Blood, 1 November 2006, Vol. 108, No. 9, pp. 3121-3127.
Prepublished online as a Blood First Edition Paper on July 13, 2006; DOI 10.1182/blood-2006-03-006809.
Previous Article | Table of Contents | Next Article 
IMMUNOBIOLOGY
Strong selection of virus-specific cytotoxic CD4+ T-cell clones during primary human cytomegalovirus infection
Ester M. M. van Leeuwen,
Ester B. M. Remmerswaal,
Mirjam H. M. Heemskerk,
Ineke J. M. ten Berge, and
Rene A. W. van Lier
From the Department of Experimental Immunology, and the Department of Internal Medicine, Division of Nephrology, Academic Medical Center, Amsterdam, the Netherlands; and the Department of Hematology, Leiden University Medical Center, Leiden, the Netherlands
 |
Abstract
|
|---|
To obtain insight into human CD4+ T cell differentiation and selection in vivo, we longitudinally studied cytomegalovirus (CMV)specific CD4+ T cells after primary infection. Early in infection, CMV-specific CD4+ T cells have the appearance of interferon (IFN )producing T-helper 1 (TH1) type cells, whereas during latency a large population of CMV-specific CD4+CD28 T cells emerges with immediate cytotoxic capacity. We demonstrate that CD4+CD28 T cells could lyse CMV antigenexpressing target cells in a class IIdependent manner. To clarify the clonal relationship between early and late CMV-specific CD4+ T cells, we determined their V usage and CDR3 sequences. The T-cell receptor (TCR ) diversity in the early CMV-specific CD4+ T-cell population was high in contrast to the use of a very restricted set of TCR sequences in latent infection. T-cell clones found in the late CMV-specific CD4+ T-cell population could not be retrieved from the early CD4+ T-cell population, or were present only at a low frequency. The observation that dominant CMV-specific CD4+ clones during latency were only poorly represented in the acute phase suggests that after the initial control of the virus strong selection and/or priming of novel clones takes place in persistent infections in humans.
 |
Introduction
|
|---|
CD4+ T cells play a central role in the defense against pathogens such as viruses, mostly by helping other cells to acquire and execute their effector functions.1-5 Moreover, they may impede the spread of viruses through the secretion of cytokines such as interferon (IFN ) that block viral replication.6 Last, cytotoxic functions have also been attributed to CD4+ T cells,7 but as yet it is unclear whether recognition of viral antigens can activate the cytolytic machinery.
Human cytomegalovirus (CMV)specific CD4+ T cells have been studied both during their development in primary CMV infection and during the latency phase. In the acute response, CMV-specific CD4+ T cells are highly activated and proliferating, have a CD45RA+CD45R0+CD28+CD27+ phenotype, and produce IFN after stimulation with CMV antigen in vitro.8 Late after primary infection, CMV-specific CD4+ T cells have returned to a resting stage, and the percentage of IFN -producing CMV-specific CD4+ T cells is considerably lower than during the acute infection. Moreover, a considerable number of CMV-specific CD4+ T cells have progressed toward a further differentiated phenotype, characterized by the loss of both CD27 and CD28 and the acquisition of cytolytic molecules such as perforin and granzyme B (grB).8,9 CD4+CD28 grB+ T cells appear to be characteristic for CMV infection because they emerge after primary CMV infection and can be found only in CMV-seropositive individuals.9 Consequently, proliferation and cytokine production by CD4+CD28 T cells can be induced by CMV but not by other viral antigens.
How virus-specific memory CD4+ T cells differentiate in humans is largely unknown. This can be attributed to the difficulty of tracking primary infections and the limitations in measuring antigen-specific CD4+ T cells. From murine studies, it can be deduced that after acute infection, numbers of CD4+ memory T cells, in contrast to CD8+ T cells, decline over time.10 For CD8+ T cells in persistent viral infection, the hierarchy of immunodominant epitopes during the late persistence phase is completely altered, compared with the acute phase of the infection.11-14 Furthermore, it has been shown that during the latency phase, virus-specific cells can still be primed and develop into memory cells.15 These last 2 findings indicate that during acute infection, different types of T cells may be needed compared with the phase of viral persistence. Moreover, different viral antigens may be presented to the T cells during the persistence phase, which can contribute to shaping the clonality of the memory T-cell population.
