Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 15 November 2006, Vol. 108, No. 10, pp. 3560-3563.
Prepublished online as a Blood First Edition Paper on July 27, 2006; DOI 10.1182/blood-2006-03-010835.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Table and Figures
Right arrow All Versions of this Article:
blood-2006-03-010835v1
108/10/3560    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chapiro, E.
Right arrow Articles by Nguyen-Khac, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chapiro, E.
Right arrow Articles by Nguyen-Khac, F.
Related Collections
Right arrow Neoplasia
Right arrow Oncogenes and Tumor Suppressors
Right arrow Gene Expression
Right arrow Brief Reports
Right arrowRelated Article in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

NEOPLASIA
Brief report

Overexpression of CEBPA resulting from the translocation t(14;19)(q32;q13) of human precursor B acute lymphoblastic leukemia

Elise Chapiro, Lisa Russell, Isabelle Radford-Weiss, Christian Bastard, Michel Lessard, Stephanie Struski, Helene Cave, Sandra Fert-Ferrer, Carole Barin, Odile Maarek, Veronique Della-Valle, Jonathan C. Strefford, Roland Berger, Christine J. Harrison, Olivier A. Bernard, Florence Nguyen-Khac, the Groupe Francophone de Cytogénétique Hématologique

From the Assistance Publique-Hôpitaux de Paris (AP-HP) Service d'Hématologie Biologique, Hôpital Pitié-Salpêtrière, Paris, France; Institut National de la Santé etde la Recherche Médicale (INSERM), E0210, Paris, France; University Paris VI, Paris, France; Leukaemia Research Cytogenetics Group, Cancer Sciences Division, University of Southampton, United Kingdom; University René Descartes, Paris, France; AP-HP, Laboratoire de Cytogénétique, Hôpital Necker-Enfants Malades, Paris, France; Laboratoire de Génétique oncologique, Rouen, France; Laboratoire d'Hématologie, Hôpital Hautepierre, Strasbourg, France; AP-HP, Laboratoire de Biochimie Génétique, Hôpital Robert Debré, Paris, France; Laboratoire de Génétique, Chambéry, France; Laboratoire de Génétique, Tours, France; and AP-HP, Laboratoire d'Hématologie, Hôpital Saint-Louis, Paris, France.


    Abstract
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 Appendix
 References
 
Subtle variation in the expression or function of a small group of transcription factors can drive leukemogenesis. The CEBPA protein is known to regulate the balance between cell proliferation and differentiation during early hematopoietic development and myeloid differentiation. In human myeloid leukemia, CEBPA is frequently inactivated by mutation and indirect and posttranslational mechanisms, in keeping with tumor suppressor properties. We report that CEBPA is activated by juxtaposition to the immunoglobulin gene enhancer upon its rearrangement with the immunoglobulin heavy-chain locus in precursor B-cell acute lymphoblastic leukemia harboring t(14;19)(q32;q13). Overexpression of apparently normal CEBPA RNA or protein was observed in 6 patients. These data indicate that CEBPA may exhibit oncogenic as well as tumor suppressor properties in human leukemogenesis.


    Introduction
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 Appendix
 References
 
The CCAAT/enhancer-binding protein (CEBP) belongs to a subfamily of transcription factors sharing a basic region-leucine zipper (bZIP) motif within their carboxy terminal end. They can homo- and heterodimerize through the bZIP motif. Alternative splicing and multiple translational initiation sites add further complexity to the family picture.1

CEBPA, the founder member of the family, is encoded from a gene composed of a single exon localized to the chromosomal band 19q13. Expression studies and knock-out experiments have demonstrated its essential role in the control of balance between proliferation and differentiation in a range of tissues, including hematopoietic stem cells and different stages of myeloid differentiation.2-4 CEBPA controls the expression of myeloid genes and interacts with many protein partners such as CDK2, CDK4, CDKN1A/p21, E2F, and the SPI1/PU.1 transcription factor. The interaction with E2F is essential for the repression of MYC expression and induction of granulocytic differentiation. Besides the full-length 42-kDa protein, an internal translational initiation site leads to the synthesis of a smaller 30-kDa product. This product fails to inhibit E2F and to down-regulate MYC and acts as a dominant-negative form.5,6

