| |
|
|
|
|
|
|
|||
|
Blood, 1 November 2006, Vol. 108, No. 9, pp. 2914-2922. Prepublished online as a Blood First Edition Paper on July 13, 2006; DOI 10.1182/blood-2006-05-023341.
CHEMOKINES, CYTOKINES, AND INTERLEUKINS EphB2 and EphB4 receptors forward signaling promotes SDF-1induced endothelial cell chemotaxis and branching remodelingFrom the Basic Research Laboratory, Center for Cancer Research, National Cancer Institute, and the Laboratory of Cell Biology, National Heart, Lung and Blood Institute, National Institutes of Health (NIH), Bethesda, MD.
The complex molecular mechanisms that drive endothelial cell movement and the formation of new vessels are poorly understood and require further investigation. Eph receptor tyrosine kinases and their membrane-anchored ephrin ligands regulate cell movements mostly by cellcell contact, whereas the G-proteincoupled receptor CXCR4 and its unique SDF-1 chemokine ligand regulate cell movement mostly through soluble gradients. By using biochemical and functional approaches, we investigated how ephrinB and SDF-1 orchestrate endothelial cell movement and morphogenesis into capillary-like structures. We describe how endogenous EphB2 and EphB4 signaling are required for the formation of extracellular matrixdependent capillary-like structures in primary human endothelial cells. We further demonstrate that EphB2 and EphB4 activation enhance SDF-1induced signaling and chemotaxis that are also required for extracellular matrixdependent endothelial cell clustering. These results support a model in which SDF-1 gradients first promote endothelial cell clustering and then EphB2 and EphB4 critically contribute to subsequent cell movement and alignment into cord-like structures. This study reveals a requirement for endogenous Eph signaling in endothelial cell morphogenic processes, uncovers a novel link between EphB forward signaling and SDF-1induced signaling, and demonstrates a mechanism for cooperative regulation of endothelial cell movement.
The Eph (erythropoietin-producing hepatocellular carcinoma) receptors comprise a large family of tyrosine kinases known to participate in the development of the vascular and nervous systems.1 The family of Eph receptors consists of 14 members divided into A and B subclasses, distinguished on the basis of preferential affinity for glycosylphosphatidylinositol (GPI)linked (A-class) or transmembrane (B-class) ephrin ligands. Within each A and B subclass, Eph receptorephrin ligand interactions are promiscuous, though the binding affinities differ considerably.2,3 For example, EphB4 preferentially binds ephrin B2 and shows only weak binding to ephrinB1 and ephrin B3. Exceptions to class-restricted interactions include ephrin A5, which can bind to EphB2 at high concentrations,2,4 and ephrin B ligands, which can bind to EphA4.2,3,5 Knockout mice lacking ephrin B2 or EphB4 and a proportion of mice lacking EphB2 and EphB3 displayed severe defects in the embryonic vascular system and died at the embryo stage.6-8 Mural cellspecific inactivation of ephrin B2 results in perinatal death, and mice display edema and extensive hemorrhaging in the skin.9 After birth, EphB receptors and ephrin B ligands continue to be expressed by endothelial cells from various tissues; EphB2 and ephrin B2 display some selectivity for the arterial endothelium, whereas EphB4 is expressed in arterial and venous endothelium.10 Functional assays in vitro have provided evidence that several EphB receptors and ephrin B ligands are active in human endothelial cells. Soluble dimeric forms of ephrin B ligands and EphB receptors, including Ephrin B1-Fc, ephrin B2-Fc, EphB4-Fc, and EphB1-Fc, promoted the growth, sprouting, migration, or assembly of capillary-like structures by various human endothelial cells,6,11-16 presumably by activating forward or reverse signaling. However, ephrin B2-Fc also produced repulsive signals and inhibited endothelial cell sprouting while activating EphB4 forward signaling,15 and it reduced VEGF-induced endothelial cell migration and growth.17 One important feature of Eph receptors and ephrin ligands is that they interact through cellcell contact because they are bound to the plasma membrane, and they activate bidirectional intracellular signaling emanating from both the receptor (forward