We studied CMV-specific CD4+ T cells during primary CMV infection to examine whether CMV-specific CD4+ T cells found early in infection differentiated and acquired the features of the late CMV-specific cells, or, alternatively, whether new CMV-specific CD4+ T cells emerged after acute infection and (partially) replaced the early cells. Analysis and comparison of the T-cell receptor (TCR) V CDR3 regions of the different early and late CMV-specific CD4+ T-cell populations allowed us to unravel the interrelationship between the virus-specific cells.
 |
Materials and methods
|
|---|
Subjects
Peripheral blood mononuclear cells (PBMCs) were isolated from renal transplant recipients treated with basic immunosuppressive therapy (cyclosporine A, prednisolone, and mycophenolate mofetil). All subjects gave written informed consent, and the medical ethics committee of the Academic Medical Center, Amsterdam, approved the study.
Transduction of LCLs
Epstein-Barr virus (EBV)transformed lymphoblastoid cell lines (LCLs) were transduced with a retroviral vector expressing green fluorescent protein (GFP) (LCL) or GFP plus the gene product of pp65 (LCL pp65) as described.16,17 Before use, GFP-expressing cells were sorted.
CMV Ag and peptides
CMV antigen (Ag) (Microbix Biosystems, Toronto, ON, Canada) and human leukocyte antigen (HLA)DR4binding CMV pp65-derived peptide IIKPGKISHIMLDVA18 and HLA-A201binding CMV pp65-derived peptide NLVPMVATV were used to stimulate PBMCs directly or loaded on LCL.
Intracellular cytokine staining
PBMCs were incubated for 6 hours with control LCL, LCL pp65, LCL pulsed with CMV Ag or CMV DR4 peptide, or just CMV Ag, CMV A2 peptide or as a positive control Staphylococcus aureus enterotoxin B (SEB; ICN/Fluka, Buchs SG, Switzerland). For the final 5 hours of culture, brefeldin A (Sigma Chemical, St Louis, MO) was added. Cells were fixed and permeabilized, followed by (intracellular) staining with different combinations of IFN -FITC, CD3peridinin chlorophyll protein (PerCP) Cy5.5, CD4-PerCP Cy5.5, CD4-allophycocyanin, CD8-PerCP Cy5.5, CD8-allophycocyanin, CD28-PE, CD69-PE (all from BD Biosciences, San Jose, CA) and CD69-allophycocyanin (Invitrogen, Carlsbad, CA), and analysis by fluorescence-activated cell sorter (FACS).
Cytotoxicity assay
Ex vivo cytotoxicity was assessed by incubating 51Cr-labeled autologous LCLs empty or pulsed with CMV Ag or CMV DR4 peptide with PBMCs at effector-target (E/T) ratios of 1:1, calculated based on absolute numbers IFN -producing CD4+ T cells. HLA-DRblocking antibody R3E2 was used (ascitis, 25 µL/mL). Percentage of specific lysis was calculated from the following formula: percentage of specific release = [(experimental release spontaneous release)/(maximum release spontaneous release)] x 100%.

View larger version (46K):
[in this window]
[in a new window]
|
Figure 1.. CD4+CD28 T cells are class IIrestricted cytotoxic CMV-specific T cells. (A) Dot plots gated on either CD4+ T cells (left column) or CD8+ T cells (right column) show intracellular cytokine staining for IFN in unstimulated cells (medium), cells stimulated with CMV Ag (for CD4+ T cells), or CMV peptide (for CD8+ T cells), with a control autologous LCL, or with an autologous LCL transduced with a pp65 construct. SEB is the positive control. Numbers indicate the percentage of CD69+ IFN + cells within total CD4+ or CD8+ T cells, respectively. (B) Dot plots gated on either total CD4+ lymphocytes, CD4+CD28 cells, or CD4+CD28+ cells (from left to right) show intracellular cytokine staining for IFN in unstimulated cells (medium), cells stimulated with autologous LCLs loaded with CMV Ag, LCLs loaded with a CMV HLA-DR4restricted peptide, or with SEB as a positive control. Numbers indicate the percentage of CD69+ IFN + cells within the population shown. (C) Graph shows the percentage of specific lysis measured in a 51Cr-release assay of total PBMCs using either CMV Ag or CMV HLA-DR4restricted peptideloaded autologous LCLs as target cells. The second bar shows the percentage of lysis of CMV Agloaded autologous LCLs in the presence of a class IIblocking antibody.
