Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 15 December 2006, Vol. 108, No. 13, pp. 4063-4070.
Prepublished online as a Blood First Edition Paper on August 22, 2006; DOI 10.1182/blood-2006-04-016105.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
blood-2006-04-016105v1
108/13/4063    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tuovinen, H.
Right arrow Articles by Arstila, T. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tuovinen, H.
Right arrow Articles by Arstila, T. P.
Related Collections
Right arrow Immunobiology
Right arrow Signal Transduction
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

IMMUNOBIOLOGY

Most human thymic and peripheral-blood CD4+CD25+ regulatory T cells express 2 T-cell receptors

Heli Tuovinen, Jukka T. Salminen, and T. Petteri Arstila

From the Haartman Institute, Department of Immunology, University of Helsinki, Finland; and Department of Surgery, Hospital for Children and Adolescents, Helsinki University Hospital, Finland.


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Authorship
 References
 
Lack of allelic exclusion in the T-cell receptor (TCR) {alpha} locus gives rise to 2 different TCRs in 10% to 30% of all mature T cells, but the significance of such dual specificity remains controversial. Here we show that human CD4+CD25+ regulatory T (Treg) cells express 2 distinct V{alpha} chains and thus 2 TCRs at least 3 times as often as other T cells. Extrapolating from flow cytometric analysis using V{alpha}2-, V{alpha}12-, and V{alpha}24-specific monoclonal antibodies (mAbs), we estimated that between 50% and 99% of the CD25+ Treg cells were dual specific, as compared with about 20% of their CD25 counterparts. Moreover, both TCRs were equally capable of transmitting signals upon ligation. Cells with 2 TCRs also expressed more FOXP3, the Treg-cell lineage specification factor, than cells with a single TCR. Our findings suggest that expression of 2 TCRs favors differentiation to the Treg-cell lineage in humans and raise the question of the potential functional consequences of dual specificity.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Authorship
 References
 
Regulatory T (Treg) cells are a specialized population capable of suppressing the function of other T cells and preventing autoimmunity. They form a subset of 5% to 10% of CD4+ T cells and were originally characterized on the basis of CD25 expression.1 More recently, it was shown that expression of the forkhead transcription factor FOXP3 is both required and sufficient for the regulatory phenotype, and it thus appears to be the master regulator of the Treg-cell lineage.2-5 The factors inducing FOXP3 expression or the mechanism by which FOXP3 confers the regulatory phenotype are not yet known. Most FOXP3+ Treg cells develop in the thymus, although they can also be induced peripherally from nonregulatory T cells.1,6 In mice, most of the evidence suggests that Treg-cell development is self-antigen driven and the resultant population autoreactive, the Treg-cell precursors somehow avoiding negative selection in the thymus.7-9 A few recent studies have questioned this interpretation, and it is possible that T-cell receptor (TCR) affinity alone is not sufficient to determine commitment to the Treg-cell lineage.2,10,11 It is assumed that human Treg-cell development and function broadly resembles that of murine Treg cells, but compared with the mouse actual data remain scarce.

While studying the up-regulation of FOXP3 in human thymocytes, we obtained data suggesting that a substantial proportion of thymic CD25+ Treg cells might transcribe both TCR {alpha} loci simultaneously. Unlike the TCR beta locus, the {alpha} locus is not subject to allelic exclusion, and recombination proceeds simultaneously in both alleles until the thymocyte is positively selected.12 It was originally reported that up to 30% of mouse or human peripheral-blood T cells may express 2 {alpha} chains,13-15 but several factors are likely to make the actual frequency somewhat lower. Not all secondary {alpha} chain rearrangements detectable on the mRNA level result in a functional protein or turn out to have the ability to pair with the beta chain expressed by the cell.16-18 Also, several studies have shown that cells positively selected through one {alpha}beta TCR can permanently down-regulate the second {alpha} chain in an active process termed phenotypic allelic exclusion.19-22 The true frequency of functional dual specificity thus remains an open question exacerbated by the scarcity of TCR variable gene {alpha} (V{alpha})–specific monoclonal antibodies (mAbs) that would allow direct measurements. The significance of dual-specific T cells is also a matter of some controversy, with much of the attention focusing on their potential autoreactivity.23-25 Studies with TCR transgenic mice have suggested that the presence of another TCR competing for intracellular signaling molecules might increase the threshold of negative selection in the thymus, allowing autoreactive T cells to escape deletion.25 Whether this is also true in a normal, polyclonal repertoire is unknown.

Here we show that most human Treg cells express 2 different surface TCRs, suggesting that in the normal thymus dual specificity may in fact be a way to facilitate the survival of autoreactive Treg cells. Our data also provide the first clear example in which the expression of a secondary TCR has an impact on the behavior and fate of the cell within a normal immune system.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Authorship
 References
 
Samples

Thymic tissue was obtained from otherwise healthy children undergoing cardiac surgery (n = 12; age, 7 days to 7 months). Blood was taken from healthy adult volunteers (n = 12; age, 21 to 37 years). All samples were freshly processed. The study was approved by the ethics committee of the Helsinki University Hospital. Informed consent was obtained from the adult volunteers and the parents of the children in accordance with the Declaration of Helsinki.

Cell isolation and flow cytometry

Thymocytes were released by mechanical homogenization. Peripheral-blood mononuclear cells (PBMCs) were collected with Ficoll-Paque (Amersham, Uppsala, Sweden) gradient centrifugation. Selected subsets were isolated using mAbs and magnetic beads (Dynal, Oslo, Norway) according to the manufacturer's instructions. The bound cells were directly lysed or, when necessary, detached by using DETACHaBEADS (Dynal). The purity of the isolated subsets varied depending on the target population. TCR V{alpha}–selected cells were typically 97% to 100% pure; CD25+ or CD25hi cells, about 80%; CD4+CD8+, more than 90%; and CD4+CD8 thymocytes, about 80% (most contaminating cells being CD4CD8). In 2 experiments in which cells expressing either 1 or 2 V{alpha} chains were isolated for FOXP3 mRNA analysis, the FACSAria instrument (Becton Dickinson, San Jose, CA) was used for flow cytometric cell sorting.