In line with its essential role in myeloid differentiation, inactivation of CEBPA is observed in human myeloid leukemic samples.1 Mutations of CEBPA are observed in about 8% of acute myeloid leukemia (AML). They comprise 2 classes: mutations within the carboxyterminal part of the protein, resulting in the functional inactivation of the transcription factor; and mutations that occur within the 5' part of the gene, allowing the synthesis of only the short, dominant-negative 30-kDa CEBPA protein. The latter situation is also observed in rare constitutive mutations of CEBPA, which are associated with the occurrence of familial AML. Both constitutive and somatic mutations are frequently associated with mutation or loss of the second copy of the CEBPA gene, related to progression of the oncogenic process.7,8

More frequently, CEBPA is indirectly inactivated in AML.1 Patients with t(8;21)(q22;q22) express the RUNX1-ETO fusion protein, which disrupts the positive autoregulation of the CEBPA promoter, suppressing CEBPA protein expression. The RUNX1-MDS1-EVI1 fusion oncoprotein, expressed in patients with t(3;21)(q26;q22), and the CBFB-MYH11 fusion protein, expressed as a result of inv(16)(p13q22), indirectly suppress CEBPA protein expression through translational inhibition of the CEBPA mRNA and loss of CEBPA protein.1 A comparable mechanism is observed in chronic myelogenous leukemia, in which the expression of heterogeneous nuclear RNPE2 (hnRNPE2) is responsible for the translational inhibition of CEBPA in blast crisis. More recently, functional inactivation of the CEBPA protein has been described in association with FLT3 internal tandem duplication.9 Together, these data support a tumor suppressor role for the CEBPA gene in myeloid malignancies.

Chromosomal translocations are frequently observed in hematologic malignancies, representing an important step in the leukemic transformation process. A number of chromosomal translocations, particularly in lymphoid malignancies, result in ectopic or enhanced expression of genes located within the vicinity of the chromosomal breakpoints.10 This leads to overexpression of a protein, usually of normal sequence, although functionally significant mutations have been reported.11

In human precursor-B acute lymphoblastic leukemia (BCP-ALL), translocations involving the immunoglobulin heavy-chain locus (IGH) at chromosomal band 14q32 is a rare but recurrent event. One such translocation, t(14;19)(q32;q13), has been previously described in 6 patients with BCP-ALL, in which the breakpoint on chromosome 19 differs from the t(14;19)(q32;q13) identified in mature B-cell malignancies.12 The Groupe Francophone de Cytogénétique Hématologique (GFCH) has collected 8 additional patients for hematologic, cytogenetic, and molecular studies. Here we report that this translocation involves the CEBPA gene on chromosome 19, resulting in a marked up-regulation of its expression and the production of an apparently normal CEBPA protein.


    Study design
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 Appendix
 References
 
Patient details are shown in Table 1. Samples were obtained after patients provided informed consent in accordance with the Declaration of Helsinki. Fluorescence in situ hybridization (FISH) analysis was performed as previously described,13 using either bacterial artificial chromosomes (BACs) or commercially available IGH probes (LSI IGH; Abbott Diagnostics, Rungis, France).14 Immunologic, molecular, and quantitative polymerase chain reaction (PCR) analyses were performed as previously described.15,16 The fusion CEBPA-Cmu transcript was amplified using standard reverse transcription (RT)-PCR techniques with the primers CEBPA3 (AGGGGTGGAAACATAGGGACTT) and C1 (CCAACGGCCACGCTGCTC).