|
|
Isolation of CMV-specific cells
IFN -producing CD4+ cells were isolated using IFN- Secretion Assay Detection Kit (PE) (Miltenyi Biotec, Amsterdam, the Netherlands) and subsequently sorted using FACsARIA (BD). For isolation of CD4+CD28 T cells, CD4-PerCP Cy5.5 (BD Biosciences, San Jose, CA), CD28-FITC (Sanquin, Amsterdam, the Netherlands) were used to stain the cells.
Cloning and sequencing
RNA isolated from sorted cells was subjected to template switch-anchored reverse transcriptasepolymerase chain reaction (RT-PCR) by using Super Smart PCR cDNA Synthesis Kit (BD Biosciences Clontech, Palo Alto, CA). V PCR was performed on amplicons as previously described.19 For the spectratyping, samples were mixed with Genescan-500 ROX size standards and run on an ABI 3100 capillary sequencer (Applied Biosystems, Warrington, United Kingdom) in Genescan mode. V PCR products were purified, ligated into pGEM-T Easy vector (Promega, Madison, WI), cloned by transformation of competent DH5 Escherichia coli, and sequenced with an M13 forward primer.
Junctional regionspecific PCR
Sequence-specific primers (5'-TTCTGTGCCAGCAGAAAACA and 5'-AGAAGGCTCTAGGCTGACC) were designed based on J and CDR3 sequence found in the V 8 of CD4+CD28 T cells (week 36) from patient 1 (5'-TTCTGTGCCAGCAGAAAACAGGAGACCGGGGAGCTGTTTTTTGGAGAAGGCTCTAGGCTGACC) to determine whether this could be traced back in early IFN -producing CD4+ T cells (week 9). PCR products were confirmed by cloning and sequencing.
 |
Results
|
|---|
CD4+CD28 T cells recognize CMV-derived peptides in a class IIrestricted fashion
We have previously shown that CD4+CD28 T cells appear after primary CMV infection and produce cytokines upon stimulation with CMV but not other antigens.9 Interestingly, these CMV-specific CD4+CD28 T cells have characteristics normally attributed to CD8+ T cells, such as the expression of the class Ibinding natural killer (NK) receptors CD158b, NKB1, CD94 (dim), and NKG2D (data not shown and Groh et al20). This corresponds to the finding that circulating KIR+ CD4+ T cells are differentiated antigen-primed cells that can produce IFN .21 Since the CD4+CD28 T cells have properties associated with CD8+ T cells, and CD4+ T cells recognizing HLA class I have been described, we assessed whether the CD4+CD28 T-cell population contains cells that can recognize CMV-derived peptides presented in HLA class I. To this end, we used autologous EBV-LCLs that were transduced with a retroviral vector inducing expression of either GFP alone (LCL) or GFP in combination with pp65 (LCL pp65), an immunodominant protein of human CMV. As can be seen in Figure 1A, in contrast to CD8+ T cells from the same donor, CD4+ T cells did not produce IFN upon stimulation with LCL pp65. Still, CMV-specific cells were present in both CD4+ and CD8+ T cells, as can be seen from the response upon stimulation with CMV Ag or CMV peptide, respectively (Figure 1A). This showed that the transduction of the LCLs induced presentation of pp65 peptides in HLA class I, but that these endogenously processed peptides were not recognized by CD4+ T cells. We therefore did not find indications that CD4+CD28 T cells can recognize CMV peptides in a class Ipresented manner.