Conjugated mAbs against human CD3, CD4, CD8, CD25, CD45RO, and {alpha}beta TCR were from Becton Dickinson; mAbs against human TCR V{alpha}2 and V{alpha}12 from Pierce (Rockford, IL); and V{alpha}24 from Beckman Coulter (Fullerton, CA). Unlabeled FOXP3 mAb (clone 150D) was a gift from Dr Alison Banham5 (Oxford, United Kingdom), and PE-labeled mAb was purchased from eBioscience (San Diego, CA). Fluorescent second step reagents (Becton Dickinson) were used with the V{alpha}2, V{alpha}24, and FOXP3 mAb. Cell permeabilization for intracellular V{alpha} protein detection was done by using the Fix&Perm kit (Caltag, Burlingame, CA) and for FOXP3 detection by using the FOXP3 permeabilization kit (eBioscience). TCR down-regulation was measured by incubating the cells with V{alpha}-specific mAb for 1 hour at 37°C and analyzing the fluorescence intensity of surface TCR molecules. Flow cytometry was performed with the FACScan instrument (Becton Dickinson).

Because of the extremely low frequency of some of the subsets, we performed several control stainings to exclude the theoretically unlikely possibility that CD4+CD25 and CD4+CD25hi cells would have different levels of nonspecific background staining. The binding of fluorescently labeled nonspecific mouse antibodies and the secondary reagents in the absence of primary mAb was tested. To test the nonspecific binding of the directly conjugated V{alpha}12 mAb, the frequency of V{alpha}12+ CD3 cells was measured. No significant difference between the subsets was observed (Table 1).


View this table:
[in this window]
[in a new window]

 
Table 1.. Frequency of TCR V{alpha}-chain expression on CD4+CD25+ and CD25- lymphocytes

 
Functional assay

CD25hi cells expressing V{alpha}2, V{alpha}12, or both were isolated from buffy coats (Finnish Red Cross, Helsinki, Finland) by immunomagnetic enrichment followed by cell sorting using FACSAria. They were cocultured with peripheral-blood lymphocytes (PBLs) in RPMI with 10% FCS and supplements using platebound anti-CD3 mAb for stimulation. After 5 days half of the culture supernatant was collected and replaced with RPMI containing 3H-thymidine (1 µCi [37 kBq] per well; Amersham). The cells were harvested 6 hours later with a Skatron harvester (Tranby, Norway) and analyzed with a liquid scintillation counter (Wallac, Turku, Finland). IFN-{gamma} levels were determined using an enzyme-linked immunosorbent assay (ELISA) with anti–human IFN-{gamma} mAb (Endogen, Woburn, MA), as described.26


Figure 1
View larger version (15K):
[in this window]
[in a new window]

 
Figure 1.. TCR {alpha} expression in thymocytes. (A) FOXP3 mRNA levels in CD4+CD8+ (DP: {blacksquare}), CD4+CD8CD25 (CD25: {square}), and CD4+CD8CD25+ (CD25+: Figure 1) cells. (B) TCR C{alpha} mRNA levels, normalized against beta-actin and (C) against GAPDH expression. (D) Surface expression of {alpha}beta TCR and intracellular expression of TCR V{alpha}12 chain in CD25 (white profile) and CD25+ (gray profiles) cells. In panels A-C, the mRNA expression levels were determined by quantitative PCR and are shown on a relative scale as mean ± SD. *P < .05, **P < .005, ***P < .001; ns indicates not significant.

 
Quantitative PCR and TCR repertoire analysis

Cells were lysed with Tripure Reagent (Roche, Basel, Switzerland) and RNA collected with RNeasy mini columns (Qiagen, Crawley, United Kingdom). Complementary DNA was synthesized using oligo-dT primers and AMV reverse transcriptase (Finnzymes, Helsinki, Finland). Quantitative polymerase chain reaction (PCR) was done using TaqMan Universal PCR master mix and intron-spanning primer-probe assays (Applied Biosystems, Foster City, CA). The sequences for TCR C{alpha} were GCCTTCAACAACAGCATTATTCCA, CTCGACCAGCTTGACATCACA, and FAM-CAGCCCAGAAAGTTC-5 quencher and, for RAG2, GTGAGCAGCCCCTCTGG, GACTGTTACCATCTGCAGAGACAT, and FAM-CCTTCAGACAAAAATCTAC-5 quencher. The other assays were commercially available from Applied Biosystems (assays-by-demand). The results were normalized against beta-actin, or GAPDH when indicated, and quantified by comparing the results with a standard dilution curve.

TCR repertoire analysis has been described.27,28 Briefly, 24 Vbeta-specific primers (Sigma, St Louis, MO) were used with a TCR beta constant gene (Cbeta)–specific primer to amplify the total beta chain repertoire, followed by a run-off reaction with an internal FAM-labeled Cbeta primer. Similarly, V{alpha}2 or V{alpha}12 primers were used together with a C{alpha} primer and an internal FAM-labeled C{alpha} primer. The fluorescent amplicons were analyzed using an ABI3730 sequencer (Applied Biosystems).

Statistics

Results are shown as mean ± SD. P values were calculated with Student 2-tailed t test, with P values below .05 as the limit for statistical significance. Confidence intervals at the 95% level were calculated for the differences between CD25+ and CD25 cells.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Authorship
 References
 
Human CD4+CD8CD25+ thymocytes express increased levels of TCR C{alpha} mRNA but not TCR proteins

Previous studies have shown that the human CD4+CD8CD25+ (CD25+) thymocytes express FOXP3 and possess regulatory capabilities.29,30 In quantitative PCR analysis, FOXP3 mRNA levels were 2 orders of magnitude higher in the CD25+ cells than in either CD4+CD8CD25 (CD25) or CD4+CD8+ double-positive (DP) cells (Figure 1A). In a further set of experiments we used the TCR C{alpha} gene to normalize the PCR data. We then noted that the CD25+ thymocyte subset consistently expressed more C{alpha} mRNA than the CD25 subset (Figure 1B). The immature DP cells also expressed higher levels of TCR C{alpha} mRNA than the CD25 cells. To make sure that these differences were not caused by variable expression of the beta-actin gene used for normalization, we reanalyzed the samples using GAPDH for reference, with similar results (Figure 1C).

The level of TCR expression in the thymus is highly variable and depends on the developmental stage of the cell type.12 To test whether the higher C{alpha} mRNA levels reflected increased expression of TCR proteins, we used flow cytometry to measure the amount of surface {alpha}beta TCR in individual cells. In contrast to the quantitative PCR results, the highest intensity of TCR staining was found in the CD25 subset (Figure 1D). The CD25+ cells expressed significantly less TCR protein than the CD25 subset (mean fluorescence intensity, 52 ± 6 and 71 ± 5, respectively; P = .002) but more than the DP cells (24 ± 2). However, the antibody we used only reacts with an intact {alpha}beta TCR, so a limiting amount of any component of the TCR/CD3 complex could have restricted the assembly of the TCR. Indeed, it has been reported that human CD25+ thymocytes express less CD3-{epsilon} protein than the CD25 thymocytes.31 We therefore repeated the analysis using a mAb specific for a single TCR V{alpha} chain, V{alpha}12, and permeabilized the cells to allow the detection of intracellular TCR {alpha} protein uncoupled to TCR beta/CD3. Both before and after permeabilization, the mean fluorescence intensities of CD25+ and CD25 cells corresponded to the results obtained with the anti-TCR mAb (Figure 1D). Thus, heterogeneity of TCR expression levels did not explain our findings.

