  21. Levy DE, Darnell JE Jr. Stats: transcriptional control and biological impact. Nat Rev Mol Cell Bio. 2002;3: 651-662.[CrossRef][Medline] [Order article via Infotrieve]

  22. Swameye I, Muller TG, Timmer J, Sandra O, Klingmuller U. Identification of nucleocytoplasmic cycling as a remote sensor in cellular signaling by databased modeling. Proc Natl Acad Sci U S A. 2003;100: 1028-1033.[Abstract/Free Full Text]

  23. Sonoyama J, Matsumura I, Ezoe S, et al. Functional cooperation among Ras, STAT5, and phosphatidylinositol 3-kinase is required for full oncogenic activities of BCR/ABL in K562 cells. J Biol Chem. 2002;277: 8076-8082.[Abstract/Free Full Text]

  24. Huang M, Dorsey JF, Epling-Burnette PK, et al. Inhibition of Bcr-Abl kinase activity by PD180970 blocks constitutive activation of STAT5 and growth of CML cells. Oncogene. 2002;21: 8804-8816.[CrossRef][Medline] [Order article via Infotrieve]

  25. Debierre-Grockiego F. Anti-apoptotic role of STAT5 in haematopoietic cells and in the pathogenesis of malignancies. Apoptosis. 2004;9: 717-728.[CrossRef][Medline] [Order article via Infotrieve]

  26. Fernandez de Mattos S, Essafi A, Soeiro I, et al. FoxO3a and BCR-ABL regulate cyclin D2 transcription through a STAT5/BCL6-dependent mechanism. Mol Cell Biol. 2004;24: 10058-10071.[Abstract/Free Full Text]

  27. Gu H, Pratt JC, Burakoff SJ, Neel BG. Cloning of p97/Gab2, the major SHP2-binding protein in hematopoietic cells, reveals a novel pathway for cytokine-induced gene activation. Mol Cell. 1998;2: 729-740.[CrossRef][Medline] [Order article via Infotrieve]

  28. Sattler M, Mohi MG, Pride YB, et al. Critical role for Gab2 in transformation by BCR/ABL. Cancer Cell. 2002;1: 479-492.[CrossRef][Medline] [Order article via Infotrieve]

  29. Scherr M, Battmer K, Ganser A, Eder M. Modulation of gene expression by lentiviral-mediated delivery of small interfering RNA. Cell Cycle. 2003;2: 251-257.[Medline] [Order article via Infotrieve]

  30. Scherr M, Battmer K, Dallmann I, Ganser A, Eder M. Inhibition of GM-CSF receptor function by stable RNA interference in a NOD/SCID mouse hematopoietic stem cell transplantation model. Oligonucleotides. 2003;13: 353-363.[CrossRef][Medline] [Order article via Infotrieve]

  31. Klucher KM, Lopez DV, Daley GQ. Secondary mutation maintains the transformed state in BaF3 cells with inducible BCR/ABL expression. Blood. 1998;91: 3927-3934.[Abstract/Free Full Text]

  32. Scherr M, Battmer K, Blomer U, et al. Lentiviral gene transfer into peripheral blood-derived CD34+ NOD/SCID-repopulating cells. Blood. 2002;99: 709-712.[Abstract/Free Full Text]

  33. Eder M, Battmer K, Kafert S, Stucki A, Ganser A, Hertenstein B. Monitoring of BCR-ABL expression using real-time RT-PCR in CML after bone marrow or peripheral blood stem cell transplantation. Leukemia. 1999;13: 1383-1389.[CrossRef][Medline] [Order article via Infotrieve]

  34. Sattler M, Griffin JD. Molecular mechanism of transformation by the BCR-ABL oncogene. Semin Hematol. 2003;40: 4-10.[Medline] [Order article via Infotrieve]

  35. Van Etten RA. Studying the pathogenesis of BCR-ABL+ leukemia in mice. Oncogene. 2002;21: 8643-8651.[CrossRef][Medline] [Order article via Infotrieve]