CD4+CD28 T cells contain grB and perforin and have cytotoxic capacity in redirected killing assays.7 In order to examine whether these cells are able to lyse targets expressing CMV epitopes, we aimed to load CMV peptides on EBV-LCL in class II. Therefore we tested whether CD4+CD28 T cells recognized peptides from autologous LCLs loaded with CMV Ag overnight. As shown in Figure 1B, from the total CD4+ T-cell population, especially the CD4+CD28 T cells produced high amounts of IFN when stimulated with LCLs pulsed with CMV Ag. Recently, a CMV pp65derived peptide (IIKPGKISHIMLDVA) has been described18 that was recognized by CD4+ T cells from HLA-DR4typed individuals. In our assay, CD4+ T cells from an HLA-DR4typed donor also produced very high quantities of IFN upon stimulation with LCLs loaded with this peptide. Notably, CD4+CD28+ T cells did not respond to this peptide, although the total percentage of CD4+CD28+ T cells responding to CMV Ag is already low so a response to one peptide might be difficult to observe (Figure 1B). Concerning CD8+ T cells, no IFN was produced upon stimulation with either CMV Ag or DR4 peptideloaded LCL (data not shown).
Now that it was determined that CD4+ T cells and specifically the CD4+CD28 T cells recognized LCLs presenting CMV epitopes, a chromium release cytotoxicity assay was performed to examine direct antigen-specific cytolysis. Efficient cytotoxicity toward target cells loaded with CMV Ag was observed (Figure 1C). Cytolysis could be blocked by an HLA-DR antibody confirming the HLA class II restriction of the response (Figure 1C). Since recognition of the CMV DR4 peptide also resulted in lysis of the target cells, these findings demonstrate that CD4+CD28 T cells can lyse in a class IIrestricted, CMV-specific manner.
That CD4+ T cells have cytotoxic potential has been described before, but these conclusions were either based on CD4+ T-cell lines or clones, which run the risk of being functionally modulated by in vitro culture,22-24 or the lysis was nonantigen specific.7 Here, for the first time we demonstrate direct ex vivo antigen-specific killing by human CD4+ T cells. The specific contribution of these cytotoxic CD4+ T cells to the maintenance of CMV latency is unknown and cannot be easily assessed in humans.25 Still, a major mechanism of CMV to avoid recognition by the T-cell immune system is down-regulation of class I expression, which will impede elimination of infected cells by class I restricted CD8+ cytotoxic T lymphocytes (CTLs).26 Because class IIexpressing monocytes are the major reservoir of CMV during latency, CD4+CD28 cytotoxic T cells may remove productively infected cells that escape elimination through the CD8+ effector T-cell compartment in a class IIdependent fashion.
Early virus-specific CD4+ T cells have a much broader TCR V repertoire than late virus-specific cells
To answer the question of whether the CMV-specific CD4+ T cells found late after CMV infection originated from the early CMV-specific CD4+ T cells or developed independently, we longitudinally studied 2 patients experiencing a primary CMV infection. The kinetics of the viral load and the CMV-specific CD4+ T cells from both patients are shown in Figure 2A. We isolated CMV-specific IFN -producing CD4+ T cells at the peak of the response (week 9) and around 1 year later. Moreover, the cytotoxic CD4+CD28 T cells were isolated from both patients at late time points (Figure 2A). As can be seen from the sorting gates shown in Figure 2B, we were able to accurately isolate the populations of interest. Figure 2C shows an example of the purity of sorted IFN -producing CD4+ T cells at a late time point. The percentage of IFN -producing CD4+ T cells was 0.9% before sort and this increased to over 99% after sorting. From all these different cell populations, RNA was isolated and amplified, and cDNA was made, after which the TCR V repertoire usage was determined. The first analysis for the presence of V families already clarified that CMV-specific cells found early in primary CMV infection in both patients had a much broader repertoire than the late cells (Figure 3A). In patient 1, this restriction was the most prominent in the CD4+CD28 T cells where only V 6.1 and V 8 could be retrieved. V 6.1 was the only V family found in all 3 CMV-specific CD4+ cell populations studied (Figure 3A). In the second patient, especially the late IFN -producing CD4+ T cells were extremely restricted, as only V families 13, 22, and 24 could be detected (Figure 4A). The restriction in the CD4+CD28 CMV-specific cells from the second patient was less pronounced but the number of V s used was less than in the early cells (20 vs 25 respectively; Figure 4A). The broader repertoire of CMV-specific memory CD4+ T cells in patient 2 compared with patient 1 could be attributed to the difference in height of the viral load. A higher viral load might induce more clonal expansion of the virus-specific cells resulting in clonal exhaustion, as has been described for EBV-specific memory CD8+ T cells.27 Along the same line of reasoning, it might be expected that in healthy individuals the narrowing of the CMV-specific T-cell repertoire will be slower than in renal transplant recipients, like we studied here, who usually have higher viral loads because of the immunosuppressive therapy. This would also explain why high percentages of oligoclonal CD28 T cells are, in nonimmunocompromised individuals, mostly found in the elderly.9,28
