Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 1 December 2006, Vol. 108, No. 12, pp. 3913-3915.
Prepublished online as a Blood First Edition Paper on August 15, 2006; DOI 10.1182/blood-2006-03-008805.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
blood-2006-03-008805v1
108/12/3913    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moliterno, A. R.
Right arrow Articles by Spivak, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moliterno, A. R.
Right arrow Articles by Spivak, J. L.
Related Collections
Right arrow Neoplasia
Right arrow Gene Expression
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

NEOPLASIA
Brief report

Molecular mimicry in the chronic myeloproliferative disorders: reciprocity between quantitative JAK2 V617F and Mpl expression

Alison R. Moliterno, Donna M. Williams, Ophelia Rogers, and Jerry L. Spivak

From the Johns Hopkins University School of Medicine, Baltimore, MD.


    Abstract
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results and discussion
 Authorship
 References
 
An activating JAK2 mutation (JAK2 V617F) is present in the chronic myeloproliferative disorders (MPDs), polycythemia vera (PV), idiopathic myelofibrosis (IMF), and essential thrombocytosis (ET). JAK2 is also a chaperone for Mpl and responsible for its cell-surface expression. We observed a reciprocal relationship between neutrophil JAK2 V617F allele percentage and platelet Mpl expression in JAK2 V617F–positive PV, IMF, and ET patients. However, severely impaired platelet Mpl expression was present in JAK2 V617F–negative MPD patients. While JAK2 V617F allele status did not necessarily correlate with the clinical MPD phenotype, the degree of impaired platelet Mpl expression did. We conclude that multiple molecular abnormalities are involved in the pathogenesis of the MPDs and that aberrant Mpl expression may be a common denominator of aberrant signaling in both the JAK2 V617F–positive and JAK2 V617F–negative MPDs.


    Introduction
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results and discussion
 Authorship
 References
 
Polycythemia vera (PV), idiopathic myelofibrosis (IMF), and essential thrombocytosis (ET) share their origin in a multipotent hematopoietic progenitor cell1; cytogenetic abnormalities of chromosomes 1, 8, 9, 13, and 202; growth factor–independent in vitro hematopoietic colony formation3; and molecular abnormalities, including increased granulocyte PRV-1 mRNA expression,4 impaired megakaryocyte and platelet thrombopoietin receptor (Mpl) expression,5 and the acquisition of JAK2 V617F.6-9 Because JAK2 has important biologic associations with regard to Mpl expression as well as signal transduction,10 we examined the relationship between JAK2 V617F and platelet Mpl expression in PV, IMF, and ET.


    Patients, materials, and methods
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results and discussion
 Authorship
 References
 
The study was approved by our institutional review board and written informed consent was obtained from all patients, in accordance with the Declaration of Helsinki. Diagnoses of PV and ET were based on the Polycythemia Vera Study Group criteria11; the diagnosis of IMF was based on the Italian Consensus Conference.12 Genomic DNA was prepared from density gradient–purified granulocytes using the Puregene Cell kit (Gentra Systems, Minneapolis, MN). RNA was prepared from platelets isolated by differential centrifugation using the RNAeasy kit (Qiagen, Valencia, CA). Complementary DNA was prepared from platelet RNA using the TaqMan Reverse Transcription Reagent kit (Applied Biosystems, Foster City, CA) and random hexamers.

Platelet Mpl densitometry

Platelet lysate (20 µg) was applied to 10% precast gradient gels (Bio-Rad, Hercules, CA), transferred, and immunoblotted with a rabbit polyclonal antiserum to the C-terminal of the Mpl protein and anti–glycoprotein IIB antiserum as described previously.13 Quantitative densitometry was performed using ImageJ software (National Institutes of Health, Bethesda, MD) by a blinded observer; Mpl normalized to IIB was expressed as the percent of 2 averaged controls on each blot. Sixteen secondary erythrocytosis patients defined the normal range, in which the mean was 98% and the range was 52% to 149%. The intra-assay correlation coefficient for replicates was 0.99, and the interassay coefficients of variation for the normal and low controls were 5% and 22%, respectively.