View this table:
[in this window]
[in a new window]
 
Table 1.. Hematologic, individual, and cytogenetic data of patients with t(14;19)(q32;q13)

 

    Results and discussion
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 Appendix
 References
 
Conventional chromosomal analysis identified 8 patients with t(14;19)(q32;q13). Apart from 1 child, the patients were adults (median, 38 years; range, 22-76 years) with ALL, ranging from pro-B to pre-B immunophenotype. Myeloid markers tested were essentially negative (Table S1, available at the Blood website; see the Supplemental Materials link at the top of the online article). Data from the Leukaemia Research Acute Leukemia Cytogenetics Database has shown an incidence of less than 0.5% and approximately 2% for this translocation in B-lineage childhood and adult ALL, respectively. The involvement of the IGH locus was confirmed by FISH (data not shown). Extensive FISH mapping identified a single BAC (RP11-270I13) containing sequences that encompassed the breakpoint within 19q13. Figure 1A shows a representative image from patient P5, which was similar in all 8 patients. No material was available for further study of patients P7 and P8. The clustering of the chromosome 19 breakpoints within the sequences covered by a single BAC indicated the recurrent targeting of an individual gene.

To investigate the potential partner gene, we evaluated the expression by quantitative PCR of 4 genes located in this region of chromosome 19: LRP3, CEBPA, CEBPG, and PEPD. The expression levels were normalized against ABL and compared with the human cell line U937. The candidate oncogene was CEBPA. Its level of expression was at least 2.5 times higher in t(14;19) than control BCP-ALL samples, with a number of t(14;19) patients expressing extremely high levels of CEBPA mRNA (Figure 1B; Figure S2 for the 3 other genes).

Recent data17 have indicated that the t(14;19) translocation breakpoint may be located within the 3' untranslated region (UTR) of CEBPA, suggesting a fusion transcript between CEBPA and the IGH constant region. RT-PCR analysis of 6 patients (P1 to P6) with primers from Cmu and CEBPA allowed specific amplification of material from patients P1 and P2 only. Direct sequencing demonstrated the fusion of Cmu-JH to the 3' UTR of CEBPA, establishing unequivocally that CEBPA was the gene involved in the t(14;19) (Figure 1C).


Figure 1
View larger version (31K):
[in this window]
[in a new window]
 
Figure 1.. The CEBPA gene is targeted by the t(14;19) translocation. (A) A representative FISH image of the t(14;19)(q32;q13) in patient P5. The RP11-270I13 probe produces a red signal on the normal chromosome 19 and a split signal between der(14) and der(19). A green signal from the IGH constant region-specific probe14 identifies chromosomes 14 and der(14). Images were visualized under a Leica DM RXA microscope equipped with a fluorescence epi-illumination 100x/130-0.60 oil-immersion objective lens (Leica, Rueil-Malmaison, France). Leica QFISH software was used to digitally acquire images after capturing them with a Photometrics Sensys camera (Roper Scientific, Evry, France). (B) Quantitative RT-PCR analysis of CEBPA expression in t(14;19) patients (P1-P6), 3 control patients with BCP-ALL and the human cell lines U937 (AML) and HEP3B (hepatocellular carcinoma) using gene expression assay no. Hs.00263372_s1 (Applied Biosystems, Foster City, CA). Data are presented as percentage of ABL expression. Note that for patient 1 the bar graph is not drawn to scale: the real value is 6672%. Comparable results were obtained when the GUS gene was used as a reference. Because CEBPA is composed of a single exon, control experiments were performed with omission of the reverse transcriptase from the reaction. The observed Ct values in control experiments were always several cycles higher than in the test experiments. Quantitative RT-PCR analyses of the neighboring genes (CEBPG, PEPD, and LPR3) are shown in Figure S1. P1-P6 indicates t(14;19) samples; T1-T3, control BCP-ALL samples without a chromosome 19 abnormality. (C) Nucleotide sequence alignments of fusion CEBPA-Cmu transcripts isolated from patients P1 and P2: chromosome 19 sequences are indicated in uppercase; chromosome 14 sequences, lowercase. The JH segment is underlined on the germline chromosome 14 sequences and was identified as JH4 for P1 and JH6 for P2. The first exon of IGH constant (Cmu) gene is indicated in bold. Nucleotides underlined in P2 sequences differ from the genomic germline sequences used for comparison. (D) Western blot analyses of 200 µg protein extracted from blast cells of patients P2, P5, and P6. Proteins were separated on a 12% denaturating acrylamide gel, and transferred onto a nylon membrane. Proteins were detected using a goat anti-CEBPA immuneserum (sc 9314; Santa Cruz Biotechnology, Santa Cruz, CA). U937 and MOLT-4 (T-ALL cell line) extracts were used as positive and negative controls, respectively. Arrows indicate the p42 and p30 CEBPA protein species.