From the V s that were found in both patients, spectratyping was performed, in which each peak represents a different CDR3 length. In contrast to the early cells that showed a skewed but still quite broad distribution, very few peaks were present in the samples from the late CMV-specific cells, corroborating the profound restriction in these cell populations (Figure 3B for patient 1 and Figure 4B for patient 2). On average in patient 1, the late IFN -producing cells had only 40% of the number of peaks present in the early IFN -producing cells; the number of different CDR3 lengths in the CD28CD4+ T cells was even reduced to 27% compared with the early CMV-specific cells. For patient 2 these numbers were 90% and 64%, respectively. Markedly, in some cases peak lengths were found in the late CMV-specific cells that were not apparent in the early CMV-specific cells. An example can be seen in Figure 3B for V 16 in case of the late IFN -producing CMV-specific CD4+ T cells and for V 8 in case of the CMV-specific CD4+CD28 T cells. From this we could conclude that certain clones may be abundantly present at later time points but not early in primary infection. This already indicated that there is a very strong selection within the CMV-specific CD4+ T cells and that new clones may arise after the acute response to the viral infection. From patient 2, we also isolated CD4+CD28 T cells 2 years after infection, but these hardly differed from the cells retrieved after 1 year, implying that during the latency stage the CD4+ T-cell population remained relatively stable in this patient (data not shown).
Selection of CMV-specific CD4+ T-cell clones after the acute response
For more extensive comparison between the early and late CMV-specific CD4+ T cells, we sequenced the CDR3 regions. This was done from V s in which identical clones could be expected based on the presence of peaks with a similar length in both early and late cells. The sequences that were found are depicted in Tables 1 and 2 for both patients. Analysis of the different sequences again substantiated the wide variability in clones found in the CMV-specific CD4+ T cells present early in primary infection, whereas particularly in patient 1 the number of clones found in the late CMV-specific CD4+ T-cell population was very limited. Multiple identical clones were found when late CMV-specific IFN -producing and CD28CD4+ T-cell populations were compared. This was to be expected because most IFN -producing CD4+ T cells have lost expression of CD28, and both populations thus overlap. However, most of the clones retrieved from either one of the late CMV-specific CD4+ T-cell populations could not be detected in the early virus-specific CD4+ T cells. Despite the selection for V families with corresponding CDR3 lengths, only a few identical sequences were found in early and late CMV-specific CD4+ T cells in patient 2 (Table 2). In patient 1, not a single sequence from the late IFN -producing or CD28CD4+ T cells matched the early CMV-specific CD4+ T cells (Table 1). A specific PCR was developed based on the sequence found in all V 8 clones of the CD4+CD28 T cells in this patient. No specific product could be detected in the total cDNA of the early IFN -producing CD4+ T cells, only in material that was amplified with V 8-specific primers (Figure 3C), indicating that the particular clone is present in the early population but only at an extreme low frequency. Since we did not perform such a PCR for all clones found in the late CMV-specific CD4+ T-cell populations, we cannot exclude that others are present in the early populations. However, it is clear that the frequency of these clones within early CMV-specific CD4+ T cells can only be very low. In conjunction with the observed strong selection of CMV-specific CD4+ T cells present early in infection, new naive T cells also might be primed during the latency phase, as has been reported in mice.15 In any case, it is apparent that the virus-specific cells late in infection are different from the population of CD4+ T cells responding early.