signaling) and the ligand (reverse signaling).18-20 When appropriately activated, EphB receptor and ephrin B ligands become phosphorylated on tyrosine residues in their cytoplasmic domain and form complexes with various adaptor proteins, including PDZ and Src homology 2 (SH2) domaincontaining proteins, resulting in crosstalk between Eph signaling and other signaling pathways.1,20-23 One example of crosstalk involves ephrin B reverse signaling and the G-proteincoupled receptor CXCR4 signaling in primary cerebellar granule cells through the adaptor PDZ-RGS3 protein, resulting in functional inactivation of CXCR4 and failure to migrate in response to SDF-1.24 CXCR4 and its unique ligand, SDF-1, are required for the normal development of the cardiovascular, hematopoietic, and nervous systems.25-29 Mice with targeted deletions of CXCR4 or SDF-1 die in utero and display similar defects in the ventricular septum of the heart, the cerebellum, and the vasculature supplying the gastrointestinal tract.25,27,29,30 Postnatally, vascular endothelial cells constitutively express CXCR4, and some cells also constitutively express and secrete SDF-1.31-33 Functional studies in vitro and in vivo have demonstrated that SDF-1/CXCR4 plays critical roles in the regulation of endothelial cell branching morphogenesis and angiogenesis.33-36 In this study, we have explored the possibility that ephrin B/EphB and SDF-1/CXCR4 may coordinately regulate endothelial cell movement and other functions. We report that endogenous EphB2 and EphB4 signaling are required for the formation of capillary-like vascular structures and that EphB2 and EphB4 activation enhances SDF-1induced signaling and chemotaxis in endothelial cells. These results provide evidence of signaling and functional cooperation between the receptors EphB2 and EphB4 and the chemokine SDF-1 in endothelial cells.
Cells and cell cultures Human umbilical vein endothelial cells (HUVECs) and human dermal microvascular endothelial cells (HDMECs; Emory University, Atlanta, GA) from neonatal foreskin were propagated through passage 6, as described.33,37 Human aortic endothelial cells (HAECs; Cambrex Bio Science, Walkersville, MD) were propagated in "one endothelial cell medium" (Cambrex Bio Science). Cell lines SK-N-MC, SK-NEP-1, A-204, and NIH3T3 fibroblasts (ATCC, Manassas, VA) were cultured, as described.38 Brain tissue was obtained from the Laboratory of Pathology of the National Cancer Institute (Bethesda, MD). Chemokines, antibodies, and peptides
Recombinant (Escherichia coliderived) human SDF-1 RNA isolation and reverse transcriptionpolymerase chain reaction Total RNA was extracted using TRI Reagent (Molecular Research Center, Cincinnati, OH). cDNA was synthesized from 1 µg total RNA (SuperScript preamplification system; Gibco-BRL, Carlsbad, CA). Amplifications (28-30 cycles) were performed in a 20-µL reaction mixture, as described.33 Primer sequences for EphB1, EphB2, EphB3, EphB4,17 EphB6,41 ephrin B2,17 ephrin B3,41 and GAPDH33 were described. Primers for ephrin B1 were as follows: sense, TCTGATGGCAAGCATGAGAC; antisense, CGTCATCTTCCTGCTCATCA. PCR products were loaded onto 1.8% agarose gels (NuSieve agarose; FMC, Rockland, ME) and were visualized with ethidium bromide. Western blot analysis and immunoprecipitation Cell lysates were prepared in tricineSDS sample buffer (Novex, San Diego, CA). Brain tissue was treated with NP-40 buffer, sonicated, and solubilized in tricineSDS sample buffer. Protein (50 µg) was boiled, separated through precast polyacrylamide gels (8% or 10%-20%; Novex), and blotted onto nitrocellulose membranes. After blocking, membranes were probed with primary antibodies (18 hours, 4°C), washed, and probed (1 hour, room temperature) with secondary antibodies (HRP-conjugated rabbit antigoat, donkey antimouse, or donkey antirabbit). Membranes were stripped and restained after complete removal of signal. Immunoreactive bands were detected by enhanced chemiluminescence (ECL kit; Amersham Pharmacia Biotech, Uppsala, Sweden) and scanned. Immunoprecipitation of EphB2 and EphB4 was carried out as previously described.39 Cells were lysed in modified RIPA buffer (150 mM NaCl, 1 mM EDTA, 1% Nonidet P-40 [NP-40], 0.5% Na deoxycholate, 0.1% SDS, 20 mM Tris, pH 8.0) with protease inhibitors (Roche Complete; Roche