| |
|
|
|
|
|
|
|||
|
Blood, 1 August 2006, Vol. 108, No. 3, pp. 936-942. Prepublished online as a Blood First Edition Paper on April 6, 2006; DOI 10.1182/blood-2006-01-010215.
HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY Structural basis for platelet collagen responses by the immune-type receptor glycoprotein VIFrom the Department of Molecular Genetics, Biochemistry & Microbiology, University of Cincinnati College of Medicine, Cincinnati, OH; and the Department of Medicine, Division of Cardiology, University of Pennsylvania, Philadelphia, PA.
Activation of circulating platelets by exposed vessel wall collagen is a primary step in the pathogenesis of heart attack and stroke, and drugs to block platelet activation have successfully reduced cardiovascular morbidity and mortality. In humans and mice, collagen activation of platelets is mediated by glycoprotein VI (GPVI), a receptor that is homologous to immune receptors but bears little sequence similarity to known matrix protein adhesion receptors. Here we present the crystal structure of the collagen-binding domain of human GPVI and characterize its interaction with a collagen-related peptide. Like related immune receptors, GPVI contains 2 immunoglobulin-like domains arranged in a perpendicular orientation. Significantly, GPVI forms a back-to-back dimer in the crystal, an arrangement that could explain data previously obtained from cell-surface GPVI inhibition studies. Docking algorithms identify 2 parallel grooves on the GPVI dimer surface as collagen-binding sites, and the orientation and spacing of these grooves precisely match the dimensions of an intact collagen fiber. These findings provide a structural basis for the ability of an immunetype receptor to generate signaling responses to collagen and for the development of GPVI inhibitors as new therapies for human cardiovascular disease.
Thrombus formation in the arterial vasculature is a process initiated by the interaction of several platelet receptors with collagen and collagen-associated proteins at the site of vascular injury. Initially, platelets are tethered transiently to exposed collagen when the receptor GPIb interacts with collagen-bound von Willebrand factor (VWF).1 For stable platelet adhesion to occur, the immunoglobulin (Ig)like receptor GPVI must bind to collagen, triggering the activation of a signaling cascade.2,3 GPVI signaling leads to inside-out activation of the platelet integrins 2 1 and IIb 3.4,5 Activated 2 1 binds tightly to a specific sequence in collagen to allow firm adhesion of the platelets to the site of injury,5,6 and activated IIb 3 mediates platelet aggregation.7 In addition, GPVI signaling stimulates secretion of platelet granule contents to activate nearby circulating platelets and propagate thrombus formation. In humans, GPVI deficiency causes a loss of platelet activation in response to collagen,2,3 and GPVI polymorphisms have been linked to increased risk of myocardial infarction.8 Remarkably, loss or inhibition of GPVI prevents arterial thrombus formation in animal models but causes only mildly prolonged bleeding times in mice and humans, suggesting that GPVI could be a prime therapeutic target for prevention of arterial thrombotic diseases such as heart attack and stroke.3
The gene for GPVI is found in the leukocyte receptor cluster (LRC) on human chromosome 19.9 The sequence of the GPVI ectodomain was predicted to form 2 Ig-like domains comprising the collagen-binding domain followed by a heavily O-glycosylated stalk.2 Like other LRC receptors, GPVI associates with the FcR
Cloning, expression, refolding, and purification of GPVI
Human GPVI cDNA was prepared as described.14 The DNA sequence encoding the CBD (residues Q1-T183) was amplified by polymerase chain reaction (PCR) using CACCGAAAACCTGTATTTTCAGGGCCAGAGTGGACCGCTCCCC (the tobacco etch virus protease [TEVp] cleavage site is underlined) and CTATGTGACCACAAGCTCCAGCGGGTCGCTGGG as the sense and antisense primers, respectively. The PCR product was inserted into the pDEST17 vector encoding an N-terminal (His)6tag using the GATEWAY system (Invitrogen, Carlsbad, CA), and transformed into Escherichia coli strain Tuner(DE3) (Novagen, Madison, WI). Cultures were grown to an A600 of 0.8 and induced for 4 hours at 37°C with 0.1 mM isopropyl The denatured and reduced protein was refolded by rapid dilution with vigorous stirring in refolding buffer (1 M L-arginine, 2 mM EDTA, 5 mM reduced L-glutathione, 0.5 mM oxidized L-glutathione, and 100 mM Tris-HCl, pH 