|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, 15 June 2007, Vol. 109, No. 12, pp. 5463-5472. Prepublished online as a Blood First Edition Paper on February 22, 2007; DOI 10.1182/blood-2006-11-059071.
NEOPLASIA ß-Catenin stabilization stalls the transition from double-positive to single-positive stage and predisposes thymocytes to malignant transformation1 Molecular Oncology Research Institute, Tufts-New England Medical Center, Boston; 2 Dana-Farber Cancer Institute, Harvard Medical School, Boston; 3 Center for Molecular Imaging Research, Massachusetts General Hospital and Harvard Medical School, Charlestown, MA
Activation of ß-catenin has been causatively linked to the etiology of colon cancer. Conditional stabilization of this molecule in pro-T cells promotes thymocyte development without the requirement for pre-TCR signaling. We show here that activated ß-catenin stalls the developmental transition from the double-positive (DP) to the single-positive (SP) thymocyte stage and predisposes DP thymocytes to transformation. ß-Catenin–induced thymic lymphomas have a leukemic arrest at the early DP stage. Lymphomagenesis requires Rag activity, which peaks at this developmental stage, as well as additional secondary genetic events. A consistent secondary event is the transcriptional up-regulation of c-Myc, whose activity is required for transformation because its conditional ablation abrogates lymphomagenesis. In contrast, the expression of Notch receptors as well as targets is reduced in DP thymocytes with stabilized ß-catenin and remains low in the lymphomas, indicating that Notch activation is not required or selected for in ß-catenin–induced lymphomas. Thus, ß-catenin activation may provide a mechanism for the induction of T-cell–acute lymphoblastic leukemia (T-ALL) that does not depend on Notch activation.
The canonical ß-catenin/TCF-LEF signaling is stimulated by wnts, a family of secreted cysteine-rich glycoproteins that bind to cell surface Frizzled receptors. In unstimulated cells, newly synthesized ß-catenin is captured by a large cytoplasmic complex consisting of the tumor suppressor adenomatous polyposis coli (APC), the constitutively active kinase glycogen synthase kinase 3ß (GSK-3ß), and Axin. In this complex, ß-catenin is phosphorylated by GSK-3ß at 4 N-terminal serine and threonine residues and targeted for degradation.1–4 Activation of the Wnt/ß-catenin cascade results in inhibition of the constitutive activity of GSK-3ß5 by the cytoplasmic protein Dishevelled (Dvl).6–9 Consequently, ß-catenin is no longer phosphorylated and can accumulate in the cytoplasm and nucleus. Once in the nucleus, ß-catenin binds to members of the TCF/LEF family of transcription factors, the most downstream components of the Wnt-signaling pathway. For reviews, see van de Wetering10 and Staal and Clevers.11
The Wnt/ß-catenin signaling cascade has been implicated in multiple stages of hematopoietic development. It was proposed that Wnt signaling controls the self-renewal of hematopoietic stem cells (HSCs).12 More recently it was shown that deregulated activation of this pathway enforced cell cycle entry in HSCs leading to the exhaustion of the long-term stem cell pool and a multilineage developmental block.13,14 In the thymus, loss- and gain-of-function studies have indicated that at least 2 stages of thymopoiesis require Wnt/ß-catenin signaling. Thymocytes express the TCF-1 and LEF-1 effectors of the canonical Wnt/ß-catenin signaling pathway. Ablation of TCF-1 activity affects all proliferating stages of thymocyte development including the CD44+CD25+ DN2 and the pre-TCR–dependent CD44–CD25– DN4 and CD8+TCRß– immature single-positive (ISP) stage.15 Enforced expression of inhibitors of Wnt signaling such as soluble Frizzled or Dickkopf proteins in T-cell progenitors