Diagnostic, Indianapolis, IN) and 1 mM sodium orthovanadate. Goat antiEphB2 or goat antiEphB4 antibodies (3 µg; R&D Systems) were added (18 hours, 4°C) to precleared cell lysates (150 µg protein). EphB2- or EphB4-antibody complexes were precipitated with protein GSepharose beads (50 µL; Amersham Pharmacia Biotech), and the precipitates were eluted by boiling in 2 x SDS sample buffer (Novex), separated by SDS-PAGE electrophoresis (8%; Novex), and blotted onto nitrocellulose membranes. The membranes were immunoblotted with antiphosphotyrosine mouse monoclonal antibody (4G10; Cell Signaling Technology) and peroxidase-conjugated donkey antimouse IgG antibody (Amersham Pharmacia Biotech). Membranes were reprobed with goat antiEphB2 or antiEphB4 goat antibodies (R&D Systems). Immunofluorescence microscopy and flow cytometry HUVECs (10-50 x 103 cells/mL) were incubated (0.75-18 hours, 37°C) onto gelatin (0.2%) or Matrigel (Collaborative; BD PharMingen, San Diego, CA)coated glass chamber slides (Lab-Tech, Naperville, IL) in complete culture medium, washed, and fixed with 1% formaldehyde. Fixed cells were incubated (45 minutes at 4°C) with affinity-purified goat IgG antibodies to murine EphB2 or EphB4 (1 µg/mL; R&D Systems) or control goat IgG (1 µg/mL; Chemicon International, Temecula, CA) and DAPI (4,6 diamidino-2-phenylindole), followed by washing and incubation with Texas Redconjugated affinity-purified donkey antigoat IgG (1 µg/mL; Jackson Immuno Research). F-actin was detected with Alexa 488conjugated antibody to phalloidin (Molecular Probes).33 Confocal images were acquired with a Zeiss LSM 510 confocal microscope (Carl Zeiss, Thornwood, NJ) with a Zeiss acioverto 100M inverted microscope and 50-mW argon UV laser tuned to 364 nm and a 25-mW argon visible laser tuned to 488 nm. Either a 10x/0.3 NA Plan-Neofluar dry objective of a 25x/0.8 NA Plan-Neofluar oil immersion objective was used at various digital zoom settings. Emission signals after sequential excitation of FITC and DAPI by the 488-nm laser line and 364-nm laser line were collected with a BP505-550 filter and a BP385-470 filter, respectively, using individual photomultipliers. Images were imported into Adobe Photoshop (Adobe Systems, San Jose, CA). For flow cytometric detection of phospho-Akt, HUVECs were detached (2 mM EDTA in PBS), washed in PBS, and suspended in 250 µL BD Cytofix/Cytoperm solution (Becton Dickinson, Franklin Lakes, NJ) for 20 minutes at 4°C. Cells were washed, blocked (10 minutes, room temperature) with 0.5% BSA in PBS, and stained (30 minutes, room temperature) with rabbit monoclonal antibody to phospho-Akt (Ser473193H12; 1:100 dilution; Cell Signaling Technology). Cells were washed and incubated (30 minutes, room temperature) with FITC-conjugated goat antirabbit IgG (Molecular Probes). Matrigel cord formation and migration assays Cord formation assay was carried out as described.37 Endothelial cells preincubated (37°C, 20 minutes) with or without peptides were plated (40 000-75 000 cells) onto 24-well tissue culture plates precoated with 200 to 300 µL solidified Matrigel (Collaborative; BD PharMingen) in complete culture medium. Cells were photographed with a digital camera (Retiga 1300; Qimaging, Burnaby, BC, Canada) under phase-contrast microscopy (1 x 51 with a 10 x 0.25 PhL lens; Olympus Optical, Melville, NY), and images were obtained with IPLab for Windows software (Scanalytics, Fairfax, VA) imported into Adobe Photoshop. Network formation was measured by counting the number of cord angles per field (each field was defined as the area visualized by a 4 x magnification lens). For video microscopy, HUVECs (40 000-50 000 cells/chamber) were dispersed on Matrigel-coated LabTek chambers (Nalge Nunc, Naperville, IL) in complete culture medium. Time-lapse microscopy was performed with an inverted confocal scanning microscope (LSM510 META; Carl Zeiss, Thornwood, NJ) equipped with a heated stage (maintaining 37°C temperature and 5% CO2 with a CTI-Controller 3700 digital; Zeiss) and a 10 x (0.3 NA) plan apochromat objective. Images were recorded at 5-minute intervals over 13 to 14 hours using LSM510 software and were processed to Quick-time format using MetaMorph software (Universal Imaging, Glendale, WI). One second of the video corresponded to approximately 30 minutes of real time.