There was also no difference in the recombination activity in the {alpha} loci between the CD25+ and CD25 thymocytes. As a mark of ongoing TCR gene rearrangement, DP cells expressed high levels of RAG-2 mRNA. In contrast, in both CD25+ and CD25 cells the level of RAG-2 was low, with no difference between them (not shown).

CD25+ thymocytes express 2 productively rearranged TCR V{alpha} genes at an increased frequency

The TCR {alpha} locus is not subject to allelic exclusion, and a significant subset of human T cells has been shown to express 2 V{alpha} proteins.14 Several details of the data described under "Human CD4+CD8CD25+ thymocytes express increased levels of TCR C{alpha} mRNA but not TCR proteins" suggested that the CD25+ thymocytes might transcribe both TCR {alpha} loci simultaneously. First, the difference between CD25 and CD25+ cells in C{alpha} mRNA levels was consistently 2-fold. Second, the high C{alpha} mRNA content in the CD25+ population was similar to that of the DP population, which uses both loci while attempting to rearrange a functional {alpha} gene and often expresses 2 TCRs.19-21 Third, the frequency of V{alpha}12+ cells was higher in the CD25+ than in the CD25 subset, as would be expected if the former contained more cells expressing 2 TCRs. This was also true for another V{alpha} gene, V{alpha}2 (Table 1). We therefore analyzed the frequency of cells expressing 2 distinct surface TCRs, a task complicated by the small number of V{alpha} gene-specific mAbs available. We used magnetic beads to isolate CD4+CD8 thymocytes and analyzed by flow cytometry the frequency of CD25+ and CD25 cells expressing both V{alpha}2 and V{alpha}12 chains. These cells with 2 TCRs were significantly more common among the CD25+ than the CD25 thymocytes (Table 1; n = 4). We then isolated thymocytes expressing TCR V{alpha}2. Flow cytometric analysis of the V{alpha}2+ cells showed that the frequency of cells also expressing V{alpha}12 was significantly higher in the CD25+ than in the CD25 population.

Peripheral-blood CD4+CD25hi cells express 2 TCRs at a high frequency

Studies in mice have indicated that surface expression of 2 TCRs is significantly more common in thymocytes than in mature T cells.15,19-21 A crucial question, therefore, was whether the expression of 2 TCRs was retained in mature Treg cells. Quantitative PCR analysis of PBLs showed no significant difference in the TCR C{alpha} mRNA levels between isolated CD4+CD25 and CD4+CD25+ cells (not shown). However, the circulating CD25+ population is heterogeneous, and Treg-cell activity and FOXP3 expression in humans is largely restricted to CD4+ PBLs with a high CD25 expression (hereafter CD25hi cells).5,32 A direct analysis of cells expressing V{alpha}2 and V{alpha}12 simultaneously showed that they were more frequent in the CD25hi subset than in the CD25 subset (Table 1; n = 10). Because the V{alpha}2+V{alpha}12+ population was so small and the analysis easily affected by random variation, we next purified the V{alpha}2+ PBL population. Staining of the isolated cells with the V{alpha}12 mAb revealed a clear difference between CD25hi and CD25 cells (Figure 2). On the average, the frequency of V{alpha}2+ cells also expressing V{alpha}12 was 4 times higher in the CD25hi population than in the CD25 population (Table 1). The third available mAb, specific to V{alpha}24, produced a higher nonspecific background staining than the other 2 mAbs and was therefore not used in these experiments. Also, part of the V{alpha}24+ population belongs to the invariant natural killer T-cell (NKT-cell) subset, although their frequency is usually less than 0.1%.33

The most reliable estimates of the frequency of dual-specific T cells in mice are based on comparing normal mice with mice possessing only one functional TCR {alpha} locus.18 The excess V{alpha} expression in the normal animals will then reveal the fraction of cells expressing 2 {alpha} chains. Although this approach cannot be applied to dual-specific T cells in humans generally, it can be used to compare 2 different T-cell subsets within the same individual. We therefore measured the frequency of TCR V{alpha}2+,V{alpha}12+, and V{alpha}24+ cells in the CD25hi and CD25 subsets. In each case, the frequency of the V{alpha}+ cells was significantly higher in the CD25hi subset (Table 1). These data indicate that, compared with the CD25 cells, the CD25hi population is enriched in cells expressing 2 {alpha} chains.


Figure 2
View larger version (32K):
[in this window]
[in a new window]

 
Figure 2.. Expression of TCR V{alpha}12 in isolated V{alpha}2+ PBLs. (A) V{alpha}2 expression in PBMCs. (B) V{alpha}2 expression after immunomagnetic isolation. (C) Gating of CD25 and CD25hi cells within the V{alpha}2+ population. (D) V{alpha}12 expression in V{alpha}2+CD25 and (E) V{alpha}2+CD25hi cells. In panels A, B, D, and E, the cutoff point between positive and negative cells is indicated. A representative example of 7 donors is shown.

 
PBLs with 2 TCRs express more FOXP3 than PBLs with one TCR

The results described in the preceding sections showed that both in the thymus and peripheral blood the CD4+CD25+ population consists of cells expressing 2 TCRs at a much higher frequency than the CD4+CD25 cells. However, although the CD25hi PBL subset is highly enriched in Treg cells, with 95.7% of them expressing FOXP3,5 we wanted to exclude the possibility that some of the dual-specific CD25hi cells might be activated T cells and not Treg cells. We therefore analyzed the expression of FOXP3, the Treg lineage–determining gene, in cells with 1 or 2 TCRs. We isolated cells expressing both V{alpha}2 and V{alpha}12, regardless of any other cell-surface marker, and compared them with CD4+ cells or cells expressing either V{alpha}2 or V{alpha}12 alone. The cells with 2 surface TCRs expressed significantly more FOXP3 mRNA than the 2 other populations tested (Figure 3A). There was no significant difference between CD4+ cells and cells with a single TCR. These results were confirmed by intracellular staining with anti-FOXP3 mAb, which showed that FOXP3+ cells were significantly more common among cells with 2 TCRs than among cells with a single TCR or the whole CD4+ population (Figure 3B-C). Similarly, among isolated V{alpha}2+ cells, cells also expressing V{alpha}12 were significantly more frequent in the CD4+FOXP3+ subset than in the CD4+FOXP3 subset (1.5 ± 0.5 versus 0.7 ± 0.4, P = .015; Figure 3D). Taken together, our data provide strong evidence that the human CD25hi FOXP3+ Treg-cell population is highly enriched in cells expressing 2 surface TCRs.