leads to a specific block in the DN1 to DN2 developmental transition.16,17 The concomitant ablation of LEF-1 and a TCF-1 hypomorph results in a complete block of embryonic thymocyte development at the ISP stage.18 The TCF-1–/– developmental block at the DN4 stage is ß-catenin dependent since it can be relieved only by transgenic reconstitution with versions of TCF-1 that contain an intact ß-catenin–binding domain.19 Conditional ablation of ß-catenin20 or down-regulation of its activity by the expression of the inhibitor ICAT21 impacts negatively the DN to DP thymocyte transition. On the other hand, we have shown that conditional stabilization of ß-catenin, at the DN3 stage of thymocyte development, promotes aberrant development of DP and SP thymocytes that have reduced TCRß gene VDJ type rearrangements and Notch activity, and are devoid of pre-TCR and ß-Catenin has only recently been implicated in the etiology of hematopoietic malignancies by studies showing that up-regulation of this signaling pathway marks the cancer stem cell for chronic myelogenous leukemia.24 Stabilization of ß-catenin was also linked to B-cell chronic lymphocytic leukemia.25 Earlier studies linked genes targeted by ß-catenin signaling in the etiology of leukemogenesis. Thus, up-regulation of the Wnt/ß-catenin target c-Myc is probably the most uniform feature of hematopoietic malignancies and in particular Burkitt lymphomas,26 as well as T-cell acute lymphoblastic leukemia (T-ALL) of the HOX11 subtype.27 Transgenic mice overexpressing c-Myc develop both B- and T-cell lymphomas.28–31 c-Myb, another Wnt/ß-catenin target was shown to cooperate with c-Myc to cause T-cell lymphoma in transgenic mice.32 FRAT1 activity, which leads to the stabilization of ß-catenin, synergizes with c-Myc to promote T-cell leukemogenesis.33 Perhaps the most striking recent finding in T-ALL was the detection of Notch activating mutations in more than 50% of the examined cases.34 Notch activating mutations were found to superimpose with the activation of other T-ALL–related oncogenic pathways and to span the entire spectrum of the identified T-ALL subtypes.34 Notch appears to be a key player in mouse models of T-cell leukemia as well. Transgenic expression of activated Notch135 or Notch336 mediates thymocyte transformation that is linked with the modulation of pre-TCR signaling, inhibition of the E2A pathway, and up-regulation of c-Myc, as well as E2A-PBX.37 Conversely, lymphomas induced in E2A- or P53-deficient mice or in mice expressing activated Tal1/SCL appear to induce activation of Notch or select for secondary Notch-activating mutations.38–42 The monoclonal nature of these leukemias points to the requirement for additional genetic events. Although activation of Notch1 is a frequent event in human T-ALL as well as mouse lymphoma models, it does not constitute the common denominator for this disease. This is emphasized by the substantial fraction of T-ALL samples that do not show activation of Notch, and the requirement for secondary events in the Notch-dependent animal models of leukemia. It is therefore essential to evaluate pathways of lymphomagenesis that do not depend on Notch. In this report, we provide evidence for the implication of ß-catenin activation in lymphomagenesis. Activation of ß-catenin stalled the developmental transition of DP thymocytes to the SP stage and predisposed these cells to transformation, which required Rag activity, expression of c-Myc, as well as additional genetic events. Significantly, ß-catenin–mediated transformation did not require Notch activation. Our observations indicate that deregulated activation of ß-catenin may be etiologically linked to T-ALL and suggest that ß-catenin may be a suitable target for therapy of a subset of leukemias in which Notch is not activated.