Migration assays were performed as described33 using 0.2% gelatin-coated polycarbonate filters (pore size, 8 µm) of 24-well transwells (Costar, Cambridge, MA). Chemotaxis medium (RPMI 1640 containing 0.5% BSA and 10 mM HEPES) alone or with SDF-1 Statistical analysis Group differences were evaluated by Student t test; P values below .05 were considered significant.
EphB receptor and ephrin B ligand expression in human endothelial cells Five known EphB receptors (EphB1-EphB4, EphB6) and 3 ephrin ligands (ephrin B1, ephrin B2, ephrin B3) are known to exist in mammals; some are expressed in primary human endothelial cells derived from different tissues.10-12,17,42,43 Reverse transcriptionpolymerase chain reaction (RT-PCR) analysis showed expression of all 5 EphB receptors in human umbilical vein endothelial cells (HUVECs), human aortic endothelial cells (HAECs), and human dermal microvascular endothelial cells (HDMECs) (Figure 1A). EphB1, EphB3, and EphB6 expression levels varied among HUVECs, HDMEDs, and HAECs, as judged by relative mRNA band intensities. Ephrin B2 was expressed in HUVECs, HAECs, and HDMECs, but expression of ephrin B1 and ephrin B3 was minimal. We used specific antibodies to examine the expression of EphB and ephrin B proteins. Specific bands attributable to EphB2 and EphB4 were detected in HUVECs, HAECs, and HDMECs but not bands clearly attributable to EphB1, EphB3, and EphB6 (Figure 1B). All EphB proteins were detected in human brain tissue extracts (brain)44; EphB1 was detected only at low levels. EphB2- and EphB4-related bands appeared to be of different sizes in brain tissue and endothelial cells, presumably because of different glycosylation patterns (Figure 1B). EphB4 protein was detected in murine NIH3T3 fibroblasts, SK-N-MC neuroblastoma (neuro),45 A-204 rhabdomyosarcoma (rhabd), and SK-NEP-1 Wilms tumor (Wilms) cell lines. EphB2 protein was detected in the Wilms tumorderived cell line (Figure 1B). Consistent with RT-PCR results, we detected ephrin B2 protein in HUVECs, HAECs, and HDMECs but not ephrin B3 (Figure 1C) or ephrin B1 (data not shown). We conclude that primary human endothelial cells from the umbilical vein, the aorta, and the dermal microvascular endothelium express the EphB2 and EphB4 receptors and the ephrin B2 ligand. EphB2 and EphB4 receptor activity in HUVECs When cultured in low serum medium on gelatin-coated dishes, HUVECs did not express a constitutively active EphB2 receptor detected by antiphosphotyrosine antibodies after EphB2 immunoprecipitation (Figure 2A). By contrast, EphB2 was phosphorylated in HUVECs after 10- to 30-minute stimulation with ephrin B1-Fc (1 µg/mL), a dimeric form of the ephrin B1 ligand (Figure 2A). Ephrin B1-Fc preclustered by incubation with a monoclonal antibody to human IgG1-Fc11 also induced EphB2 phosphorylation similar in kinetics and magnitude to that induced by nonpreclustered ephrin B1/Fc (data not shown). We tested whether the SNEW peptide, which was shown to inhibit EphB2 receptor activity in COS cells,39 also inhibited EphB2 receptor activity in HUVECs. The SNEW peptide (100 µM), but not the control peptide (SCR-EPQ control, 100 µM), antagonized ephrin B1-Fcinduced phosphorylation of EphB2 in HUVECs (Figure 