JAK2 V617F determination

Custom TaqMan SNP Genotyping Assays (Applied Biosystems) for JAK V617F with templates from either genomic DNA or cDNA consisting of real-time polymerase chain reaction (PCR) primers flanking the mutant region plus 2 TaqMan MGB real-time PCR probes specific for the normal or mutant sequence (JAK2 genomic assay: forward primer, AAGCTTTCTCACAAGCATTTGGTTT and reverse primer, AGAAAGGCATTAGAAAGCCTGTAGTT; JAK2 cDNA assay: forward primer, AAGCTTTCTCACAAGCATTTGGTTT and reverse primer, CCAAATTTTACAAACTCCTGAACCAGAA; JAK2 genomic assay: probes, VIC-TCTCCACAGACACATAC and FAM-TCCACAGAAACATAC; JAK2 cDNA assay: probes, VIC-CTCCACAGACACATAC and FAM-TCCACAGAAACATAC) were performed on an Applied Biosystems Prism 7700 sequence detection system using the default PCR conditions. DNA mixtures corresponding to V617F allele percentages of 5%, 10%, 25%, 50%, 75%, and 90% were assay reference standards. Intra-assay replicates did not vary more than 5%, and interassay replicates did not vary more than 12%.

Statistical analysis

Statistical calculations were performed using SigmaStat (STSTAT Software, Point Richmond, CA).


    Results and discussion
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results and discussion
 Authorship
 References
 
Our study population consisted of a clinically well-defined group of PV, IMF, and ET patients followed for up to 30 years. In agreement with previous studies, we detected JAK2 V617F in neutrophil genomic DNA in 92% of PV (n = 92), 45% of ET (n = 84), and 42% of IMF (n = 19) patients.6,7,14,15 There were no significant differences in age, disease duration, sex, or degree of splenomegaly between the JAK2 V617F–positive and –negative patients.

The percent of JAK2 alleles that are JAK2 V617F is related both to the extent of dominance of the JAK2 V617F–positive clone16 and also to the clone's JAK2 V617F genotype, which can be heterozygous or homozygous due to a mitotic recombination event.17 Therefore, we measured the percentage of JAK2 V617F alleles in PV, IMF, and ET neutrophils using a quantitative, allele-specific assay sensitive to the presence of 5% JAK2 V617F. We found that the median neutrophil JAK2 V617F allele percentage was greater in PV (67%; range, 35%-100%) than in ET (47%; range, 10%-63%; P < .001), and that allele percentages more than 63% were restricted to PV and IMF, a finding similar to some18 but not all19 studies. When stratified by disease duration, 100% neutrophil JAK2 V617F allele percentages were present in only 15% of PV patients less than 3 years from diagnosis compared with 40% of PV patients 3 to 10 years and 40% of PV patients between 10 and 26 years since diagnosis, although these differences were not significant (Figure 1A).

In PV patients, there was no difference between the median JAK2 V617F percentage in platelet cDNA and neutrophil genomic DNA (65% versus 61%, respectively) (Figure 1B). However, in ET, the median JAK2 V617F percentage was significantly higher in platelet cDNA than in neutrophil genomic DNA (42% versus 22%, respectively; P = .001) (Figure 1B). In 3 of 11 ET patients, JAK2 V617F was not detected in neutrophil genomic DNA but was easily detected in platelet cDNA. The differences in neutrophil JAK2 V617F allele percentage in ET compared with PV and the observation that JAK2 V617F can be detected in platelets only in ET suggest that factors such as the level of stem-cell commitment upon acquisition of JAK2 V617F or the degree of retained polyclonal hematopoiesis are related to differences in clinical phenotypes in JAK2 V617F–positive PV and ET.


Figure 1
View larger version (21K):
[in this window]
[in a new window]
 
Figure 1.. JAK2 VG17F allele percentages in the MPDs. (A) Neutrophil JAK2 V617F allele percentages in the MPDs. Thirty-six ET and 77 PV patients were stratified by neutrophil JAK2 V617F allele percentage and disease duration. Boxes indicate the quartiles of the distribution; medians are indicated by black lines. All of the PV median neutrophil allele percentages were significantly greater than all of the ET median neutrophil allele percentages, regardless of disease duration (P = .008). Within ET or PV, the differences in allele percentages as a function of disease duration were not statistically significant. The JAK2 V617F allele percentage in the 8 IMF patients (median of 100, range of 48-100) could not be compared with the other groups because of the small sample size. (B) JAK2 V617F percentages in PV and ET neutrophils and platelets. Neutrophil genomic DNA and platelet cDNA were isolated simultaneously from blood samples in 23 PV and 13 ET patients. Circles indicate PV samples; triangles, ET. Median neutrophil JAK2 V617F allele percentage in PV (66%, gray bar) was greater than in ET (22%, black bar) (P < .001); median platelet JAK2 V617F allele percentage in PV (65%, gray bar) was greater than in ET (43%, black bar) (P = .002). In PV, the median neutrophil JAK2 V617F allele percentage was not significantly different (ns) from the platelet JAK2 V617F allele percentage, whereas in ET the platelet JAK2 V617F allele percentage was significantly greater than the neutrophil JAK2 V617F allele percentage (P = .001). Lines indicate cases in which JAK2 V617F was detected in platelet cDNA only. Neutrophil cDNA analysis yielded similar results (data not shown).