8.8) at 4°C for 16 hours. The refolded protein was dialyzed against TEVp cleavage buffer (100 mM NaCl, 2 mM CaCl2, and 20 mM Tris-HCl, pH 8.0), cleaved overnight at room temperature, and further purified by IMAC and size exclusion chromatography using a HiLoad 26/60 Superdex 75 column (Amersham Biosciences, Piscataway, NJ) equilibrated with TBS buffer (150 mM NaCl, 20 mM Tris-HCl, pH 7.4). The recombinant GPVI was judged to be more than 90% pure by sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) with a yield of 0.5 to 1.0 mg per 1 L LB. CRP used for binding experiments was purchased from Peptide International (Louisville, Kentucky) as a noncross-linked (POG)10 polypeptide. Crystallization and structure determination
Purified GPVI was crystallized by mixing 0.4 µL GPVI (5 mg/mL in TBS) with 0.4 µL crystallization buffer (1 M ammonium sulfate and 5% MPD) in sitting drop crystallization plates. Small needle-shaped crystals appeared in 3 days and were improved by microseeding and macroseeding techniques. For seeding, 2 µL protein solution (10 mg/mL in TBS) was mixed with 2 µL crystallization buffer (0.9 M ammonium sulfate, 8% MPD, and 20% glycerol). After seeding, diamond-shaped platelike crystals grew to a maximum size of approximately 150 x 150 x 20 µm in one month. The crystals belong to the space group P21212 with 2 GPVI molecules in the asymmetric unit. Data were collected at 100 K with an R-AXIS IV++ image-plate detector using CuK The structure was solved by molecular replacement using Phaser1.3.1.16 The search model used was LIR-1 (pdb 1G0X [PDB] 17) after truncating loops, which yielded 2 clear solutions. All crystallographic refinements were performed with CNS18 using the maximum-likelihood target function. Rigid body refinement was followed by several cycles of torsion-angle simulated annealing, positional refinement, individual B-factor refinement, and manual model rebuilding. Both 2Fo Fc and Fo Fc electron density maps were used to manually rebuild the model with XtalView.19 When the value of the R-factor dropped to 24%, solvent molecules and ions were gradually included. The electron density was well defined for the overall structure except for 2 residues of the N-terminus for molecule A and residues 99 to 107 and 130 to 137 for molecule B. The final model contained 182 and 167 residues for molecules A and B, respectively. Criteria for inclusion of solvent and ion molecules included height and shape of the electron density peaks and appropriate coordination by GPVI residues. Data collection and refinement statistics are reported in Table 1.
Analytical ultracentrifugation Sedimentation velocity and equilibrium experiments were carried out at 20°C in a Beckman XL-I ProteomeLab analytical ultracentrifuge (Beckman Coulter, Palo Alto, CA) using absorbance optics, as described.20 For sedimentation velocity experiments, samples of GPVI or mixtures with CRP were spun at 48 000 rpm. Sedimentation coefficients were determined using the program SEDFIT.21 For sedimentation equilibrium experiments, mixtures of 10 µM CRP and 10, 40, and 80 µM GPVI were spun at speeds of 16 000, 19 000, 29 000, 35 000, and 48 000 rpm. Data files were trimmed and analyzed by global fitting using the programs WinREEDIT and WinNONLIN (Jeff Lary, University of Connecticut, Storrs, CT). Values of sw, the weight-average sedimentation coefficient determined by SEDFIT, were fitted to a single-site binding isotherm using SEDPHAT.22 Docking of CRP to GPVI We used the PatchDock server23 (http://bioinfo3d.cs.tau.ac.il/PatchDock) to predict the binding orientation of CRP on GPVI. A truncated CRP with the sequence (POG)5 was created from the crystal structure of (POG)4POA(POG)5 (pdb 1CAG [PDB] 24) and used as the ligand, with GPVI D1 as the receptor. Six of the top 10 solutions showed CRP bound in a putative binding groove adjacent to the C'E loop and neighboring several residues implicated in collagen and CRP binding (K41, K59, R60, and R16625,26). Three of these solutions bound in one orientation (ie, with the N-termini of CRP closer to GPVI residue F54), and the other 3 solutions bound in the opposite orientation (ie, with the C-termini closer to F54), consistent with the pseudo-2-fold symmetry within CRP. We also used the FTDock program from the 3D-Dock software package to dock CRP to GPVI.27 Because FTDock does not recognize hydroxyproline, a modified CRP with the sequence (PPG)5 was created from the crystal structure of (PPG)10, (pdb 1K6F [PDB] 28). The grid-based shape complementarity search was performed using 148 grid units in each dimension (grid point spacing: 0.07 nm [0.7 Å]). The docking solutions were sorted by surface complementarity and the top solution was also found in the same surface groove in D1 identified by PatchDock. Furthermore, filtering the solutions by proximity to K59 reveals a second solution within the binding groove, but in the opposite orientation. Calculation of estimated 2D Kd at platelet surface