2B). Ephrin B receptors and ligands are promiscuous, but their binding affinities vary.3 For example, EphB4 receptors are preferentially activated by ephrin B2 ligands.23,46 As shown (Figure 2C), ephrin B2-Fc induced EphB4 phosphorylation in HUVECs after 30 minutes, which was abrogated by the specific EphB4 peptide inhibitor TNYL-RAW (TNYL, 100 µM) but not by the SNEW peptide (100 µM) or a control peptide (SCR-WTL, 100 µM; Figure 2C and data not shown). In addition to promoting EphB4 phosphorylation, ephrin B2-Fc promoted EphB2 phosphorylation in HUVECs (Figure 2D). These results provide evidence that EphB2 and EphB4 receptors are functional in HUVECs and that EphB2 and EphB4 activation is inhibited by the specific SNEW and TNYL-RAW peptides.
Contribution of EphB2 and EphB4 receptor activity to endothelial cell cord formation When dispersed onto wells coated with Matrigel, a crude mixture of extracellular matrix proteins, HUVECs form cordlike structures.33,47,48 This morphogenic process, which occurs spontaneously during incubation in culture medium, recapitulates several steps in new vessel formation, including cell attachment to the extracellular matrix, cell movement, cellcell adhesion, extension of lamellipodia and filopodia, and formation of cordlike structures.33,48 By 13- to 14-hour video microscopy, we monitored HUVEC formation of cordlike structures (Video S1, available on the Blood website; see the Supplemental Videos link at the top of the online article). Shortly after addition to Matrigel-coated chambers, HUVECs spread and begin to attach, as evidenced by their flattened appearance, apparently larger size, and presence of lamellipodia. Cells also start to move and, by 1 to 1.5 hours, join with neighboring cells to form many dispersed clusters composed of 2 to 5 cells. Between 1.5 and 4 hours, HUVECs within the clusters change from round to elongated, actively form new lamellipodia and filopodia, and move often vigorously while maintaining contact with each other. By approximately 4 hours, fragmented lines of various orientation and bends are formed, each composed of 2 to 5 elongated cells. Through constant movement of the cells and accelerated formation of filopodia, these fragmented lines become bridged to each other. As a result, by 7 to 8 hours, a network of endothelial cells forms in which individual cells appear attached to the extracellular matrix and anchored to each other. We looked for potential changes in EphB2 (Figure 3A) and EphB4 (Figure 3B) phosphorylation during cord formation onto Matrigel. After 45-minute dispersion onto Matrigel, when HUVECs were attached to the matrix and began to come in contact with other cells, low-level EphB2 (Figure 3A) and EphB4 (Figure 3B) phosphorylation was detected. At 2 and 4 hours, when HUVECs clustered, changed shape from round to elongated, and generated fragmented, cordlike structures, EphB2 (Figure 3A) and EphB4 (Figure 3B) phosphorylation were detected. At 18 hours, when the network was established, EphB2 (Figure 3A) and EphB4 (Figure 3B) phosphorylation was low or undetectable. These results provide evidence for a temporal correlation between the occurrence of cellcell contact and EphB2 and EphB4 activation during cord formation.