 


Figure 2
View larger version (19K):
[in this window]
[in a new window]
 
Figure 2.. Quantitative platelet Mpl protein expression in the MPDs stratified by disease and neutrophil JAK2 V617F status. Platelet Mpl protein expression and neutrophil JAK2 V617F allele percentages were determined in 70 PV, 69 ET, and 13 IMF patients. Patients in each disease category are stratified by neutrophil JAK2 V617F allele percentage of more than 95%, between 5% to 95%, and less than 5%. Boxes indicate the quartiles of the distribution; medians are indicated by black lines. Linear regression analysis of neutrophil JAK2 V617F allele percentage and platelet Mpl expression in 101 PV, ET, and IMF patients was significant (P < .001) with a correlation coefficient of –0.390 (inset).

 
JAK2 is the cognate tyrosine kinase of Mpl, and impaired megakaryocyte and platelet Mpl expression have been documented in many laboratories in the myeloproliferative disorders (MPDs).20-22 Therefore, we examined the concordance of impaired platelet Mpl expression with disease phenotype and JAK2 V617F status in 152 MPD patients. Platelet Mpl expression was significantly different among the MPDs, with a median of 55% in ET (range, 1-246; reduced in 43%), 16% in PV (range, 1-227; reduced in 89%; P < .001 with respect to ET), and 5% in IMF patients (range, 1-22; reduced in 100%; P = .076 with respect to PV). In PV, median platelet Mpl expression was lower in patients with only the JAK2 V617F allele compared with patients with both the wild-type and mutant alleles (P = .001) (Figure 2). The median platelet Mpl expression of 98% in JAK2 V617F–negative ET patients was higher than the median of 28% in JAK2 V617F–positive ET patients (P = .001). Linear regression analysis of neutrophil JAK2 V617F allele percentage and platelet Mpl expression in the JAK2 V617F–positive cases demonstrated a significant inverse relationship (r =–0.36, P < .001) (Figure 2). However, while a negative correlation between neutrophil JAK2 V617F allele percentage and platelet Mpl expression existed, the JAK2 V617F allele percentage did not completely account for the variability of platelet Mpl expression. Of importance, the same association of impaired Mpl expression with an MPD phenotype occurred in JAK2 V617F–negative patients. This suggests that the same phenotype may develop as a consequence of different molecular mechanisms.

A previous study did not find a strong association between JAK2 V617F and impaired Mpl expression23; however, the study was limited by a small number of Mpl measurements (n = 25), all of which were in ET patients, and neither neutrophil JAK2 V617F nor platelet Mpl expression was measured quantitatively. Impaired Mpl expression is in part related to defective Mpl processing, which may lead to retention in the Golgi or aberrant localization in the cytoplasm.13 Constitutively activated JAK2 may also reduce Mpl protein expression by causing receptor down-regulation. Indeed, the inverse correlation between neutrophil JAK2 V617F allele percentage and platelet Mpl reduction suggests that these are related abnormalities. Identification of other lesions in Mpl and the JAK signaling pathways in the JAK2 V617F–negative MPDs will further define the significance of aberrant Mpl protein expression to the molecular pathogenesis of the MPDs.


    Authorship
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results and discussion
 Authorship
 References
 
A.R.M. and D.M.W. designed and performed research and wrote the paper; O.R. designed and performed the research; J.L.S. designed the research and wrote the paper.

The authors declare no competing financial interests.


    Acknowledgements
 
We thank Drs Sophie M. Lanzkron and Michael B. Streiff for patient recruitment.

This work was supported by the Myeloproliferative Disorders Foundation and the National Institutes of Health (RO1-HL082995).


    Footnotes
 
Submitted March 9, 2006; accepted July 19, 2006.

Prepublished online as Blood First Edition Paper, August 15, 2006; DOI 10.1182/blood-2006-03-008805.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 USC section 1734.

Correspondence: Alison R. Moliterno, Johns Hopkins University School of Medicine, Ross Research 1025, 720 Rutland Ave, Baltimore, MD 21205; e-mail: amoliter{at}jhmi.edu.