Correlating the reported GPVI receptor density on the platelet surface29 with an estimated Kd for dimerization of soluble GPVI CBD was carried out according the approach of Dustin et al.30,31 The interaction of 2 membrane-embedded receptors is estimated to occur with a loss of 3 degrees of freedom (compared with their interaction as soluble receptors), due to their restriction to 2-dimensional diffusion within the plane of a lipid bilayer.32 The 3D Kd was converted into Other computational methods Generation of collagen fiber models was carried out by applying crystallographic symmetry to the CRP structures (pdb 1CAG [PDB] , 1CGD, and 1BKV) using the program O.34 Analysis of buried surface areas and interdomain angles were calculated using Areaimol from the CCP4 suite15 and Dom_Angle, respectively.35 Domain boundaries were defined as residues 0 to 89 for D1 and residues 90 to 183 for D2. Figures were generated with PyMOL (DeLano Scientific, San Francisco, CA),36 Molscript,37 and Raster3D.38
Crystal structure of the collagen-binding domain of GPVI
The crystal structure of the GPVI CBD was solved by molecular replacement using data to a resolution of 0.24 nm (2.4 Å). The CBD is composed of 2 Ig-like domains oriented 90° apart, similar to other LRC receptors such as Fc
GPVI D2, like D1, contains the conserved proline (P100) at the end of the A strand, but in D2 it adopts the trans rather than cis conformation. As a result, there is no sharp bend in the protein backbone, the A' strand does not form, and the architecture of the subsequent AB loop is significantly altered (Figure 1E). The topology of the D2 domain is therefore a C2-type Ig fold with ABE and GFCC' sheets, rather than the typical I-type fold. GPVI D2 diverges somewhat from the canonical C2 fold, which features a very short C' strand of 3 residues. Instead, GPVI D2 has significantly elongated C and C' strands, each containing 10 residues. Both the unusual AB loop and CC' hairpin extend outward from the main body of D2 and appear to be quite flexible, given the lack of clear electron density for these regions in a second independent molecule within the asymmetric unit.
The GPVI CBD forms a dimer in the crystal
The asymmetric unit of the crystal contains a parallel, back-to-back dimer formed by the D2 domains of the 2 GPVI molecules (Figure 2A). The G strands of the D2 domains interact to create a continuous Interaction of GPVI CBD and collagen-related peptide in solution To understand how GPVI associates with the macromolecule collagen, we next studied the interaction between the GPVI CBD and CRP, which functionally mimics collagen in biologic assays. To analyze the affinity of the interaction under conditions favoring a 1:1 complex, sedimentation velocity analytical ultracentrifugation experiments were carried out by titrating GPVI with CRP (a noncross-linked (POG)10 triple helix) at up to 35-fold molar excess (Figure 3A). The weight-averaged sedimentation coefficient (sw) of each dataset was plotted as a function of CRP concentration and fitted to a single-site binding isotherm, yielding a Kd of 5 µM (Figure 3A inset). This affinity is significantly tighter than that determined by surface plasmon resonance (SPR)47; however, the SPR experiment measured binding of GPVI to immobilized, cross-linked CRP with a different sequence than the noncross-linked CRP described here. Additional sedimentation velocity and sedimentation equilibrium experiments conducted using 1:1, 4:1, or 8:1 molar ratio mixtures of GPVI/CRP indicated that multiple GPVI molecules can bind to a single CRP triple helix, consistent with the presence of multiple overlapping sites for GPVI within the repeating tripeptide sequence of the CRP triple helix. The sw values indicated formation of a 1:1 complex in the first sample and formation of higher-order complexes in the 4:1 and 8:1 mixtures (Figure 3B). Sedimentation equilibrium experiments conducted in parallel on similar mixtures indicated that 2 or 3 molecules of GPVI could bind simultaneously to a CRP triple helix (data not shown).