V{alpha}2 and V{alpha}12 are representative of the whole repertoire

Because our analysis of the dual-specific Treg cells relied mostly on extrapolation from populations expressing V{alpha}2 or V{alpha}12, representing in our donors 5% to 7% of the whole repertoire, we performed a careful analysis of this subset to show that these V{alpha} chains are typical and representative of the TCR {alpha} repertoire. Flow cytometric analysis of PBLs from 6 donors showed that V{alpha}2+ cells did not have a preference for recognition of either major histocompatibility complex (MHC) class I or class II, with a CD4/CD8 ratio of 1.6, compared with 1.3 in all T cells, while V{alpha}12+ cells favored recognition of MHC I (CD4/CD8 ratio, 0.6; Figure 4A). Within the CD4+ population the frequency and intensity of CD25 expression was similar in V{alpha}12+ and V{alpha}2+ cells to that of cells expressing other V{alpha} genes (Figure 4B). CD45RO, a marker reported to differentiate between regulatory and nonregulatory CD25+ T cells in humans,4 was also expressed at roughly the same frequency by V{alpha}2+,V{alpha}12+, and other CD4+ T cells (Figure 4C). Analysis of FOXP3 mRNA and protein showed comparable levels in all T cells and V{alpha}2+ cells, while V{alpha}12+ cells had a slightly lower level of expression, most likely explainable by the overrepresentation of CD8+ cells among V{alpha}2+ cells (Figure 3D). In isolated CD25hi cells the expression of FOXP3 was identical in V{alpha}2+,V{alpha}12+, and other T cells. Furthermore, when cultured together with other T cells, isolated CD25hi cells expressing V{alpha}2, V{alpha}12, or both suppressed anti-CD3–triggered responses as efficiently as CD25hi cells in general (Figure 4E).

We then analyzed the TCR repertoire of V{alpha}2+ and V{alpha}12+ cells. The TCR {alpha} chain repertoire showed a polyclonal, Gaussian distribution of CDR3 lengths in both V{alpha}2 and V{alpha}12 genes (Figure 4F), similar to that of other V{alpha} chains. We next isolated cells expressing V{alpha}2 or V{alpha}12 and used a panel of 24 Vbeta gene-specific primers to analyze the total TCR beta repertoire used by these subsets. In both populations, the beta chain usage was similar to that of the T-cell population in general, with a mostly polyclonal pattern of CDR3 lengths with occasional clonal expansions and underrepresented rearrangements (Figure 4G). These data show that with the exception of a biased MHC recognition by the V{alpha}12+ subset, the cells expressing V{alpha}2 or V{alpha}12 are indistinguishable from the T-cell population and repertoire in general, and both V{alpha} chains pair freely with beta chains.


Figure 3
View larger version (35K):
[in this window]
[in a new window]

 
Figure 3.. FOXP3 expression in single- and dual-specific peripheral-blood T cells. (A) FOXP3 mRNA and (B) protein levels in CD4+, single V{alpha}+, and V{alpha}2+V{alpha}12+ PBLs (n = 8; mean ± SD). (C) A representative example of intracellular FOXP3 staining in isolated V{alpha}2+ cells also expressing V{alpha}12 (n = 8) and (D) of the frequency of dual-specific V{alpha}12+ cells within the CD4+FOXP3 and CD4+FOXP3+ subsets of isolated Va2+ cells (n = 4). *P < .05, ***P < .001; ns indicates not significant.

 


Figure 4
View larger version (37K):
[in this window]
[in a new window]

 
Figure 4.. Phenotype, regulatory function, and TCR repertoire of V{alpha}2+ and V{alpha}12+ PBMCs. (A) CD4/CD8 ratio and expression of (B) CD25 and (C) CD45RO within the CD4+ subset. (D) Expression of FOXP3 mRNA and protein (TCR {alpha}beta+: Figure 4;V{alpha}2+: {square};V{alpha}12+: {blacksquare}). (E) Suppression of T-cell proliferation and IFN-{gamma} production by CD25hi cells expressing V{alpha}2, V{alpha}12, or both, with total CD25hi cells as a control (nonstimulated PBMCs: {square}; anti-CD3–stimulated PBMCs: {blacksquare}; anti-CD3–stimulated PBMCs cocultured at a ratio of 1:1 with the indicated CD25hi subsets: Figure 4). The cell numbers in the cultures were adjusted to the number of CD25hi V{alpha}2+V{alpha}12+ cells obtained (3000 to 4000). (F) TCR V{alpha}2 and V{alpha}12 repertoire in CD4+ cells. (G) Part of the TCR beta repertoire in isolated V{alpha}2+ and V{alpha}12+ cells. The results in panels D and E are the mean and, in other panels, a representative example of 2 to 4 independent experiments.

 
Most human Treg cells express 2 TCRs

Estimates of the fraction of T cells expressing 2 TCRs are complicated by the limited choice of reagents and the low frequency of the populations actually measured. Because of this we used several approaches to calculate the frequency of CD25hi cells with 2 TCRs, each based on a different set of experimental data. A previously used method18 extrapolates from staining with 2 V{alpha}-specific mAbs: frequency = (A x 100 x 100)/(B x C), where A, B, and C are the frequency of V{alpha}2+V{alpha}12+ cells, V{alpha}2+ cells, and V{alpha}12+ cells, respectively. In our donors, this equation gave 15% as the overall frequency of T cells with 2 TCRs.

As the second approach we compared the frequency of single-specific V{alpha}12+ T cells in the total T-cell population with the frequency of dual-specific V{alpha}12+ T cells within the V{alpha}2+ population: frequency = (A x 100)/(B–B x 0.15), where A is the frequency of V{alpha}12+ cells in the V{alpha}2+ population, B the frequency of V{alpha}12+ cells in the total population, and 15% the frequency of dual-specific cells in the total population.

The measurements based on the excess staining of the CD25hi cells with V{alpha}-specific mAb can also be used to estimate the frequency of CD25hi cells with 2 TCRs: frequency = (A–[B–B x 0.15]) x 100/(B–B x 0.15), where A and B are the frequency of the V{alpha}X gene in the CD25hi and CD25 subsets, respectively, and 15% again the overall frequency of dual-specific cells.