To test for a contribution of EphB2 or EphB4 signaling to HUVEC cord formation, we used the SNEW and TNYL-RAW peptides, which selectively block EphB2 (SNEW) or EphB4 (TNYL-RAW) receptor activation. The SNEW peptide (100 µM) and the TNYL-RAW peptide (100 µM) individually interfered with the ability of HUVECs to form the characteristic network of cordlike structures on Matrigel, but a control peptide (SCR-EPQ, 100 µM) did not (Figure 3C, representative images). Similarly, the addition of SNEW or TNYL-RAW peptides, but not of the control SCR-WTL (all at 100 µM) reduced Matrigel-dependent cord formation in HAECs and HDMECs (data not shown). Late addition of the SNEW or TNYL-RAW peptides (100 µM), as early as 45 minutes after the cells were dispersed onto the Matrigel, was ineffective at altering HUVEC cord formation (data not shown). Functional inactivation of CXCR4 by the peptide inhibitor CTCE-9908 (50 µg/mL; Figure 3C) and the synthetic compound AMD3100 (5 µg/mL; data not shown) prevented endothelial cell cord formation on Matrigel, as did the addition of soluble SDF-1
To confirm the results obtained in steady state experiments and to dissect potential differences in the inhibition of cord formation by the peptide inhibitors of CXCR4, EphB2, and EphB4, we used real-time videomicroscopy. If CXCR4 signaling accounted for cell clustering in response to cell-derived SDF-1 gradients, CTCE-9988 would be expected to impair HUVEC migration. If EphB2 and EphB4 became activated by cellcell contact, the SNEW and TNYL-RAW peptides would be expected to inhibit events after the occurrence of cell clustering. If, however, EphB2 and EphB4 contributed to cell adhesion to the extracellular matrix, their inhibitors would impair early events during cord formation. In the presence of the CXCR4 inhibitor CTCE-9908 (50 µg/mL), the cells attached to Matrigel, but their movement toward each other to form cell clusters was markedly reduced in magnitude and was temporally delayed compared with control cells, such that few cell clusters were noted after approximately 7.5 hours (Video S2); such clusters were visible by 1.5 hours in control cells (Video S1). In spite of subsequent cell elongation and formation of cords from the few cell clusters, the overall network was incomplete. In the presence of the SNEW peptide (100 µM) or in the presence of TNYL-RAW peptide (100 µM), cell attachment and initial cell clustering appeared similar to those observed in control cells incubated in medium only (Videos S3, S4). Once clusters formed, however, cell elongation, movement, alignment into segments, and later connection of these segments onto a reticular pattern were substantially delayed and reduced in magnitude. These results confirm that CXCR4 plays an important role in promoting the initial endothelial cell movement and clustering on Matrigel and provide evidence for a critical contribution of EphB2 and EphB4 activation in promoting cord formation, particularly once the cells have clustered. Modulation of EphB2 and EphB4 expression during endothelial cell cord formation Given that endocytosis and cleavage of Eph and ephrin molecules have been described to follow their activation,1 we looked for potential changes of surface EphB2 and EphB4 expression during tube formation. We detected diffuse surface EphB2 and EphB4 on a proportion of HUVECs cultured onto gelatin-coated plates or incubated on Matrigel for 45 minutes (Figure 3A, top panel). After 6-hour incubation on Matrigel, when HUVECs made contact with each other and formed some cords, surface EphB2 and EphB4 were consistently undetectable (Figure 3A, bottom panel; representative images on the left depict the typical HUVEC network and on the right depict a higher magnification of cells within a cord). Surface EphB2 and EphB4 continued to be undetectable on HUVECs even after 18 hours on Matrigel, when the network structure was fully established (data not shown). Thus, EphB2 and EphB4 were down-regulated from the cell surface during endothelial cell cord formation. Actin microfilaments organize into the so-called stress fibers during endothelial cell formation of cordlike structures.33 We examined whether EphB2 or EphB4 inactivation affects these characteristic changes. Confocal microscopy revealed the characteristic filamentous (F)actin network spanning adjacent HUVECs incubated for 6 hours onto Matrigel (Figure 4B, top row; representative images reflect 2 adjacent cells). By contrast, F-actin staining was minimal or focally confined in HUVECs incubated for 6 hours onto Matrigel in the presence of the EphB2 peptide inhibitor SNEW (100 µM) or the EphB4 peptide inhibitor TNYL-RAW (100 µM), indicative of defective actin polymerization (Figure 4B; representative images reflect 2 adjacent cells each).