Computational determination of CRP binding sites on the GPVI dimer How does the GPVI dimer recognize CRP and fibrous collagen? Unfortunately, complexes of GPVI with CRP were found to be resistant to crystallization, most likely due to excessive heterogeneity of the complexes, which results from the ability of GPVI to bind at multiple overlapping sites along the triple helix. In order to identify collagen-binding sites on GPVI, we therefore used 2 different computational algorithms, PatchDock23 and FTDock,27 to dock CRP onto GPVI. Both docking programs positioned CRP within the shallow groove on D1 adjacent to the C'E loop (Figure 4A-B). The floor of the putative binding groove is formed by several hydrophobic residues (L53, F54, P56, L62, and Y66, and the aliphatic portion of K41), with several polar (S43, S44, Q48, Q50, S61) and basic (K41, R46, K59, R166) residues around the periphery (Figure 4B-D). This groove is unique to GPVI among LRC receptors, as it results from the 11-residue deletion in GPVI. The binding of CRP to this groove provides a structural explanation for how an immune-type receptor has evolved to bind vessel wall collagen. In these models, CRP is immediately adjacent to GPVI residues K41, K59, R60, and R166, which have been implicated as collagen and CRP-binding residues by mutational analysis, as described in "Discussion"25,26 (Figure 4E). Furthermore, previously described GPVI mutations having no effect on CRP affinity are not located within the putative binding groove25,26 (Figure 4E, light-blue surfaces). The docked CRP solutions from each program are evenly distributed between 2 nearly opposite orientations within the groove. This is consistent with the pseudo-2-fold symmetry present in CRP, caused by its imino groups (prolines and hydroxyprolines) occupying similar positions in both orientations. Native collagen fibers are composed of a pseudo-hexagonal array of parallel CRP-like triple helices separated by 1.3 to 1.4 nm (13 to 14 Å),50 an arrangement that is also conserved in crystal structures of soluble CRP-like peptides24 (Figure 4B top). Of interest, the 2 putative CRP-binding grooves within a GPVI dimer are essentially parallel and are separated by approximately 5.5 nm (55 Å), which is equivalent to the distance between the n and n + 4 helices in a collagen fiber. The geometric compatibility of the binding grooves with collagen helices would allow the GPVI dimer to bind simultaneously to 2 helices within a collagen fiber.
The receptor GPVI is central to the process of collagen-mediated platelet activation and subsequent thrombus formation. The atomic structure of GPVI is therefore of interest in terms of understanding how an immune-type receptor can recognize fibrous collagen. Furthermore, the structure allows the identification of potential regions responsible for interacting with collagen, which may serve as desirable targets for inhibitory drugs. The crystallographic data presented here reveal that the GPVI CBD adopts a fold previously seen in related immune receptors of the leukocyte receptor cluster, but an 11-residue deletion in the sequence of GPVI relative to other LRC receptors creates a shallow groove on the surface of D1 that forms a putative collagen-binding site, based on docking algorithms and mutagenesis data. The CBD forms a back-to-back dimer in the crystal in which the 2 putative collagen-binding grooves are nearly parallel and separated by 5.5 nm (55 Å), a configuration that matches the orientation and dimensions of triple helices within fibrous collagen. The dimeric GPVI conformation observed in the crystal is intriguing and may well represent the physiologically relevant form of GPVI on the platelet surface. Previous studies have shown that soluble GPVI-Fc fusions, but not monomeric soluble GPVI, inhibited platelet activation,2,47,51,52 suggesting that either a dimeric conformation or the higher avidity conferred by the Fc fusion was required to effectively compete with cell-surface GPVI for binding to collagen. This was further supported by surface plasmon resonance assays showing that the GPVI-Fc fusion bound collagen nearly 200-fold more tightly than monomeric GPVI did.47