Mice
The Ctnnb Flow cytometry and antibodies
FITC-, PE-, CyChrome-, or APC-conjugated antibodies were purchased from BD PharMingen (San Diego, CA). Antibodies used were as follows: anti–CD4-FITC, -CyChrome, -PE, or -APC (RM4-5); anti–CD8-FITC, -CyChrome, -PE, or -APC (53.6.7); anti–TCRß-PE or -CyChrome (H57); anti–B220-CyChrome (RA3-6B2) or -CD19-PE (1D3); anti–CD44-FITC (IM7) or –PE (IM7); anti–CD25-APC (PC61); anti–pan NK-PE or biotinylated (DX5); anti–Gr1-PE or biotinylated (RB6.782); anti– BrdU labeling Mice were injected intraperitoneally with 1.8 µg freshly resuspended BrdU in water every day. BrdU was also supplied in their drinking water at 0.8 µg/mL, and fresh solutions were provided daily. Mice were processed to estimate BrdU incorporation 2 hours after injection. Thymocytes from BrdU-treated mice were surface stained, permeabilized, and stained intracellularly using the BrdU labeling kit from BD PharMingen. In vivo tumor induction
Lymphoma or thymocyte suspensions were prepared aseptically. Cells (2 x 105) were injected in the tail vein of sublethally irradiated (4 Gy) Rag2–/– Northern blot analysis
Total RNA was isolated from LckCre, LckCre-Ctnnb Southern blot analysis DNA (10 µg) was digested with EcoRI overnight at 37°C, separated on a 0.8% agarose gel, and blotted onto nitrocellulose. The blots were hybridized with a P32-labeled probe from the Jß2 region of the TCRß gene. Microarray analysis Thymocytes or tumor masses were homogenized for RNA isolation using the TRIZOL reagent (Invitrogen) and purified using Qiagen RNeasy minicolumns. RNA samples were processed for hybridization on the Mouse Expression-Array-430 Genechips (Affymetrix, Santa Clara) by the microarray core facility of the Dana-Farber Cancer Institute. Data from all 18 microarrays were loaded onto the DNA-Chip Analyzer (dChip, http://www.dchip.org) program for normalization and quantification. Normalization was performed using the default settings of the dChip software, which is based on perfect match (PM)/mismatch (MM) difference for each gene in each sample.49 The expression values were quantified using the PM-only model and genes were filtered according to 0.30 less than standard deviation/mean less than 10.00 and P call in the array used more than 50%. After filtering, genes were selected for expression differences higher than 3-fold by t test (P < .05) or for significant changes (P < .05). Semiquantitative RT-PCR cDNA was prepared by oligo-dT priming using the Superscript II RT kit (Invitrogen). cDNAs were equilibrated by real-time ß-actin PCR using SYBR-green PCR master mix (Applied Biosystems, Foster City, CA) and an OpticonII (BioRad) PCR machine. Serial 1:5 dilutions were used. PCR products were separated on 1.2% agarose gels. Primers were as follows: ß-actin-F, TGGAATCCTGTGGCATCCATGAAAC; ß-actin-R, TAAAACGCAGCTCAGTAACAGTCCG; Notch1-F, CGGTGTGAGGGTGATGTCAATG; Notch1-R, GAATGTCCGGGCCAGCGCCACC; Notch3-F, GAGGCTACCTTGGCTCTGCT; Notch3-R, GGCAGCCTGTCCAAGTGATCT; Deltex1-F, CCCTCGCCACTGCTACCTA; Deltex1-R, AAAGGGAAGGCGGGCAACTC; Hes1-F, CAGCCAGTGTCAACACGACAC; Hes1-R, TCGTTCATGCACTCGCTGAG; Lunatic-Fringe-F, TTCATGAGCACGGCAGAGCGCATCC; Lunatic-Fringe-R, TCCTGTCCAGAATGGCAGCCTGTGG. Western blot Thymocytes were lysed in radioimmunoprecipitation assay (RIPA) buffer supplemented with Protease Inhibitor Cocktail (Roche Applied Science, Indianapolis, IN). Lysates (80 µg) were separated on 10% SDS-PAGE and transferred onto nitrocellulose membranes (GE-Healthcare Bio-Sciences, Piscataway, NJ). Nonspecific binding was blocked by incubation in blocking buffer (5% nonfat milk in PBST), followed by incubation with the primary antibodies and the appropriate horseradish peroxidase (HRP)–conjugated secondary antibodies diluted in blocking buffer. Antimouse anti–ß-catenin was from BD-Biosciences (Franklin Lakes, NJ), and anti-GAPDH (1:3000) was from Abcam (Cambridge, United Kingdom). The signal was detected using the enhanced chemiluminescence Plus (ECL-Plus kit; GE-Healthcare Bio-Sciences).