An interesting question is what factors determine which clones remain present, which clones disappear over time, and even which clones arise later during infection. For CMV-specific CD8+ T cells it has been shown elegantly that the avidity for antigen plays a major role in shaping the clonal dominance.29 It is therefore possible that the same will hold true for CD4+ T cells, but since we do not know the specific peptides these cells recognize it is difficult to clarify this now. Other factors that might be involved in determining the dominance of CMV-specific clones are the efficiency of presentation of different peptides by antigen-presenting cells (APCs) and the abundance of the epitopes. In line with the last, it is not unlikely that the epitopes presented to T cells will change from the acute to the persistent phase of infection, which will probably be reflected in the composition of the T-cell population.
 |
Discussion
|
|---|
In this study, we wanted to clarify whether the late emerging cytotoxic CD4+CD28 T cells originated and differentiated from the IFN -producing CMV-specific CD4+ T cells found early in primary CMV infection. Altogether our data show that the CMV-specific cytotoxic CD4+ T cells present during the persistence stage of CMV infection have developed through very strong selection from the virus-specific cells early in primary viral infection. After the acute response to CMV infection, the clonal diversity of virus-specific CD4+ T cells contracts and dominant clones can be found that were hardly, if at all, present in the early phase. Also in the late CMV-specific CD4+ T cells, CDR3 lengths can be found that differ from those found in early responding cells. This means that some of the late virus-specific cells did not originate from virus-specific cells present early in infection but developed independently in a later phase. To our knowledge, this is the first study describing the development of virus-specific CD4+ T cells from the initial response to primary infection until the persistence phase of the virus. We conclude that the selection of virus-specific CD4+ T cells in persistent infections does not occur only during the acute phase of the response but continues when the virus has become latent. This leads to a CD4+ memory T-cell population in the persistence phase that is not merely a reflection of the virus-specific cells found early in primary infection.
 |
Acknowledgements
|
|---|
The authors would like to thank Berend Hooibrink (Department of Cell Biology and Histology, Academic Medical Center, Amsterdam, the Netherlands) for sorting the different cell populations, technicians from the Department of Clinical Virology for performing CMV PCRs and CMV serology, and Dr P. Baars for critical reading of the manuscript.
 |
Footnotes
|
|---|
Submitted March 2, 2006;
accepted June 26, 2006.
Prepublished online as Blood First Edition Paper, July 13, 2006; DOI 10.1182/blood-2006-03-006809.
Supported by a Vici grant from the Netherlands Organization for Scientific Research (NWO) to R.A.W.v.L.
E.M.M.v.L. designed research, performed research, analyzed data, and wrote the paper; E.B.M.R. performed research and analyzed data; M.H.M.H. contributed vital new reagents and analytical tools; I.J.M.t.B. designed research and wrote the paper; and R.A.W.v.L. designed research and wrote the paper.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Rene A. W. van Lier, Department of Experimental Immunology, Rm K0-146, Academic Medical Center, Meibergdreef 9, 1105 AZ Amsterdam, the Netherlands; e-mail: r.vanlier{at}amc.uva.nl.