These 3 complementary methods produced reasonably consistent estimates (Table 2). Within the CD25 population, the frequency of cells with 2 TCRs was roughly 20% and thus comparable to T cells in general. A significantly higher fraction of the CD25hi cells was dual specific, the 3 equations producing estimates ranging from 50% to 99%. Although extrapolations and therefore tentative, these calculations strongly suggest that most human CD25hi Treg cells express 2 TCRs.


View this table:
[in this window]
[in a new window]

 
Table 2.. Estimated frequency of CD25hi and CD25- PBMC expressing 2 TCRs

 
Both TCR {alpha} chains on Treg cells are functional

TCRs transmitting signals are rapidly internalized following engagement by a ligand.14,34 To test whether both TCRs on the surface of the dual-specific Treg cells were capable of signal transduction, we used mAb against V{alpha}2 to stimulate the cells for 1 hour at 37°C and then compared the down-regulation of the engaged TCR in V{alpha}2+ single- and V{alpha}2+V{alpha}12+ dual-specific cells. The nonengaged V{alpha}12 was used as a negative control. In cells expressing only V{alpha}2, the mean fluorescence intensity of surface V{alpha}2 decreased to 64% of the original in CD4+ cells and to 65% in the CD4+CD25hi cells, while the intensity of V{alpha}12 remained stable (94% in both cases; Figure 5). The 1-hour incubation also had no measurable effect on the overall level of CD3 expression either in CD4+ cells or in CD25hi cells (not shown). We then measured the down-regulation of V{alpha}2 in cells also expressing V{alpha}12. In dual-specific CD4+ cells, V{alpha}2 intensity decreased to 57% and in CD25hi Treg cells to 60%, indicating that there was no significant difference in TCR down-regulation between single- and dual-specific T cells either in the CD25hi population or in the CD4+ cells in general. Similarly, engagement of V{alpha}12 on CD25hi cells led to its down-regulation in both single-specific and V{alpha}2+V{alpha}12+ cells (to 69% and 60%, respectively), while V{alpha}2 intensity was unaffected (not shown). These results suggest that both TCRs expressed by the dual-specific CD25hi Treg cells are as efficient as TCRs expressed by single-specific T cells in transmitting signals when bound by a ligand.


Figure 5
View larger version (22K):
[in this window]
[in a new window]

 
Figure 5.. TCR down-regulation in cells expressing 1 or 2 V{alpha} chains. The mean fluorescence intensity of TCR V{alpha} expression was measured before and after incubation for 1 hour with an anti-V{alpha}2 mAb. The results are shown as the relative decrease in fluorescence as compared with the original intensity (indicated by the dotted line; V{alpha}2 on V{alpha}2+V{alpha}12 cells: {square};V{alpha}2 on V{alpha}2+V{alpha}12+ cells: Figure 5;V{alpha}12 on V{alpha}2 V{alpha}12+ cells: {blacksquare}). The asterisks above the error bars indicate the statistical significance of the change in fluorescence (ns indicates not significant, **P < .005); the comparison between single- and dual-specific V{alpha}2+ cells is also shown. There was no statistically significant difference between CD25hi and other CD4+ cells (n = 6).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Authorship
 References
 
Despite the well-established fact that many T cells express 2 TCRs, their development and function is in practice viewed in terms of monospecificity, and there have been no reports of dual specificity having an impact on the normal immune system. On theoretical grounds, it has been argued that the second {alpha} chain is often nonfunctional, either because it cannot pair with the beta chain or because the second TCR has not been positively selected and does not recognize self-MHC.15-22 Our data on human Treg cells thus provide the first clear instance in which the presence of a second TCR influences the fate of the dual-specific cell in a nontransgenic setting. The data are based on the surface expression of 2 TCRs and verified by flow cytometry, so the pairing of both {alpha} chains to the beta chain has demonstrably taken place. Upon engagement by mAb, the TCR complexes on dual-specific Treg cells were also internalized quite as efficiently as TCRs on single-specific T cells, suggesting that both receptors were capable of transmitting signals. The antigens recognized by human Treg cells are not yet known, so it cannot be shown directly that both receptors participate in Treg-cell selection or responses. However, the greater part of TCR repertoire is biased for MHC recognition even before selection,35 so it is likely that most of the secondary TCRs have at least the potential to respond to MHC-bound antigens. Furthermore, the fact itself that Treg cells are so greatly enriched in cells expressing 2 TCRs suggests that dual specificity does have an active role in directing cells to the regulatory lineage.

Previous studies on dual-specific T cells, and especially attempts to measure their frequency, have often been criticized for their reliance on the small number of V{alpha}-specific mAbs available. Also, the fact that in many cells the presence of secondary V{alpha} mRNA does not result in surface protein expression15-22 means that mRNA-based approaches to study a wider range of V{alpha} genes are not reliable. Our data, too, address directly only part of the repertoire, ranging from 5% to 7% in different donors, although the measurement of excess V{alpha} expression does provide a more comprehensive view of the secondary {alpha} chains within the CD25hi subset.18 Therefore, the actual frequency of dual-specific cells may be somewhat different from our estimates, but the relative difference between Treg cells and other T cells should not be affected. Furthermore, our detailed analysis of the cells expressing V{alpha}2 or V{alpha}12 showed that they are representative of the TCR {alpha} repertoire in general. Both populations had a normal surface phenotype, including the expression of CD25 and CD45RO, expressed FOXP3 at roughly the same level, contained CD25hi cells with a regulatory function, and possessed a fully polyclonal repertoire of both {alpha} and beta chains. It is therefore highly unlikely that our observations would apply only to the 2 V{alpha} genes studied. Our analysis of the expression of V{alpha}24 also supported our conclusions, the reservations concerning this {alpha} chain notwithstanding. It therefore seems that the Treg-cell population in humans is indeed highly enriched in cells expressing 2 TCRs.