Stabilization of ß-catenin induces a developmental block in the DP to SP transition
We have addressed the role of ß-catenin in thymocyte development using a mouse model (Ctnnb
To distinguish between these 2 possibilities, we crossed the Ctnnb
Although the overall thymic cellularity of CD4Cre-Ctnnb  ex3 mice was comparable to that of LckCre control mice, like LckCre-Ctnnbex3 mice they had a reduced number of SP thymocytes (P = .013 for CD4+ and P = .007 for CD8+). The average fraction of CD4+ cells was 2.45% and 4.2% in CD4Cre-Ctnnbex3 and LckCre-Ctnnbex3 mice, respectively, and of CD8+ cells was 1% and 1.4% in CD4Cre-Ctnnbex3 and LckCre-Ctnnbex3 mice, respectively, indicating that CD4Cre-Ctnnbex3 and LckCre-Ctnnbex3 mice had similarly reduced fraction of SP thymocytes (P = .14 for CD4+ and P = .34 for CD8+). This correlated with an increased fraction of CD4+CD8+ DP thymocytes in CD4Cre-Ctnnbex3 (P = .001) and LckCre-Ctnnbex3 (P = .001) mice compared to LckCre mice. Thus, the thymic profile of CD4Cre-Ctnnbex3 and LckCre-Ctnnbex3 mice suggested that in both instances the stabilization of ß-catenin induced a developmental block in the transition from the DP to the SP stage.
To determine the nature of the developmental block, we compared the rate of generation and loss of DP and SP thymocytes in control and CD4Cre-Ctnnb
Stabilization of ß-catenin induces T-cell lymphomas
Both LckCre-Ctnnb
Lymphomas in both mouse strains consisted of highly proliferative cells, as measured ex vivo by surface staining for CD4 and CD8 followed by intracellular staining with 7AAD and FACS analysis. More than 30% of the cells in LckCre-Ctnnb ex3 (n = 4) and CD4Cre-Ctnnbex3 (n = 5) lymphomas were actively dividing compared to less than 10% in LckCre (n = 6) control thymocytes. Proliferation increased sharply upon transformation since pretransformed LckCre-Ctnnbex3 (n = 7) and CD4Cre-Ctnnbex3 (n = 6) DP thymocytes (Figure 3D) showed similar proliferation rates as control thymocytes.
The increased proliferation only after transformation indicated that the process of lymphomagenesis was likely selective for secondary events. To confirm this hypothesis we determined the clonality of ß-catenin–induced lymphomas by examining the diversity of TCRß gene rearrangements. DNA isolated from 3 LckCre-Ctnnb
The malignant nature of the ß-catenin–induced lymphomas, and their ability to grow autonomously and invade the organs of secondary recipients, was examined by transferring 2 x 105 tumor cells or a similar number of pretransformed thymocytes from CD4Cre-Ctnnb ex3 mice to sublethally irradiated Rag2–/– c–/– recipients (4 Gy). Three independent lymphomas (2 CD4Cre-Ctnnbex3 and 1 LckCre-Ctnnbex3) were injected into 9 independent recipients. Tumor-derived CD4+CD8+ DP cells were detectable in the blood of all mice injected with lymphoma cells but not those receiving pretransformed CD4Cre-Ctnnbex3 thymocytes 3 weeks after transfer (Figure 4B). These DP cells were of donor origin showing surface expression of  ßTCR and high levels of ß-catenin (Figure 4C). Recipient mice showed signs of poor health 3 to 5 weeks after transfer and were killed. Histologic analyses indicated that lymphoma cells had invaded most of the recipient's tissues including spleen, bone marrow, liver, lungs, and brain (data not shown). Thus, ß-catenin–dependent lymphomas were malignant and could cause leukemia when transferred to healthy recipients. ß-Catenin–mediated lymphomagenesis depends on Rag activity
The incidence and latency of leukemogenesis varied significantly among the different mouse strains with stabilized ß-catenin. The median latency of leukemia in LckCre-Ctnnb
To distinguish between the requirement for pre-TCR/ ßTCR or Rag activity, we generated Rag-deficient mice that expressed LckCre-Ctnnbex3 as well as the MHC class II–selected transgenic TCR-6.545 or the MHC class I–selected transgenic TCR-CL446 (LckCre-Ctnnbex3-TCR(CL4)-Rag2–/– and LckCre-Ctnnbex3-TCR(6.5)-Rag2–/–). These animals express transgenic ßTCRs that recognize epitopes of the influenza hemagglutinin (HA) protein. Thymocytes from these compound mutant mice progressed to the DP and SP stages through signaling from the pre-TCR and the transgenic ßTCRs (data not shown). We also generated mice lacking the pre-TCR (pT–/–) but expressing CD4Cre and Ctnnbex3(CD4Cre-Ctnnbex3-pT–/–), and therefore stabilized ß-catenin in the few thymocytes that bypass the pre-TCR–dependent DN3 block and reach the DP stage. While LckCre-Ctnnbex3-TCR(CL4)-Rag2–/– and LckCre-Ctnnbex3-TCR(6.5)-Rag2–/– mice did not develop leukemia (Figure 5A), CD4Cre-Ctnnbex3-pT–/– mice developed thymic lymphomas. The latency (average latency: 101 days) and incidence of lymphomagenesis were similar to that of LckCre-Ctnnbex3 mice (P = .88 by log-rank test), while CD4Cre-Ctnnbex3 mice showed a reduced incidence and latency. Both LckCre-Ctnnbex3 and CD4Cre-Ctnnbex3-pT–/– strains have a reduced subset of ßTCR+ DP cells compared to CD4Cre-Ctnnbex3 mice, supporting the notion that although ßTCR may not be sufficient (ie, in the absence of Rag there is no transformation) it may be necessary for transformation.