 |
References
|
|---|
- DiSanto JP, Bonnefoy JY, Gauchat JF, Fischer A, de Saint Basile G. CD40 ligand mutations in x-linked immunodeficiency with hyper-IgM. Nature. 1993;361: 541-543.[CrossRef][Medline]
[Order article via Infotrieve]
- Ridge JP, Di Rosa F, Matzinger P. A conditioned dendritic cell can be a temporal bridge between a CD4+ T-helper and a T-killer cell. Nature. 1998;393: 474-478.[CrossRef][Medline]
[Order article via Infotrieve]
- Janssen EM, Lemmens EE, Wolfe T, et al. CD4+ T cells are required for secondary expansion and memory in CD8+ T lymphocytes. Nature. 2003;421: 852-856.[CrossRef][Medline]
[Order article via Infotrieve]
- Shedlock DJ, Shen H. Requirement for CD4 T cell help in generating functional CD8 T cell memory. Science. 2003;300: 337-339.[Abstract/Free Full Text]
- Sun JC, Bevan MJ. Defective CD8 T cell memory following acute infection without CD4 T cell help. Science. 2003;300: 339-342.[Abstract/Free Full Text]
- Guidotti LG, Chisari FV. Noncytolytic control of viral infections by the innate and adaptive immune response. Annu Rev Immunol. 2001;19: 65-91.[CrossRef][Medline]
[Order article via Infotrieve]
- Appay V, Zaunders JJ, Papagno L, et al. Characterization of CD4(+) CTLs ex vivo. J Immunol. 2002;168: 5954-5958.[Abstract/Free Full Text]
- Rentenaar RJ, Gamadia LE, van der Hoek N, et al. Development of virus-specific CD4(+) T cells during primary cytomegalovirus infection. J Clin Invest. 2000;105: 541-548.[Medline]
[Order article via Infotrieve]
- van Leeuwen EM, Remmerswaal EB, Vossen MT, et al. Emergence of a CD4+CD28-granzyme B+, cytomegalovirus-specific T cell subset after recovery of primary cytomegalovirus infection. J Immunol. 2004;173: 1834-1841.[Abstract/Free Full Text]
- Homann D, Teyton L, Oldstone MB. Differential regulation of antiviral T-cell immunity results in stable CD8+ but declining CD4+ T-cell memory. Nat Med. 2001;7: 913-919.[CrossRef][Medline]
[Order article via Infotrieve]
- Wherry EJ, Blattman JN, Murali-Krishna K, van der Most R, Ahmed R. Viral persistence alters CD8 T-cell immunodominance and tissue distribution and results in distinct stages of functional impairment. J Virol. 2003;77: 4911-4927.[Abstract/Free Full Text]
- Steven NM, Leese AM, Annels NE, Lee SP, Rickinson AB. Epitope focusing in the primary cytotoxic T cell response to Epstein-Barr virus and its relationship to T cell memory. J Exp Med. 1996;184: 1801-1813.[Abstract/Free Full Text]
- Stevenson PG, Belz GT, Altman JD, Doherty PC. Changing patterns of dominance in the CD8+ T cell response during acute and persistent murine gamma-herpesvirus infection. Eur J Immunol. 1999;29: 1059-1067.[CrossRef][Medline]
[Order article via Infotrieve]
- Woodberry T, Suscovich TJ, Henry LM, et al. Differential targeting and shifts in the immunodominance of Epstein-Barr virus-specific CD8 and CD4 T cell responses during acute and persistent infection. J Infect Dis. 2005;192: 1513-1524.[CrossRef][Medline]
[Order article via Infotrieve]
- Kemball CC, Lee ED, Vezys V, et al. Late priming and variability of epitope-specific CD8+ T cell responses during a persistent virus infection. J Immunol. 2005;174: 7950-7960.[Abstract/Free Full Text]
- Heemskerk MH, Blom B, Nolan G, et al. Inhibition of T cell and promotion of natural killer cell development by the dominant negative helix loop helix factor Id3. J Exp Med. 1997;186: 1597-1602.[Abstract/Free Full Text]
- Heemskerk MH, Hoogeboom M, Hagedoorn R, et al. Reprogramming of virus-specific T cells into leukemia-reactive T cells using T cell receptor gene transfer. J Exp Med. 2004;199: 885-894.[Abstract/Free Full Text]
- Li Pira G, Bottone L, Ivaldi F, et al. Identification of new Th peptides from the cytomegalovirus protein pp65 to design a peptide library for generation of CD4 T cell lines for cellular immunoreconstitution. Int Immunol. 2004;16: 635-642.[Abstract/Free Full Text]