 
To confirm the expression of CEBPA at the protein level, whole-cell extracts were analyzed by Western blotting. The CEBPA protein was present as the 2 usual species, p42 and p30, of similar size to the U937 positive control (Figure 1D; Figure S3). Thus, apparently normal CEBPA proteins are expressed in patients with t(14;19). This was expected, as no mutation of the CEBPA gene was observed in patients (data not shown).

Our results indicate that CEBPA may act as an oncogene in lymphoid malignancies, in contrast to its role as a tumor suppressor in myeloid leukemia. A preliminary report has indicated that additional members of the CEBP family are involved in translocations with IGH in BCP-ALL, which may also exhibit oncogenic properties.17 Interestingly, our patients with CEBPA overexpression did not express myeloid markers, such as CD13 or myeloperoxidase (MPO), suggesting that only a subset of the known CEBPA target genes, mainly defined in a myeloid context, would be activated in a lymphoid context. Their identification would be of great interest. Another possibility is that CEBPA exerts its effect through its interaction with other transcription factors, thereby deregulating a different set of genes. This example from CEBPA strongly supports the emerging paradigm that both an increase or decrease in gene dosage may contribute to the pathogenesis of leukemia.4


    Appendix
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 Appendix
 References
 
Members of the Groupe Francophone de Cytogénétique Hématologique are as follows (unless otherwise indicated, institutions are located in France): Joris Andrieux, Laboratoire de Génétique Médicale, Hôpital Jeanne de Flandre, Lille; Nathalie Auger, Laboratoire de Cytogénétique, Département de biologie et de pathologie médicales, Institut Gustave Roussy, Villejuif; Hervé Avet-Loiseau, Laboratoire de Cytogénétique Hématologique, Plateau technique, Hôtel Dieu, Nantes; Laurence Baranger, Laboratoire de Génétique, Centre Hospitalier Regional Universitaire, Angers; Carole Barin, Unité de Génétique, Centre Hospitalier Universitaire Bretonneau, Tours; Christian Bastard, Département de Génétique, Centre Henri Becquerel, Rouen; Martine Becker, Service de Cytogénétique, Laboratoire Mérieux, Lyon; Laurence Benattar, Service de Biologie du Développement, Hôpital Robert Debré, Paris; Roland Berger, Institut National de la Santé et de la Recherche Médicale (INSERM) EMI 02 10, Tour Pasteur Hôpital Necker, Paris;Alain Bernheim, Laboratoire de Génomique Cellulaire des Cancers, Unité mixte de recherche (UMR) Centre National de la Recherche Scientifique (CNRS) 8125, Institut Gustave Roussy, Villejuif; Chrystèle Bilhou-Nabera, Laboratoire de Cytogénétique, Service d'Hématologie, Hôpital Bicêtre, Le Kremlin-Bicêtre; Marc De Braekeleer, Laboratoire de Cytogénétique, Faculté de Médecine et des Sciences de la Santé, Brest; Françoise Brizard, Laboratoire d'Hématologie, CHR la Milétrie, Poitiers; Christine Cabrol, Laboratoire de Cytogénétique Hématologie, Hôpital Cantonal Universitaire, Geneva, Switzerland; Evelyne Callet-Bauchu, Laboratoire Central