AKT phosphorylation by SDF-1 is enhanced by ephrin B1-Fc or ephrin B2-Fc
Given that CXCR4, EphB2, and EphB4 contributed to endothelial cell cord formation and that considerable interplay exists between Eph signaling and other signaling pathways,1,49,50 we examined whether interplay exists between SDF-1induced and EphB2 or EphB4 signaling. SDF-1 stimulation leads to AKT phosphorylation in many cell types, including endothelial cells.51-53 Through flow cytometry, we detected phospho-AKT in approximately 14% of HUVECs stimulated for 15 minutes with SDF-1
Addition of the SNEW peptide (100 µM) during 5-minute HUVEC costimulation with SDF-1 (500 ng/mL) and ephrin B1-Fc (1 µg/mL) reduced the proportion of phospho-Aktpositive cells, but there was no such change with the control SCR-EPQ peptide (Figure 5B). A similar reduction in the proportion of phospho-Aktpositive cells was derived from addition of the TNYL-RAW (100 µM), but not the control SCR-WTL, peptide (100 µM) to HUVECs costimulated for 15 minutes with SDF-1 (500 ng/mL) and ephrin B2-Fc (1 µg/mL) (Figure 5B).
We confirmed by immunoblotting that the combination of SDF-1 EphB2 and EphB4 signaling enhance SDF-1induced chemotaxis
While searching for functional correlates of increased Akt phosphorylation induced by the combination of SDF-1 and ephrin B1-Fc or ephrin B2-Fc, we examined endothelial cell chemotaxis. First we incubated HUVECs (10 minutes, 37°C) with ephrin B1-Fc (1 µg/mL), ephrin B2-Fc (1 µg/mL), or medium only, and then we exposed them to SDF-1 gradients in transwell assays. SDF-1
In this study, we show that endogenous EphB2 and EphB4 signaling is required for endothelial cell formation of extracellular matrixdependent cordlike structures, a complex morphogenic process that recapitulates critical steps during new vessel formation. Previously, we demonstrated that endogenous SDF-1 and CXCR4 are also required for the formation of cordlike structures.33 We show here that EphB2 and EphB4 activation enhances SDF-1induced endothelial cell chemotaxis, a step required for the formation of cordlike structures. Thus, we provide direct evidence for signaling and functional cooperation between endogenous EphB2/EphB4 and SDF-1 in endothelial cells. Previous studies in vitro have documented that soluble, dimeric forms of ephrin ligands and EphB receptors can promote endothelial cell sprouting and formation of capillary-like cords, presumably by stimulating forward or reverse signaling,11,14,15,21 and that interplay exists between Eph signaling and various signaling molecules.12,13,16,21,54,55 However, it was not previously shown that signaling of endogenous EphB2 and EphB4 is required for the formation of capillary-like structures or that in endothelial cells signaling and functional cooperation take place between SDF-1and EphB2 and EphB4.