    References
 Top
 Abstract
 Introduction
 Patients, materials, and methods
 Results and discussion
 Authorship
 References
 

  1. Adamson JW, Fialkow PJ, Murphy S, Prchal JF, Steinmann L. Polycythemia vera: stem-cell and probable clonal origin of the disease. N Engl J Med. 1976;295: 913-916.[Abstract]

  2. Najfeld V, Montella L, Scalise A, Fruchtman S. Exploring polycythaemia vera with fluorescence in situ hybridization: additional cryptic 9p is the most frequent abnormality detected. Br J Haematol. 2002;119: 558-566.[CrossRef][Medline] [Order article via Infotrieve]

  3. Prchal JF, Axelrad AA. Bone-marrow responses in polycythemia vera [letter]. N Engl J Med. 1974; 290: 1382.[Medline] [Order article via Infotrieve]

  4. Temerinac S, Klippel S, Strunck E, et al. Cloning of PRV-1, a novel member of the uPAR receptor superfamily, which is overexpressed in polycythemia rubra vera. Blood. 2000;95: 2569-2576.[Abstract/Free Full Text]

  5. Moliterno AR, Hankins WD, Spivak JL. Impaired expression of the thrombopoietin receptor by platelets from patients with polycythemia vera. N Engl J Med. 1998;338: 572-580.[Abstract/Free Full Text]

  6. Baxter EJ, Scott LM, Campbell PJ, et al. Acquired mutation of the tyrosine kinase JAK2 in human myeloproliferative disorders. Lancet. 2005;365: 1054-1061.[Medline] [Order article via Infotrieve]

  7. Levine RL, Wadleigh M, Cools J, et al. Activating mutation in the tyrosine kinase JAK2 in polycythemia vera, essential thrombocythemia, and myeloid metaplasia with myelofibrosis. Cancer Cell. 2005;7: 387-397.[CrossRef][Medline] [Order article via Infotrieve]

  8. James C, Ugo V, Le Couedic JP, et al. A unique clonal JAK2 mutation leading to constitutive signalling causes polycythaemia vera. Nature. 2005; 434: 1144-1148.[CrossRef][Medline] [Order article via Infotrieve]

  9. Kralovics R, Passamonti F, Buser AS, et al. A gain-of-function mutation of JAK2 in myeloproliferative disorders. N Engl J Med. 2005;352: 1779-1790.[Abstract/Free Full Text]

  10. Royer Y, Staerk J, Costuleanu M, Courtoy PJ, Constantinescu SN. Janus kinases affect thrombopoietin receptor cell surface localization and stability. J Biol Chem. 2005;280: 27251-27261.[Abstract/Free Full Text]

  11. Berk PD, Goldberg JD, Donovan PB, et al. Therapeutic recommendations in polycythemia vera based on Polycythemia Vera Study Group protocols. Semin Hematol. 1986;23: 132-143.[Medline] [Order article via Infotrieve]

  12. Barosi G. Myelofibrosis with myeloid metaplasia: diagnostic definition and prognostic classification for clinical studies and treatment guidelines. J Clin Oncol. 1999;17: 2954-2970.[Abstract/Free Full Text]

  13. Moliterno AR, Spivak JL. Posttranslational processing of the thrombopoietin receptor is impaired in polycythemia vera. Blood. 1999;94: 2555-2561.[Abstract/Free Full Text]

  14. Vizmanos JL, Ormazabal C, Larrayoz MJ, Cross NC, Calasanz MJ. JAK2 V617F mutation in classic chronic myeloproliferative diseases: a report on a series of 349 patients. Leukemia. 2006;20: 534-535.[CrossRef][Medline] [Order article via Infotrieve]

  15. Jones AV, Kreil S, Zoi K, et al. Widespread occurrence of the JAK2 V617F mutation in chronic myeloproliferative disorders. Blood. 2005;106: 2162-2168.[Abstract/Free Full Text]

  16. Levine RL, Belisle C, Wadleigh M, et al. X-inactivation based clonality analysis and quantitative JAK2V617F assessment reveals a strong association between clonality and JAK2V617F in PV but not ET/MMM, and identifies a subset of JAK2V617F negative ET and MMM patients with clonal hematopoiesis. Blood. 2006;107: 4139-4141.[Abstract/Free Full Text]

  17. Kralovics R, Guan Y, Prchal JT. Acquired uniparental disomy of chromosome 9p is a frequent stem cell defect in polycythemia vera. Exp Hematol. 2002;30: 229-236.[CrossRef][Medline] [Order article via Infotrieve]

  18. Wolanskyj AP, Lasho TL, Schwager SM, et al. JAK2 mutation in essential thrombocythaemia: clinical associations and long-term prognostic relevance. Br J Haematol. 2005;131: 208-213.[CrossRef][Medline] [Order article via Infotrieve]