Because random recombination of the second TCR {alpha} locus will produce a functional chain in not more than one third of the cells, the high frequency of 2 productive {alpha} genes in CD25+ Treg cells is likely to be the result of intrathymic selection. A substantial body of evidence indicates that Treg cells are selected by self-antigens and recognize them with a high affinity.1,7-9 It is not known how thymocytes expressing such autoreactive TCRs avoid negative selection, especially because the up-regulation of FoxP3 in itself does not appear to provide protection from deletion.9 It has been postulated that the affinity of Treg-cell TCRs to self-antigens falls just below the threshold of negative selection1 but, opposing this view, it was recently demonstrated that these TCRs are capable of triggering tissue damage if expressed by FoxP3 cells.9 Furthermore, a substantial fraction of the autoreactive effector cells in FoxP3 scurfy mice seems to use TCRs, which in FoxP3+ mice are largely restricted to Treg cells. These results suggest that there is little difference in the TCR affinity between autoreactive FoxP3+ thymocytes that survive and FoxP3 thymocytes that are mostly deleted, again raising the question as to how the autoreactive Treg cells avoid negative selection. The finding that most human Treg cells express 2 {alpha} chains may provide at least part of the solution. Studies in transgenic mice have shown that the intracellular competition of 2 {alpha} chains for pairing with a single beta chain allows the cell to down-modulate the autoreactive TCR, thereby avoiding negative selection, and still to be positively selected through the other TCR.25 Our data suggest a scenario in which a developing thymocyte with an autoreactive TCR is deleted unless saved by the presence of a second {alpha} chain, in which case it is recruited to the Treg-cell lineage and upregulates FOXP3. The real physiologic significance of the lack of allelic exclusion in the {alpha} locus may therefore be to create a selection window for autoreactive Treg cells.

Findings suggesting a role for dual specificity in the development of Treg cells have also been reported from studies on mouse strains transgenic for an autoreactive TCR. In several settings the autoreactive TCR induces more efficient Treg-cell development when placed in a recombination-competent background that allows endogenous TCR rearrangements.36-40 For example, in mice expressing a transgenic TCR specific for myelin basic protein, neither the transgenic TCR+ cells in Rag-deficient mice nor the endogenous TCR+ cells in Rag-sufficient mice were effective Treg cells.40 Only those cells that expressed both an endogenous and the transgenic autoreactive TCR were capable of suppressing the autoimmune encephalitis. In these models, too, the presence of a secondary TCR seems to provide the opportunity for the transgenic TCR to escape deletion and direct the developing thymocyte into the Treg-cell lineage. Nevertheless, in other settings it has been possible to generate Treg cells in TCR transgenic mice in the Rag-deficient background,41-43 and analysis of mice unable to express 2 different V{alpha} chains showed that they have normal Treg cells.44 It is therefore clear that murine Treg cells can develop from monospecific precursors, but in the normal human immune system dual specificity appears to strongly favor differentiation into the Treg-cell lineage.

Does the potential dual specificity influence Treg-cell function? Previous studies on the functional significance of dual-specific T cells have often reached conflicting conclusions. In some settings activation of dual-specific T cells has indeed been associated with autoimmunity,23-25 while in others dual-specific T cells appear to be neutral or even protective.18,45,46 These contradictions may be in large part due to the transgenic models used, which, although convenient, may reveal more of the particular TCRs than of dual-specific T cells in general. In a normal immune system the effect of having 2 TCRs on T-cell function is unknown, and without data on the antigens recognized by human Treg cells, the effect of dual specificity on Treg-cell function must remain speculative. However, one paradox of Treg-cell biology is that their development is dependent on high-affinity interactions with self-antigens in the thymus, but at least some of them can subsequently respond to exogenous antigens in the periphery.47 For example, in mice infected by leishmania, most thymus-derived Treg cells in the lymph nodes draining the infection site are specific to the parasite.48 This apparent conflict between thymic selection and peripheral activation has been explained by crossreactivity, antigen-independent bystander suppression, or peripheral induction of adaptive subsets of Treg cells, but our data suggest a further possibility. Because most Treg cells express 2 TCRs, the secondary repertoire is likely to be as diverse as the positively selected self-reactive repertoire,31 with many potentially useful specificities. Some of the Treg cells regulating responses to exogenous antigens may have been selected through the autoreactive TCR but function in the periphery through the other. In other situations the same cells might be activated through the autoreactive TCR to prevent autoimmunity. In this way dual specificity may increase the range and flexibility of Treg-cell responses.

Despite intensive study, many aspects of Treg-cell commitment and function remain unclear. The dual specificity of this population provides putative answers to some questions but also raises new ones, which will require more information on the antigens recognized by human Treg cells. In particular, such data will help in resolving how signals from the 2 TCRs are integrated during Treg-cell selection and activation. Our findings open new avenues of investigation into the development and function of human Treg cells and also provide the first demonstration of dual specificity having an impact on the normal immune system.


    Authorship
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Authorship
 References
 
Contribution: H.T. and T.P.A. designed and performed the research and wrote the paper, and J.S. contributed clinical samples.

Conflict-of-interest disclosure: The authors declare no competing financial interests.


    Acknowledgements
 
This work was supported by grants from the Academy of Finland, Finnish Cultural Foundation, and Helsinki University Science Foundation and research funds of the Helsinki University Hospital.

We thank A. Banham for providing the anti-FOXP3 mAb, A. Miettinen for reviewing the manuscript, S. Sarna for advice on statistics, and O. Vaarala for performing the IFN-{gamma} measurements.


    Footnotes
 
Submitted April 11, 2006; accepted August 8, 2006.

Prepublished online as Blood First Edition Paper, 8/22/2006; DOI 10.1182/blood-2006-04-016105.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 USC section 1734.

Correspondence: T. Petteri Arstila, Haartman Institute, Department of Immunology, PB21, 00014 University of Helsinki, Finland; e-mail: petteri.arstila{at}helsinki.fi.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Authorship
 References
 

  1. Sakaguchi S. Naturally arising CD4+ regulatory T cells for immunologic self-tolerance and negative control of immune responses. Annu Rev Immunol. 2004;22: 531-562.[CrossRef][Medline] [Order article via Infotrieve]

  2. Fontenot JD, Rudensky AY. A well adapted regulatory contrivance: regulatory T cell development and the forkhead family transcription factor Foxp3. Nat Immunol. 2005;6: 331-337.[CrossRef][Medline] [Order article via Infotrieve]

  3. Fontenot JD, Rasmussen JP, Williams LM, Dooley JL, Farr AG, Rudensky AY. Regulatory T cell lineage specification by the forkhead transcription factor foxp3. Immunity. 2005;22: 329-341.[CrossRef][Medline] [Order article via Infotrieve]

  4. Yagi H, Nomura T, Nakamura K, et al. Crucial role of FOXP3 in the development and function of human CD25+CD4+ regulatory T cells. Int Immunol. 2004;16: 1643-1656.[Abstract/Free Full Text]

  5. Roncador G, Brown PJ, Maestre L, et al. Analysis of FOXP3 protein expression in human CD4(+) CD25(+) regulatory T cells at the single-cell level. Eur J Immunol. 2005;35: 1681-1691.[CrossRef][Medline] [Order article via Infotrieve]

  6. Taams LS, Akbar AN. Peripheral generation and function of CD4+CD25+ regulatory T cells. Curr Top Microbiol Immunol. 2005;293: 115-131.[Medline] [Order article via Infotrieve]