d'Hématologie, Centre Hospitalier Lyon Sud, Pierre Benite; Hélène Cannoni, Laboratoire de Cytogénétique Oncologique, Hôpital Timone Enfants, Marseille; Elise Chapiro, Laboratoire de Cytogénétique Hématologique, Groupe Hospitalier Pitié-Salpétrière, Paris; Jean Chiesa, Laboratoire de Cytogénétique Oncologique et Prénatale, Hôpital Gaston Doumergues, Nîmes; Marie-Agnès Collonge-Rame, Service de Génétique-Histologie, Biologie de la Reproduction, Besançon; Pascale Cornillet-Lefebvre, Laboratoire Central d'Hématologie, Hôpital Robert Debré, Reims; Nicole Dastugue, Génétique des Hémopathies, Pav. Lefebvre, Hôpital Purpan, Toulouse; Agnès Daudignon, Département d'Hématologie-Immunologie-Cytogénétique, Centre hospitalier de Valenciennes; François Desangles, Laboratoire de Cytogénétique, Service de Biologie Clinique, Hôpital (HIA) Val de Grâce, Paris; Virginie Eclache-Saudreau, Laboratoire d'hématologie, Hôpital Avicenne, Bobigny; Sandra Fert-Ferrer, Laboratoire de Biologie Médicale, Centre Hospitalier, Chamberry; Carine Gervais, Laboratoire d'Hématologie Cellulaire et de Cytogénétique Onco-Hématologique, Centre Hospitalier Universitaire (CHU) de Haute Pierre, Strasbourg; Michel Giollant, Laboratoire de Cytogénétique, Faculté de Médecine Clermont-Ferrand; Carlos Graux, Cliniques Universitaires St-Luc, Centre de Génétique, Secteur Hématologique, Brussels, Belgium; Marie-José Gregoire, Laboratoire de Génétique, CHU de Nancy-Brabois, Vandoeuvre-Les-Nancy; Anne Hagemeijer, Center of Human Genetics, Leuven, Belgium; Pierre Heimann, Service de Génétique Médicale-Bâtiment C, IRIBHM, Hôpital Universitaire Erasme, Brussels, Belgium; Christian Herens, Université de Liège, Tour de Pathologie, Liège; Catherine Henry, Laboratoire de Cytogénétique, CHU Pontchaillou, Rennes; Jean-Loup Huret, Génétique, Département d'Information Médicale, CHR la Milétrie, Poitiers; Eric Jeandidier, Service de Génétique, Mulhouse; Philippe Jonveaux, Laboratoire de Génétique, CHU de Nancy-Brabois, Vandoeuvre-Les-Nancy; Martine Jotterand, Service de GénétiqueMédicale, Unité de Cytogénétique du Cancer, Centre Hospitalier Universitaire Vaudois, Lausanne, Switzerland; Marina Lafage-Pochitaloff, Laboratoire de Cytogénétique Hématologique et Moléculaire, Departement de Biopathologie, Institut Paoli Calmettes, Marseille; Jean-Luc Lai, Laboratoire de Génétique Médicale, Hôpital Jeanne de Flandre, Lille; Christine Lefebvre, Laboratoire de Génétique Onco-Hématologique, CHU Grenoble; Franseza Le Mee, Laboratoire de Génétique et Biologie Cellulaire, CHRU Pontchaillon, Rennes; Dominique Leroux, Laboratoire de Génétique Onco-Hématologique, CHU Grenoble; Michel Lessard, Laboratoire d'Hématologie, Hôpital Haute Pierre, Strasbourg; James Lespinasse, Laboratoire de Génétique Chromosomique, Chamberry; Eric Lippert, Laboratoire d'Hématologie, Cytogénétique, Hôpital Haut-Lévêque, Pessac; Isabelle Luquet, Laboratoire Central d'Hématologie, Hôpital Robert Debré, Reims; Odile Maarek, Laboratoire Central d'Hématologie, Hôpital Saint-Louis, Paris; Lucienne Michaux, Jeanne-Marie Libouton, Geneviève Ameye, Centre de génétique (UCL), Brussels, Belgium; Hossain