Analysis of mutant mice has demonstrated indispensable roles for certain ephrin B ligands and EphB receptors in normal vascular development. Particularly striking is the phenotype of mice null for either ephrin B2 or EphB4, which die during embryogenesis and display an apparent block at the primitive capillary plexus stage.6-8 However, evidence for a continued role of EphB/ephrin B function in postnatal angiogenesis is limited and derives from altered expression of these molecules in hereditary vascular malformations, inflammation, and cancer.10,56,57 In these cases, it is unclear whether altered Eph/ephrin expression is a cause or a consequence of disease. Functional assays in vitro showed that various ephrin B and EphB molecules can promote adult endothelial cell growth, sprouting, migration, or assembly of capillary-like structures, presumably by activating forward or reverse signaling.6,11-16 Other experiments showed that ephrin B2-Fc produces repulsive signals and inhibits adult endothelial cell sprouting while activating EphB4 forward signaling15 and reduced VEGF-induced endothelial cell migration and growth.17 Here, using the EphB2 inhibitor SNEW peptide and the EphB4 peptide inhibitor TNYL-RAW,39 we demonstrate that EphB2 and EphB4 function is necessary for mature endothelial cell assembly into vascular structures and thus provide evidence for a continued role of Eph/ephrin in postnatal morphogenic processes. Consistent with the current results, interruption of EphB/ephrin B signaling with soluble forms of EphB2 or eph-rin B1 extracellular domains disrupted neuronal migration to the subventricular zone,58 and a monoclonal antibody directed at EphB2 killed cancer cells expressing the receptor.59 The downstream signaling of EphB/ephrin B is not well understood, in part because of the large number of adaptor proteins that link Eph signaling to various signaling pathways.1,20,60 Earlier studies in neuronal cells provided evidence that ephrin B reverse signaling mediated by the adaptor protein PDZ-RGS3 can neutralize CXCR4 signaling induced by SDF-1 and proposed that this result could explain migration patterns of cerebellar granule cells.24 In another study, stimulation of EphB4 by ephrin B2-Fc led to Akt phosphorylation in human mesenteric endothelial cells.12 Here, we observed greater Akt phosphorylation and chemotaxis when HUVECs were costimulated with ephrin B1-Fc or ephrin B2-Fc plus SDF-1 than when stimulated with SDF-1 alone. Thus, we provide evidence for a link between EphB2 and EphB4 forward signaling and SDF-1induced signaling and for cooperation between the 2 axes in promoting endothelial cell chemotaxis. Evidence indicates that a variety of molecules contribute to the endothelial cell morphogenic process, including the neuropilin-1/VEGFRs and Delta4/Notch systems.61-63 Our current results add EphB2 and EphB4 to the list and suggest a model in which endothelial cells dispersed on Matrigel monolayers migrate toward neighboring endothelial cells in response to SDF-1 gradients generated by some of the endothelial cells.33 This leads to the formation of endothelial cell clusters, which provides an opportunity for EphB2 and EphB4 activation by Ephrin B2 on neighboring cells. Consistently, we found that endogenous EphB2 and EphB4 were not phosphorylated when the cells were incubated with a CXCR4 inhibitor, even after 4 hours, onto Matrigel. We suggest that active EphB2 and EphB4 contribute to the morphogenic process by promoting cell adhesion, elongation, and active protrusion of filopodia. Importantly, by amplifying SDF-1 chemotaxis, active EphB2 and EphB4 would promote the movement of clustered endothelial cells and, in so doing, would contribute to the formation of the network. It is interesting to consider why a system of activation based on cellcell contact such as EphB/ephrin B would participate in endothelial cell cord formation. One possibility is that by amplifying SDF-1 chemotaxis, EphB/ephrin B would ensure the movement of groups of cells already clustered rather than single cells. Evidence for an exquisite interplay among molecules that orchestrate cell proliferation, differentiation, adherence, and movement can be seen in the nervous and the vascular systems, which have complex branching structures.61,64 It appears that SDF-1/ CXCR4 and the Eph/ephrin system cooperate in regulating endothelial cell movement.
We thank Drs Anna C. Berardi, Masashi Narazaki, Joshua Farber, and Cassin Kimmel-Williams for their help in various aspects of this work.
Submitted November 23, 2005; accepted June 27, 2006.
Prepublished online as Blood First Edition Paper, July 13, 2006; DOI 10.1182/blood-2006-05-023341.
Supported by the Intramural Research Program of the National Institutes of Health, National Cancer Institute, Center for Cancer Research, and in part by a grant from the Ministero dell'Istruzione, dell'Università e della Ricerca, University of Brescia, Italy.
G.T. and O.S. designed the research, performed the experiments, and wrote the paper; M.L.S., J.A.M., and P.J.M. performed some of the experiments.
The online version of this article contains a data supplement.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Giovanna Tosato, Basic Research Laboratory, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892; e-mail: tosatog{at}mail.nih.gov.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2006 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||