  7. Cozzo C, Caton AJ. The role of self-peptides in the development of CD4+ CD25+ regulatory T cells. Curr Opin Immunol. 2005;17: 131-136.[CrossRef][Medline] [Order article via Infotrieve]

  8. Hsieh CS, Liang Y, Tyznik AJ, Self SG, Liggitt D, Rudensky AY. Recognition of the peripheral self by naturally arising CD25(+) CD4(+) T cell receptors. Immunity. 2004;21: 267-277.[CrossRef][Medline] [Order article via Infotrieve]

  9. Hsieh CS, Zheng Y, Liang Y, Fontenot JD, Rudensky AY. An intersection between the self-reactive regulatory and nonregulatory T cell receptor repertoires. Nat Immunol. 2006;7: 401-410.[CrossRef][Medline] [Order article via Infotrieve]

  10. van Santen HM, Benoist C, Mathis D. Number of T reg cells that differentiate does not increase upon encounter of agonist ligand on thymic epithelial cells. J Exp Med. 2004;200: 1221-1230.[Abstract/Free Full Text]

  11. Grajewski RS, Silver PB, Agarwal RK, et al. Endogenous IRBP can be dispensable for generation of natural CD4+CD25+ regulatory T cells that protect from IRBP-induced retinal autoimmunity. J Exp Med. 2006;203: 851-856.[Abstract/Free Full Text]

  12. Spits H. Development of alphabeta T cells in the human thymus. Nat Rev Immunol. 2002;2: 760-772.[CrossRef][Medline] [Order article via Infotrieve]

  13. Casanova JL, Romero P, Widmann C, Kourilsky P, Maryanski JL. T cell receptor genes in a series of class I major histocompatibility complex-restricted cytotoxic T lymphocyte clones specific for a Plasmodium berghei nonapeptide: implications for T cell allelic exclusion and antigen-specific repertoire. J Exp Med. 1991;174: 1371-1383.[Abstract/Free Full Text]

  14. Padovan E, Casorati G, Dellabona P, Meyer S, Brockhaus M, Lanzavecchia A. Expression of two T cell receptor alpha chains: dual receptor T cells. Science. 1993;262: 422-424.[Abstract/Free Full Text]

  15. Heath WR, Carbone FR, Bertolino P, Kelly J, Cose S, Miller JF. Expression of two T cell receptor alpha chains on the surface of normal murine T cells. Eur J Immunol. 1995;25: 1617-1623.[Medline] [Order article via Infotrieve]

  16. Kuida K, Furutani-Seiki M, Saito T, Kishimoto H, Sano K, Tada T. Post-translational attainment of allelic exclusion of the T cell receptor alpha chain in a T cell clone. Int Immunol. 1991;3: 75-82.[Abstract/Free Full Text]

  17. Malissen M, Trucy J, Jouvin-Marche E, Cazenave PA, Scollay R, Malissen B. Regulation of TCR alpha and beta gene allelic exclusion during T-cell development. Immunol Today. 1992;13: 315-322.[CrossRef][Medline] [Order article via Infotrieve]

  18. Corthay A, Nandakumar KS, Holmdahl R. Evaluation of the percentage of peripheral T cells with two different T cell receptor alpha-chains and of their potential role in autoimmunity. J Autoimmun. 2001;16: 423-429.[CrossRef][Medline] [Order article via Infotrieve]

  19. Boyd R, Kozieradzki I, Chidgey A, et al. Receptor-specific allelic exclusion of TCRV alpha-chains during development. J Immunol. 1998;161: 1718-1727.[Abstract/Free Full Text]

  20. Gascoigne NR, Alam SM. Allelic exclusion of the T cell receptor alpha-chain: developmental regulation of a post-translational event. Semin Immunol. 1999;11: 337-347.[CrossRef][Medline] [Order article via Infotrieve]

  21. Niederberger N, Holmberg K, Alam SM, et al. Allelic exclusion of the TCR alpha-chain is an active process requiring TCR-mediated signaling and c-Cbl. J Immunol. 2003;170: 4557-4563.[Abstract/Free Full Text]

  22. Lacorazza HD, Nikolich-Zugich J. Exclusion and inclusion of TCR alpha proteins during T cell development in TCR-transgenic and normal mice. J Immunol. 2004;173: 5591-5600.[Abstract/Free Full Text]

  23. Elliott JI, Altmann DM. Dual T cell receptor alpha chain T cells in autoimmunity. J Exp Med. 1995; 182: 953-959.[Abstract/Free Full Text]

  24. Sarukhan A, Garcia C, Lanoue A, von Boehmer H. Allelic inclusion of T cell receptor alpha genes poses an autoimmune hazard due to low-level expression of autospecific receptors. Immunity. 1998;8: 563-570.[CrossRef][Medline] [Order article via Infotrieve]

  25. Zal T, Weiss S, Mellor A, Stockinger B. Expression of a second receptor rescues self-specific T cells from thymic deletion and allows activation of autoreactive effector function. Proc Natl Acad Sci U S A. 1996;93: 9102-9107.[Abstract/Free Full Text]

  26. Skarsvik S, Ludvigsson J, Vaarala O. Aberrant regulation of interleukin-12 receptor beta2 chain on type 1 cytokine-stimulated T lymphocytes in type 1 diabetes. Immunology. 2005;114: 287-293.[CrossRef][Medline] [Order article via Infotrieve]

  27. Genevee C, Diu A, Nierat J, et al. An experimentally validated panel of subfamily-specific oligonucleotide primers (V alpha 1-w29/V beta 1-w24) for the study of human T cell receptor variable V gene segment usage by polymerase chain reaction. Eur J Immunol. 1991;22: 1261-1269.

  28. Puisieux I, Even J, Pannetier C, Jotereau F, Favrot M, Kourilsky P. Oligoclonality of tumor-infiltrating lymphocytes from human melanomas. J Immunol. 1994;153: 2807-2818.[Abstract]

  29. Stephens LA, Mottet C, Mason D, Powrie F. Human CD4(+)CD25(+) thymocytes and peripheral T cells have immune suppressive activity in vitro. Eur J Immunol. 2001;31: 1247-1254.[CrossRef][Medline] [Order article via Infotrieve]

  30. Annunziato F, Cosmi L, Liotta F, et al. Phenotype, localization, and mechanism of suppression of CD4(+)CD25(+) human thymocytes. J Exp Med. 2002;196: 379-387.[Abstract/Free Full Text]

  31. Kasow KA, Chen X, Knowles J, Wichlan D, Handgretinger R, Riberdy JM. Human CD4+CD25+ regulatory T cells share equally complex and comparable repertoires with CD4+CD25- counterparts. 2004;172: 6123-6128.