Mossafa, Laboratoire Pasteur-CERBA, Département de Génétique Humaine, Val d'Oise; Marie-Joelle Mozziconacci, Laboratoire de Cytogénétique, Hématologique et Moléculaire, Departement de Biopathologie, Institut Paoli Calmettes, Marseilles; Dominique Muehlematter, Unité de cytogénétique du cancer, Service de génétique médicale, Centre Hospitalier Universitaire Vaudois, Lausanne, Switzerland; Francine Mugneret, Laboratoire de Cytogénétique, Laboratoire de Cytogénétique, CHU Le Bocage, Dijon; Nathalie Nadal, Laboratoire d'hématologie - Pavillon de Biologie (niveau 1), CHU Hôpital Nord, St Etienne; Florence Nguyen-Khac, Service d'Hématologie Biologique, Pr Merle-Beral, Pav Laveran, Groupe Hospitalier Pitié-Salpétrière, Paris; Marie-Pierre Pages, Laboratire d'Hématologie et de Cytogénétique-Hôpital Debrousse, Lyon; Dominique Penther, Laboratoire de Génétique Oncologique, centre de lutte contre le cancer Henri Becquerel, Rouen; Bernard Perissel, Laboratoire de Cytogénétique, Faculté de Médecine, Clermont-Ferrand; Christine Perot, Laboratoire de Cytogénétique, Hôpital Saint Antoine, Paris; Ghislaine Plessis, Laboratoire de Cytogénétique Postnatal, CHU Clémenceau, Caen; Hélène Poirel, Cliniques Universitaires St-Luc, Centre de Génétique, Secteur Hématologie, Brussels, Belgium; Bruce Poppe, Center for Medical Genetics, Ghent University Hospital, Ghent, Belgium; Benoît Quilichini, Laboratoire de Cytogénétique, CHU La Timone, Marseille; Katrina Rack, Institut de Pathologie et de Génétique, Gerpinnes, Belgium; Isabelle Radford-Weiss, Laboratoire de Cytogénétique, Hôpital Necker-Enfants Malades, Paris; Sylvie Ramond, Laboratoire de Cytogénétique, Service d'Hématologie Biologique, Hôtel Dieu de Paris; Jean-Philippe Rault, Laboratoire de Biologie, Hôpital Legouest, Metz; Sophie Raynaud, Laboratoire de Génétique (niveau 3), Hôpital de l'Archet, Nice; Aline Receveur, Laboratoire de Cytogénétique, Amiens, Paris; Serge Romana, Service de Génétique et Cytogénétique, Hôpital Necker-Enfants Malades, Paris; Annick Rossi, CRTS, Bois Guillaume; Michèle Schoenwald, Service d'Oncologie Médicale, Centre Hospitalier Régional Orléans La Source, Orléans; Frank Speleman, Center for Medical Genetics, Ghent University Hospital, Ghent, Belgium; Claude Stoll, Laboratoire de Génétique Médicale, Faculté de Médecine, Strasbourg; Stéphanie Struski, Laboratoire d'Hématologie, Hôpital de Haute Pierre, Strasbourg; Pascaline Talmant, Laboratoire de Cytogénétique Hématologique, Plateau technique, Hôtel Dieu, Nantes; Sylvie Taviaux, Laboratoire de Génétique Moléculaire et Chromosomique, Hôpital Arnaud de Villeneuve, Montpellier; Christine Terré, Laboratoire de Cytogénétique, Centre de Transfusion Sanguine, Le Chesnay; Isabelle Tigaud, Laboratoire de Cytogénétique, Centre Hospitalier Lyon Sud, Pierre Benite; Jacqueline Van DenAkker, Laboratoire de Cytogénétique, Hôpital SaintAntoine, Paris; Michel Vekemans, Service de Génétique, Hôpital Necker-Enfants Malades, Paris; Christine Verellen, Centre de génétique UCL, Brussels, Belgium; and Franck Viguie, Laboratoire de Cytogénétique, Service d'Hématologie Biologique, Hôtel Dieu de Paris.