  19. Antonioli E, Guglielmelli P, Pancrazzi A, et al. Clinical implications of the JAK2 V617F mutation in essential thrombocythemia. Leukemia. 2005; 19: 1847-1849.[CrossRef][Medline] [Order article via Infotrieve]

  20. Horikawa Y, Matsumura I, Hashimoto K, et al. Markedly reduced expression of platelet c-mpl receptor in essential thrombocythemia. Blood. 1997;90: 4031-4038.[Abstract/Free Full Text]

  21. Tefferi A, Yoon SY, Li CY. Immunohistochemical staining for megakaryocyte c-mpl may complement morphologic distinction between polycythemia vera and secondary erythrocytosis. Blood. 2000;96: 771-772.[Abstract/Free Full Text]

  22. Elliot MA, Yoon SY, Kao P, Li CY, Tefferi A. Simultaneous measurement of serum thrombopoietin and expression of megakaryocyte c-Mpl with clinical and laboratory correlates for myelofibrosis with myeloid metaplasia. Eur J Haematol. 2002; 68: 175-179.[CrossRef][Medline] [Order article via Infotrieve]

  23. Goerttler PS, Steimle C, Marz E, et al. The Jak2V617F mutation, PRV-1 overexpression, and EEC formation define a similar cohort of MPD patients. Blood. 2005;106: 2862-2864.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
R. Tiedt, J. Coers, S. Ziegler, A. Wiestner, H. Hao-Shen, C. Bornmann, J. Schenkel, S. Karakhanova, F. J. de Sauvage, C. W. Jackson, et al.
Pronounced thrombocytosis in transgenic mice expressing reduced levels of Mpl in platelets and terminally differentiated megakaryocytes
Blood, February 19, 2009; 113(8): 1768 - 1777.
[Abstract] [Full Text] [PDF]


Home page
haematolHome page
F. Passamonti and E. Rumi
Clinical relevance of JAK2 (V617F) mutant allele burden
Haematologica, January 1, 2009; 94(1): 7 - 10.
[Full Text] [PDF]


Home page
BloodHome page
J. L. Spivak and R. T. Silver
The revised World Health Organization diagnostic criteria for polycythemia vera, essential thrombocytosis, and primary myelofibrosis: an alternative proposal
Blood, July 15, 2008; 112(2): 231 - 239.
[Full Text] [PDF]


Home page
BloodHome page
R. Tiedt, H. Hao-Shen, M. A. Sobas, R. Looser, S. Dirnhofer, J. Schwaller, and R. C. Skoda
Ratio of mutant JAK2-V617F to wild-type Jak2 determines the MPD phenotypes in transgenic mice
Blood, April 15, 2008; 111(8): 3931 - 3940.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
E. Rumi, F. Passamonti, M. G. Della Porta, C. Elena, L. Arcaini, L. Vanelli, C. Del Curto, D. Pietra, E. Boveri, C. Pascutto, et al.
Familial Chronic Myeloproliferative Disorders: Clinical Phenotype and Evidence of Disease Anticipation
J. Clin. Oncol., December 10, 2007; 25(35): 5630 - 5635.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. L. Spivak
Thrombocytosis, pregnancy, and regression toward mean
Blood, July 15, 2007; 110(2): 472 - 473.
[Full Text] [PDF]


Home page
BloodHome page
F. Passamonti, M. L. Randi, E. Rumi, E. Pungolino, C. Elena, D. Pietra, M. Scapin, L. Arcaini, F. Tezza, R. Moratti, et al.
Increased risk of pregnancy complications in patients with essential thrombocythemia carrying the JAK2 (617V>F) mutation
Blood, July 15, 2007; 110(2): 485 - 489.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
E. Hammond, K. Shaw, B. Carnley, S. P'ng, I. James, and R. Herrmann
Quantitative Determination of JAK2 V617F by TaqMan: An Absolute Measure of Averaged Copies per Cell That May Be Associated with the Different Types of Myeloproliferative Disorders
J. Mol. Diagn., April 1, 2007; 9(2): 242 - 248.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
A. M. Vannucchi and T. Barbui
Thrombocytosis and Thrombosis
Hematology, January 1, 2007; 2007(1): 363 - 370.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
blood-2006-03-008805v1
108/12/3913    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moliterno, A. R.
Right arrow Articles by Spivak, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moliterno, A. R.
Right arrow Articles by Spivak, J. L.
Related Collections
Right arrow Neoplasia
Right arrow Gene Expression
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2006 by American Society of Hematology         Online ISSN: 1528-0020