Of interest, the leukemic profile of the CD4Cre-Ctnnb ß-catenin–dependent lymphomagenesis does not require Notch activation
To determine expression changes associated with stabilization of ß-catenin and the resulting transformation, we compared the expression profiles of thymocytes from LckCre and CD4Cre-Ctnnb
We compared the obtained microarray data using the DNA-Chip Analyzer (dChip) software. Samples were normalized and filtered according to the default parameters of the program and genes with more than 3-fold expression differences were determined. Comparison of LckCre controls to CD4Cre-Ctnnb
An intriguing observation from the microarray analyses was the more than 3-fold reduction in the levels of Notch1 expression in thymocytes with stabilized ß-catenin and the resulting lymphomas. The Notch-positive regulator Lunatic-Fringe was also in the list of genes with more than 3-fold reduced expression in thymocytes with stabilized ß-catenin (Tables S1–S2). This was in line with our previous observation that DN4-stage thymocytes with activated ß-catenin have down-regulated Notch signaling.23 However, Notch1-activating mutations have been detected in more than 50% of all examined cases of human T-ALL.34 To determine Notch-dependent expression in ß-catenin–induced lymphomas, we interrogated the microarray analyses for significant expression changes (P < .05) in members of the Notch family as well as target genes.50–52 These analyses indicated that the expression of Notch1 and Notch3, as well as the targets Deltex-1, Hes-1, and the positive regulator Lunatic-Fringe, was reduced in CD4Cre-Ctnnb
c-Myc up-regulation marks ß-catenin lymphomas and is required for transformation
Additional expression changes were detected by Northern blot analyses using RNAs extracted from LckCre, LckCre-Ctnnb
Since c-Myc has been found up-regulated in a variety of leukemias and its transgenic overexpression was shown to lead to T- and B-cell lymphomas in mice, we sought to determine the requirement for c-Myc activity in ß-catenin lymphomagenesis. To this aim, we crossed mice that allow Cre-mediated ablation of c-Myc onto the CD4Cre-Ctnnb ex3 background.48 The resulting compound mutant mice showed efficient and simultaneous deletion of the floxed Myc allele and stabilization of ß-catenin (Figure 7B). CD4Cre-Mycfl/fl mice showed thymocyte development and cellularity comparable to wild-type mice (Figure 7C). The thymic profile of the CD4Cre-Ctnnbex3-Mycfl/fl mice (Figure 7C) closely resembled that of CD4Cre-Ctnnbex3 mice (Figure 2A). While heterozygous loss of c-Myc (CD4Cre-Ctnnbex3-Mycfl/+) resulted in frequent lymphomas, mice with homozygous ablation of this protein (CD4Cre-Ctnnbex3-Mycfl/fl) did not develop lymphomas. This finding demonstrated that c-Myc activity was required for ß-catenin–mediated lymphomagenesis.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Top
Abstract
Introduction
-PE or biotinylated; and anti–Ter-PE or biotinylated (Ly-76). Anti–ß-catenin-FITC was from BD Transduction Laboratories (Lexington, KY). Biotinylated antibodies were revealed with streptavidin-PE or streptavidin-CyChrome. Staining was in fluorescence-activated cell sorter (FACS) buffer (PBS with 2% fetal bovine serum) for 30 minutes on ice. Samples were washed with FACS buffer. Intracellular staining for ß-catenin or 7AAD was performed after surface staining according to Ioannidis.