    Acknowledgements
 
We thank Xin-Ying Su, Maryvonne Busson, and Martine Falda-Buscaiot for valuable help, and Estelle Duprez and Claude Preudhomme for scientific discussion.


    Footnotes
 
Submitted March 21, 2006; accepted May 22, 2006.

Prepublished online as Blood First Edition Paper, July 27, 2006; DOI 10.1182/blood-2006-03-010835.

A complete list of the members of the Groupe Francophone de Cytogénétique Hématologique appears in "Appendix."

Supported in part by INSERM, Leukaemia Research UK, and the Ligue Nationale Contre le Cancer-Comité de Paris (équipe labellisée).

The authors declare no competing financial interests.

E.C. and L.R. performed research and analyzed data; V.D.-V. and J.C.S. performed research; I.R.-W. performed research and provided vital reagents; C. Bastard, M.L., S.S., H.C., S.F.-F., C. Barin, and O.M. provided vital reagents; R.B., C.J.H., and O.A.B. analyzed the data and revised the manuscript; and F.N.-K. designed research, analyzed data, and wrote the paper.

E.C. and L.R. contributed equally to this work.

An Inside Blood analysis of this article appears at the front of this issue.

The online version of this article contains a data supplement.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 USC section 1734.

Reprints: Florence Nguyen-Khac, Service d'Hématologie Biologique, Groupe Hospitalier Pitié-Salpêtrière, 47-83 Bd de l'Hôpital, 75013 Paris, France; e-mail: florence.nguyen{at}psl.aphp.fr.


    References
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 Appendix
 References
 

  1. Mueller BU, Pabst T. C/EBPalpha and the pathophysiology of acute myeloid leukemia. Curr Opin Hematol. 2006;13: 7-14.[Medline] [Order article via Infotrieve]

  2. Halmos B, Huettner CS, Kocher O, Ferenczi K, Karp DD, Tenen DG. Down-regulation and antiproliferative role of C/EBPalpha in lung cancer. Cancer Res. 2002;62: 528-534.[Abstract/Free Full Text]

  3. Zhang P, Iwasaki-Arai J, Iwasaki H, et al. Enhancement of hematopoietic stem cell repopulating capacity and self-renewal in the absence of the transcription factor C/EBP alpha. Immunity. 2004;21: 853-863.[CrossRef][Medline] [Order article via Infotrieve]

  4. Rosenbauer F, Koschmieder S, Steidl U, Tenen DG. Effect of transcription-factor concentrations on leukemic stem cells. Blood. 2005;106: 1519-1524.[Abstract/Free Full Text]

  5. Cleaves R, Wang QF, Friedman AD. C/EBPalphap30, a myeloid leukemia oncoprotein, limits G-CSF receptor expression but not terminal granulopoiesis via site-selective inhibition of C/EBP DNA binding. Oncogene. 2004;23: 716-725.[CrossRef][Medline] [Order article via Infotrieve]

  6. Pabst T, Mueller BU, Zhang P, et al. Dominant-negative mutations of CEBPA, encoding CCAAT/enhancer binding protein-alpha (C/EBPalpha), in acute myeloid leukemia. Nat Genet. 2001;27: 263-270.[CrossRef][Medline] [Order article via Infotrieve]

  7. Leroy H, Roumier C, Huyghe P, Biggio V, Fenaux P, Preudhomme C. CEBPA point mutations in hematological malignancies. Leukemia. 2005;19: 329-334.[CrossRef][Medline] [Order article via Infotrieve]

  8. Fitzgibbon J, Smith LL, Raghavan M, et al. Association between acquired uniparental disomy and homozygous gene mutation in acute myeloid leukemias. Cancer Res. 2005;65: 9152-9154.[Abstract/Free Full Text]

  9. Radomska HS, Basseres DS, Zheng R, et al. Block of C/EBPalpha function by phosphorylation in acute myeloid leukemia with FLT3 activating mutations. J Exp Med. 2006;203: 371-381.[Abstract/Free Full Text]

  10. Willis TG, Dyer MJ. The role of immunoglobulin translocations in the pathogenesis of B-cell malignancies. Blood. 2000;96: 808-822.[Free Full Text]

  11. Berns A. Cancer: two in one. Nature. 2005;436: 787-789.[CrossRef][Medline] [Order article via Infotrieve]

  12. Robinson HM, Taylor KE, Jalali GR, Cheung KL, Harrison CJ, Moorman AV. t(14;19)(q32;q13): a recurrent translocation in B-cell precursor acute lymphoblastic leukemia. Genes Chromosomes Cancer. 2004;39: 88-92.[CrossRef][Medline] [Order article via Infotrieve]