  36. Sillaber C, Gesbert F, Frank DA, Sattler M, Griffin JD. STAT5 activation contributes to growth and viability in Bcr/Abl-transformed cells. Blood. 2000;95: 2118-25.[Abstract/Free Full Text]

  37. Graham SM, Jorgensen HG, Allan E, et al. Primitive, quiescent, Philadelphia-positive stem cells from patients with chronic myeloid leukemia are insensitive to STI571 in vivo. Blood. 2002;99: 319-325.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
A. T. J. Wierenga, E. Vellenga, and J. J. Schuringa
Maximal STAT5-Induced Proliferation and Self-Renewal at Intermediate STAT5 Activity Levels
Mol. Cell. Biol., November 1, 2008; 28(21): 6668 - 6680.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
L. L. Zhou, Y. Zhao, A. Ringrose, D. DeGeer, E. Kennah, A. E.-J. Lin, G. Sheng, X.-J. Li, A. Turhan, and X. Jiang
AHI-1 interacts with BCR-ABL and modulates BCR-ABL transforming activity and imatinib response of CML stem/progenitor cells
J. Exp. Med., October 27, 2008; 205(11): 2657 - 2671.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Sathyanarayana, A. Dev, J. Fang, E. Houde, O. Bogacheva, O. Bogachev, M. Menon, S. Browne, A. Pradeep, C. Emerson, et al.
EPO receptor circuits for primary erythroblast survival
Blood, June 1, 2008; 111(11): 5390 - 5399.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
C. Zhu, S. Lindsey, I. Konieczna, and E. A. Eklund
Constitutive activation of SHP2 protein tyrosine phosphatase inhibits ICSBP-induced transcription of the gene encoding gp91PHOX during myeloid differentiation
J. Leukoc. Biol., March 1, 2008; 83(3): 680 - 691.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Schepers, D. van Gosliga, A. T. J. Wierenga, B. J. L. Eggen, J. J. Schuringa, and E. Vellenga
STAT5 is required for long-term maintenance of normal and leukemic human stem/progenitor cells
Blood, October 15, 2007; 110(8): 2880 - 2888.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Chu, L. Li, H. Singh, and R. Bhatia
BCR-Tyrosine 177 Plays an Essential Role in Ras and Akt Activation and in Human Hematopoietic Progenitor Transformation in Chronic Myelogenous Leukemia
Cancer Res., July 15, 2007; 67(14): 7045 - 7053.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Zhang, E. Diaz-Flores, G. Li, Z. Wang, Z. Kang, E. Haviernikova, S. Rowe, C.-K. Qu, W. Tse, K. M. Shannon, et al.
Abnormal hematopoiesis in Gab2 mutant mice
Blood, July 1, 2007; 110(1): 116 - 124.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Ni, C. Zhao, G.-S. Feng, R. F. Paulson, and P. H. Correll
A Novel Stat3 Binding Motif in Gab2 Mediates Transformation of Primary Hematopoietic Cells by the Stk/Ron Receptor Tyrosine Kinase in Response to Friend Virus Infection
Mol. Cell. Biol., May 15, 2007; 27(10): 3708 - 3715.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Voena, C. Conte, C. Ambrogio, E. Boeri Erba, F. Boccalatte, S. Mohammed, O. N. Jensen, G. Palestro, G. Inghirami, and R. Chiarle
The Tyrosine Phosphatase Shp2 Interacts with NPM-ALK and Regulates Anaplastic Lymphoma Cell Growth and Migration
Cancer Res., May 1, 2007; 67(9): 4278 - 4286.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
R. A. Van Etten
Oncogenic signaling: new insights and controversies from chronic myeloid leukemia
J. Exp. Med., March 19, 2007; 204(3): 461 - 465.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2005-08-3087v1
107/8/3279    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Scherr, M.
Right arrow Articles by Eder, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Scherr, M.
Right arrow Articles by Eder, M.
Related Collections
Right arrow Neoplasia
Right arrow Signal Transduction
Right arrow Gene Expression
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2006 by American Society of Hematology         Online ISSN: 1528-0020