  32. Baecher-Allan C, Brown JA, Freeman GJ, Hafler DA. CD4+CD25 high regulatory cells in human peripheral blood. J Immunol. 2001;167: 1245-1253.[Abstract/Free Full Text]

  33. Lee PT, Benlagha K, Teyton L, Bendelac A. Distinct functional lineages of human Valpha24 natural killer T cells. J Exp Med. 2002;195: 637-641.[Abstract/Free Full Text]

  34. Valitutti S, Muller S, Cella M, Padovan E, Lanzavecchia A. Serial triggering of many T-cell receptors by a few peptide-MHC complexes. Nature. 1995;375: 148-151.[CrossRef][Medline] [Order article via Infotrieve]

  35. Zerrahn J, Held W, Raulet DH. The MHC reactivity of the T cell repertoire prior to positive and negative selection. Cell. 1997;88: 627-636.[CrossRef][Medline] [Order article via Infotrieve]

  36. Van de Keere F, Tonegawa S. CD4(+) T cells prevent spontaneous experimental autoimmune encephalomyelitis in anti-myelin basic protein T cell receptor transgenic mice. J Exp Med. 1998;188: 1875-1882.[Abstract/Free Full Text]

  37. Olivares-Villagomez D, Wang Y, Lafaille JJ. Regulatory CD4(+) T cells expressing endogenous T cell receptor chains protect myelin basic protein-specific transgenic mice from spontaneous autoimmune encephalomyelitis. J Exp Med. 1998;188: 1883-1894.[Abstract/Free Full Text]

  38. Itoh M, Takahashi T, Sakaguchi N, et al. Thymus and autoimmunity: production of CD25+CD4+ naturally anergic and suppressive T cells as a key function of the thymus in maintaining immunologic self-tolerance. J Immunol. 1999;162: 5317-5326.[Abstract/Free Full Text]

  39. Kawahata K, Misaki Y, Yamauchi M, et al. Generation of CD4(+)CD25(+) regulatory T cells from autoreactive T cells simultaneously with their negative selection in the thymus and from nonautoreactive T cells by endogenous TCR expression. J Immunol. 2002;168: 4399-4405.[Abstract/Free Full Text]

  40. Hori S, Haury M, Coutinho A, Demengeot J. Specificity requirements for selection and effector functions of CD25+4+ regulatory T cells in anti-myelin basic protein T cell receptor transgenic mice. Proc Natl Acad Sci U S A. 2002;99: 8213-8218.[Abstract/Free Full Text]

  41. Jordan MS, Boesteanu A, Reed AJ, et al. Thymic selection of CD4+CD25+ regulatory T cells induced by an agonist self-peptide. Nat Immunol. 2001;2: 301-306.[CrossRef][Medline] [Order article via Infotrieve]

  42. Apostolou I, Sarukhan A, Klein L, von Boehmer H. Origin of regulatory T cells with known specificity for antigen. Nat Immunol. 2002;3: 756-763.[Medline] [Order article via Infotrieve]

  43. Walker LS, Chodos A, Eggena M, Dooms H, Abbas AK. Antigen-dependent proliferation of CD4+ CD25+ regulatory T cells in vivo. J Exp Med. 2003;198: 249-258.[Abstract/Free Full Text]

  44. Suto A, Nakajima H, Ikeda K, et al. CD4(+)CD25(+) T-cell development is regulated by at least 2 distinct mechanisms. Blood. 2002; 99: 555-560.[Abstract/Free Full Text]

  45. Fossati G, Cooke A, Papafio RQ, Haskins K, Stockinger B. Triggering a second T cell receptor on diabetogenic T cells can prevent induction of diabetes. J Exp Med. 1999;190: 577-583.[Abstract/Free Full Text]

  46. He X, Janeway CAJ, Levine M, et al. Dual receptor T cells extend the immune repertoire for foreign antigens. Nat Immunol. 2002;3: 127-134.[CrossRef][Medline] [Order article via Infotrieve]

  47. Bluestone JA, Abbas AK. Natural versus adaptive regulatory T cells. Nat Rev Immunol. 2003;3: 253-257.[CrossRef][Medline] [Order article via Infotrieve]

  48. Suffia IJ, Reckling SK, Piccirillo CA, Goldszmid RS, Belkaid Y. Infected site-restricted Foxp3+ natural regulatory T cells are specific for microbial antigens. J Exp Med. 2006;203: 777-788.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Int ImmunolHome page
A. F. Campese, P. Grazioli, S. Colantoni, E. Anastasi, M. Mecarozzi, S. Checquolo, G. De Luca, D. Bellavia, L. Frati, A. Gulino, et al.
Notch3 and pT{alpha}/pre-TCR sustain the in vivo function of naturally occurring regulatory T cells
Int. Immunol., June 1, 2009; 21(6): 727 - 743.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. Gong, L. Shao, Y. Wang, C. Y. Chen, D. Huang, S. Yao, X. Zhan, H. Sicard, R. Wang, and Z. W. Chen
Phosphoantigen-activated V{gamma}2V{delta}2 T cells antagonize IL-2-induced CD4+CD25+Foxp3+ T regulatory cells in mycobacterial infection
Blood, January 22, 2009; 113(4): 837 - 845.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Tuovinen, E. Kekalainen, L. H. Rossi, J. Puntila, and T. Petteri Arstila
Cutting Edge: Human CD4-CD8- Thymocytes Express FOXP3 in the Absence of a TCR
J. Immunol., March 15, 2008; 180(6): 3651 - 3654.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Larkin III, A. L. Rankin, C. C. Picca, M. P. Riley, S. A. Jenks, A. J. Sant, and A. J. Caton
CD4+CD25+ Regulatory T Cell Repertoire Formation Shaped by Differential Presentation of Peptides from a Self-Antigen
J. Immunol., February 15, 2008; 180(4): 2149 - 2157.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Fazilleau, H. Bachelez, M.-L. Gougeon, and M. Viguier
Cutting Edge: Size and Diversity of CD4+CD25high Foxp3+ Regulatory T Cell Repertoire in Humans: Evidence for Similarities and Partial Overlapping with CD4+CD25 T Cells
J. Immunol., September 15, 2007; 179(6): 3412 - 3416.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
blood-2006-04-016105v1
108/13/4063    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tuovinen, H.
Right arrow Articles by Arstila, T. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tuovinen, H.
Right arrow Articles by Arstila, T. P.
Related Collections
Right arrow Immunobiology
Right arrow Signal Transduction
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2006 by American Society of Hematology         Online ISSN: 1528-0020