  13. Romana SP, Cherif D, Le Coniat M, Derre J, Flexor MA, Berger R. In situ hybridization to interphase nuclei in acute leukemia. Genes Chromosomes Cancer. 1993;8: 98-103.[Medline] [Order article via Infotrieve]

  14. Avet-Loiseau H, Garand R, Gaillard F, et al. Detection of t(11;14) using interphase molecular cytogenetics in mantle cell lymphoma and atypical chronic lymphocytic leukemia. Genes Chromosomes Cancer. 1998;23: 175-182.[CrossRef][Medline] [Order article via Infotrieve]

  15. Su XY, Busson M, Della Valle V, et al. Various types of rearrangements target TLX3 locus in T-cell acute lymphoblastic leukemia. Genes Chromosomes Cancer. 2004;41: 243-249.[CrossRef][Medline] [Order article via Infotrieve]

  16. Beillard E, Pallisgaard N, van der Velden VH, et al. Evaluation of candidate control genes for diagnosis and residual disease detection in leukemic patients using "real-time" quantitative reverse-transcriptase polymerase chain reaction (RQ-PCR)—a Europe Against Cancer Program. Leukemia. 2003;17: 2474-2486.[CrossRef][Medline] [Order article via Infotrieve]

  17. Dyer MJS, Akasaka T, Balasas T, et al. Involvement of the CEBP gene family in four IGH{alpha} chromosomal translocations in B-cell precursor acute lymphoblastic leukemia (BCP-ALL) [abstract]. Blood. 2005;106: 2842a.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?

Related Article in Blood Online:

CEBPA dosage in leukemogenesis
Thomas Mercher and D. Gary Gilliland
Blood 2006 108: 3234. [Full Text] [PDF]



This article has been cited by other articles:


Home page
BloodHome page
I. H. I. M. Hollink, M. M. van den Heuvel-Eibrink, and C. M. Zwaan
CEBPA resembles Roman god Janus
Blood, June 25, 2009; 113(26): 6501 - 6502.
[Full Text] [PDF]


Home page
JCOHome page
S. Koschmieder, B. Halmos, E. Levantini, and D. G. Tenen
Dysregulation of the C/EBP{alpha} Differentiation Pathway in Human Cancer
J. Clin. Oncol., February 1, 2009; 27(4): 619 - 628.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. J. Russell, T. Akasaka, A. Majid, K.-j. Sugimoto, E. Loraine Karran, I. Nagel, L. Harder, A. Claviez, S. Gesk, A. V. Moorman, et al.
t(6;14)(p22;q32): a new recurrent IGH@ translocation involving ID4 in B-cell precursor acute lymphoblastic leukemia (BCP-ALL)
Blood, January 1, 2008; 111(1): 387 - 391.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. J. Wouters, M. A. Jorda, K. Keeshan, I. Louwers, C. A. J. Erpelinck-Verschueren, D. Tielemans, A. W. Langerak, Y. He, Y. Yashiro-Ohtani, P. Zhang, et al.
Distinct gene expression profiles of acute myeloid/T-lymphoid leukemia with silenced CEBPA and mutations in NOTCH1
Blood, November 15, 2007; 110(10): 3706 - 3714.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Akasaka, T. Balasas, L. J. Russell, K.-j. Sugimoto, A. Majid, R. Walewska, E. L. Karran, D. G. Brown, K. Cain, L. Harder, et al.
Five members of the CEBP transcription factor family are targeted by recurrent IGH translocations in B-cell precursor acute lymphoblastic leukemia (BCP-ALL)
Blood, April 15, 2007; 109(8): 3451 - 3461.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Table and Figures
Right arrow All Versions of this Article:
blood-2006-03-010835v1
108/10/3560    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chapiro, E.
Right arrow Articles by Nguyen-Khac, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chapiro, E.
Right arrow Articles by Nguyen-Khac, F.
Related Collections
Right arrow Neoplasia
Right arrow Oncogenes and Tumor Suppressors
Right arrow Gene Expression
Right arrow Brief Reports
Right arrowRelated Article in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2006 by American Society of Hematology         Online ISSN: 1528-0020