The data presented here suggest that GPVI dimerization is a rather weak interaction that nonetheless could occur on the platelet surface. Analytical ultracentrifugation experiments indicated that the soluble GPVI CBD construct used for crystallization remained monomeric in solution at up to 100 µM (Figure 3A and data not shown). However, the construct we crystallized lacks the stalk region, which could help stabilize a dimeric conformation, as seen for CD94.53 Furthermore, the high density of GPVI at the platelet surface29 would favor dimer formation. It is well established that weak protein-protein interactions in solution occur to a significant extent when the components are restricted to 2-dimensional diffusion in a lipid bilayer.31 For example, if the Kd for GPVI dimerization in solution were 420 µM ( The GPVI structural data provide a framework for understanding the interaction between GPVI and collagen or CRP by allowing accurate mapping of mutagenesis results onto the surface of the GPVI dimer. The residues implicated in collagen or CRP binding fall into 2 clusters: the primary region includes basic residues on the surface of D1 including K41, K59, R60, and R16625,26 (Figure 4E). Mutation of K41 or K59 affects binding to both collagen and CRP; a K41A mutation increases the affinity of GPVI for both ligands, whereas mutation of residue K59 to the mouse equivalent (K59E) decreases affinity for both collagen and CRP.25,26 The R60A and R166A mutations reduce collagen affinity but have no effect on CRP binding.25 A second cluster of residues implicated in collagen or CRP binding is found at the distal end of D1; these residues include L36, implicated in collagen (but not CRP) binding, and both V34 and the N-glycan attached to N72, both of which are involved in collagen and CRP binding.48,49 The GPVI structure shows that the side chain of V34 is buried and its mutation is likely to alter the conformation of the BC loop in D1, which includes L36 and is immediately adjacent to N72. In our computational model of CRP docked to GPVI, the CRP binding groove is located within the primary cluster of basic residues (K41, K59, R60, and R166). K41 is centrally positioned within the floor of the putative binding groove and contacts CRP directly. Furthermore, the docked CRP interacts with the side chain of R166 and is within reach of the K59 and R60 side chains. The docking predictions were based strictly on geometric and energetic criteria and did not take into account any mutagenesis data. Therefore, the correlation between the docking prediction and mutagenesis results suggests that the predicted CRP binding mode is a reasonable approximation of the physiologic interaction of GPVI with CRP and collagen.
The cluster of residues including V34, L36, and the N-glycan at N72 may form a secondary binding site for CRP or collagen triple helices. Residue L36 is located on the surface of D1 approximately 1.4 nm (14 Å) from the putative binding groove, and these secondary residues are positioned such that they could interact with adjacent triple helices within an intact collagen fibril. The mutagenesis results are therefore consistent with the mode of interaction between GPVI and a collagen fibril illustrated in Figure 4B, in which a GPVI dimer binds simultaneously to several triple helices within the collagen fibril. This binding mode also suggests a model for the initiation of signal transduction triggered by receptor clustering that accompanies collagen binding (Figure 5). These studies establish a structural basis for the ability of platelets to recognize and be activated by the vessel wall matrix protein collagen. Platelet activation is a critical step in the pathogenesis of human vascular diseases and new antiplatelet agents have revolutionized the immediate treatment of myocardial infarction. The early role of GPVI in arterial thrombus formation and the relative lack of bleeding associated with human GPVI-deficiency states suggest that new therapies aimed at inhibiting GPVI function might provide an ideal long-term treatment approach to these diseases. A structural understanding of collagen recognition by GPVI will provide a foundation for the development of such novel therapeutic agents.
We thank Drs Rhett Kovall, Tom Thompson, and Jeff Wilson for helpful advice, and Dr Pamela Bjorkman and Deb Conrady for comments on the article. Coordinates have been deposited at the RCSB protein data bank (PBD ID 2GI7).
Submitted January 29, 2006; accepted March 23, 2006.
Prepublished online as Blood First Edition Paper, April 6, 2006; DOI 10.1182/blood-2006-01-010215.
Supported in part by funds from the State of Ohio Eminent Scholar Program and an Award from the American Heart Association to A.B.H.
K.H. and A.B.H. designed research, performed research, analyzed data, and wrote the paper; and M.L.K. contributed vital reagents and wrote the paper.
The online version of this article contains a data supplement.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Andrew B. Herr, Department of Molecular Genetics, Biochemistry & Microbiology, University of Cincinnati College of Medicine, 231 Albert Sabin Way, Cincinnati, OH 45267-0524; e-mail: andrew.herr{at}uc.edu.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||