- Maslanka K, Piatek T, Gorski J, Yassai M, Gorski J. Molecular analysis of T cell repertoires: spectratypes generated by multiplex polymerase chain reaction and evaluated by radioactivity or fluorescence. Hum Immunol. 1995;44: 28-34.[Medline]
[Order article via Infotrieve]
- Groh V, Bruhl A, El-Gabalawy H, Nelson JL, Spies T. Stimulation of T cell autoreactivity by anomalous expression of NKG2D and its MIC ligands in rheumatoid arthritis. Proc Natl Acad Sci U S A. 2003;100: 9452-9457.[Abstract/Free Full Text]
- van Bergen J, Thompson A, van der Slik A, et al. Phenotypic and functional characterization of CD4 T cells expressing killer Ig-like receptors. J Immunol. 2004;173: 6719-6726.[Abstract/Free Full Text]
- Fleischer B. Acquisition of specific cytotoxic activity by human T4+ T lymphocytes in culture. Nature. 1984;308: 365-367.[CrossRef][Medline]
[Order article via Infotrieve]
- Lukacher AE, Morrison LA, Braciale VL, Malissen B, Braciale TJ. Expression of specific cytolytic activity by H-2I region-restricted, influenza virus-specific T lymphocyte clones. J Exp Med. 1985;162: 171-187.[Abstract/Free Full Text]
- Krensky AM, Reiss CS, Mier JW, Strominger JL, Burakoff SJ. Long-term human cytolytic T-cell lines allospecific for HLA-DR6 antigen are OKT4+. Proc Natl Acad Sci U S A. 1982;79: 2365-2369.[Abstract/Free Full Text]
- Appay V. The physiological role of cytotoxic CD4(+) T-cells: the holy grail? Clin Exp Immunol. 2004;138: 10-13.[CrossRef][Medline]
[Order article via Infotrieve]
- Mocarski ES Jr. Immunomodulation by cytomegaloviruses: manipulative strategies beyond evasion. Trends Microbiol. 2002;10: 332-339.[CrossRef][Medline]
[Order article via Infotrieve]
- Davenport MP, Fazou C, McMichael AJ, Callan MF. Clonal selection, clonal senescence, and clonal succession: the evolution of the T cell response to infection with a persistent virus. J Immunol. 2002;168: 3309-3317.[Abstract/Free Full Text]
- Posnett DN, Sinha R, Kabak S, Russo C. Clonal populations of T cells in normal elderly humans: the T cell equivalent to "benign monoclonal gammapathy." J Exp Med. 1994;179: 609-618.[Abstract/Free Full Text]
- Price DA, Brenchley JM, Ruff LE, et al. Avidity for antigen shapes the clonal dominance in CD8+ T cell populations specific for persistent DNA viruses. J Exp Med. 2002;202: 1349-1361.

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
C. Jenkins, W. Garcia, M. J. Godwin, J. V. Spencer, J. L. Stern, A. Abendroth, and B. Slobedman
Immunomodulatory Properties of a Viral Homolog of Human Interleukin-10 Expressed by Human Cytomegalovirus during the Latent Phase of Infection
J. Virol.,
April 1, 2008;
82(7):
3736 - 3750.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. J. M. ten Berge and R. A. W. van Lier
Attack of the CD4 clones
Blood,
February 15, 2008;
111(4):
1750 - 1751.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Crompton, N. Khan, R. Khanna, L. Nayak, and P. A. H. Moss
CD4+ T cells specific for glycoprotein B from cytomegalovirus exhibit extreme conservation of T-cell receptor usage between different individuals
Blood,
February 15, 2008;
111(4):
2053 - 2061.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Price, A. D. Bitmansour, J. B. Edgar, J. M. Walker, M. K. Axthelm, D. C. Douek, and L. J. Picker
Induction and Evolution of Cytomegalovirus-Specific CD4+ T Cell Clonotypes in Rhesus Macaques
J. Immunol.,
January 1, 2008;
180(1):
269 - 280.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Vescovini, C. Biasini, F. F. Fagnoni, A. R. Telera, L. Zanlari, M. Pedrazzoni, L. Bucci, D. Monti, M. C. Medici, C. Chezzi, et al.
Massive Load of Functional Effector CD4+ and CD8+ T Cells against Cytomegalovirus in Very Old Subjects
J. Immunol.,
September 15, 2007;
179(6):
4283 - 4291.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|