Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 15 February 2007, Vol. 109, No. 4, pp. 1593-1601.
Prepublished online as a Blood First Edition Paper on October 10, 2006; DOI 10.1182/blood-2006-05-025197.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
blood-2006-05-025197v1
109/4/1593    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Renckens, R.
Right arrow Articles by van der Poll, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Renckens, R.
Right arrow Articles by van der Poll, T.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Immunobiology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

IMMUNOBIOLOGY

Plasminogen activator inhibitor type 1 is protective during severe Gram-negative pneumonia

Rosemarijn Renckens1,2, Joris J. T. H. Roelofs3, Peter I. Bonta4, Sandrine Florquin3, Carlie J. M. de Vries4, Marcel Levi5, Peter Carmeliet6, Cornelis van't Veer1,2, and Tom van der Poll1,2

1 Center for Infection and Immunity Amsterdam, 2 Center for Experimental and Molecular Medicine, Departments of3 Pathology, 4 Biochemistry, and 5 Vascular Medicine, Academic Medical Center, University of Amsterdam, The Netherlands; 6 Center for Transgene Technology and Gene Therapy, University of Leuven, Belgium


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Authorship
 References
 
Plasminogen activator inhibitor type-1 (PAI-1) levels are consistently elevated in patients with severe pneumonia and sepsis and highly predictive for an unfavorable outcome. In addition, pneumonia is associated with strongly elevated PAI-1 levels in the pulmonary compartment. However, whether PAI-1 causally affects antibacterial host defense in vivo remains unknown. We report here that pneumonia caused by the common respiratory pathogen Klebsiella pneumoniae is associated with local production of PAI-1 in the lungs of wild-type mice. PAI-1 deficiency impaired host defense as reflected by enhanced lethality and increased bacterial growth and dissemination in mice with a targeted deletion of the PAI-1 gene. Conversely, transgenic overexpression of PAI-1 in the lung using a replication-defective adenoviral vector markedly improved host defense against Klebsiella pneumonia and sepsis. PAI-1 deficiency reduced accumulation of neutrophils in the lungs during pneumonia, whereas PAI-1 overexpression in healthy lungs resulted in neutrophil influx, suggesting that PAI-1 protects the host against Klebsiella pneumonia by promoting neutrophil recruitment to the pulmonary compartment. These data demonstrate for the first time that PAI-1 is essential for host defense against severe Gram-negative pneumonia.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Authorship
 References
 
Bacterial pneumonia remains associated with a high morbidity and mortality. Because of the high incidence of pneumonia and the increasing antimicrobial resistance,1 further understanding of the nonspecific host defense is necessary to pave the way for new treatment options. During pneumonia several mediator systems become activated, culminating in a profound inflammatory response together with increased procoagulant activity and suppression of the fibrinolytic system.2,3 Plasminogen activator inhibitor type-1 (PAI-1) is the main inhibitor of the fibrinolytic system. By inactivating both urokinase type plasminogen activator (uPA) and tissue-type plasminogen activator (tPA), PAI-1 inhibits plasmin generation and subsequent fibrin degradation. Several studies in patients with pneumonia revealed elevated PAI-1 levels in bronchoalveolar lavage fluid,25 and in patients with ventilator-associated pneumonia high PAI-1 concentrations correlated with a poor outcome.4 In addition, elevated circulating levels of PAI-1 predicted lethality in patients with sepsis,611 and the most common site of infection in such patients is the respiratory tract.12,13 Hence, observational studies are highly suggestive of a role for PAI-1 in the pathogenesis of pneumonia and sepsis.

Besides its classic role as an inhibitor of fibrinolysis, PAI-1 has been implicated as a mediator in several other processes, including wound healing, atherosclerosis, tumor angiogenesis, rheumatoid arthritis, fibrosis, metabolic disturbances, and glomerulonephritis.1421 Of interest, different roles for PAI-1 in leukocyte migration have been described. For instance, PAI-1 can inhibit integrin-mediated cell migration by the binding to vitronectin, thereby competing with integrins and the uPA receptor (uPAR).2224 In contrast, PAI-1 can support interleukin-8 (IL-8)–mediated neutrophil transendothelial migration by inhibition of the constitutive shedding of endothelial IL-8/heparan sulfate/syndecan-1 complexes.25 Furthermore, the absence of PAI-1 prevents cancer invasion in mice,17 which provides more evidence for a stimulatory role of PAI-1 in cell migration. Moreover, bleomycin-induced lung inflammation was almost absent in PAI-1 gene–deficient (PAI-1–/–) mice and strongly enhanced by transgenic PAI-1 overexpression.15 The migration of leukocytes, especially neutrophils, to the lungs is an important part of the innate immune response to bacterial pneumonia.26 Therefore, in theory, elevation of PAI-1 levels might influence the inflammatory response and host defense during severe pneumonia.

Recently, our laboratory showed that PAI-1–/– mice have an unremarkable host defense in a model of community-acquired pneumonia caused by the Gram-positive bacterium Streptococcus pneumoniae.5 In light of the clear association between elevated PAI-1 concentrations and the outcome of severe pneumonia and sepsis,4,611 we here wondered whether PAI-1 plays a functional role in the host response to severe Gram-negative pneumonia and the ensuing sepsis syndrome. Therefore, in the present study we studied the local and systemic consequences of PAI-1 deficiency and adenoviral-mediated PAI-1 overexpression in a murine model of pneumonia and sepsis caused by Klebsiella pneumoniae, a common Gram-negative respiratory pathogen.1,27,28 We show for the first time an important protective role for PAI-1 in host defense against severe pneumonia.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Authorship
 References
 
Animals

The Institutional Animal Care and Use Committee approved all experiments. Normal C57BL/6 wild-type (Wt) mice were obtained from Harlan Sprague-Dawley (Horst, The Netherlands). PAI-1–/– mice on a C57BL/6 genetic background were obtained from the Jackson Laboratory (Bar Harbor, ME). Female, 8- to 10-week-old mice were used in all experiments.

Klebsiella pneumoniae infection

Pneumonia was induced by intranasal inoculation of 1 x 104 colony-forming units (CFU) K pneumoniae serotype 2 (ATCC 43816; American Type Culture Collection, Manassas, VA) as described before.29,30

Assays

Lung homogenates were prepared as described.29,30 The following enzyme-linked immunosorbent assays (ELISAs) were used: D-dimer (Asserachrom D-dimer; Roche, Woerden, The Netherlands); murine PAI-1 and human PAI-1 (both from Kordia, Leiden, The Netherlands); macrophage inflammatory protein 2 (MIP-2) and keratinocyte-derived chemokine (KC) (both from R&D Systems, Abingdon, United Kingdom); and myeloperoxidase (MPO; Hycult Biotechnology BV, Uden, The Netherlands). Tumor necrosis factor-{alpha} (TNF-{alpha}), IL-6, interferon-{gamma} (IFN-{gamma}), and IL-10 levels were determined using a cytometric beads array (CBA) multiplex assay (BD Biosciences, San Jose, CA). Aspartate aminotransferase (ASAT) and alanine aminotransferase (ALAT), urea, and creatinine were determined with kits from Sigma (St Louis, MO), using a Hittachi analyzer (Boehringer Mannheim, Mannheim, Germany).

Evaluation of PAI-1 mRNA

Total RNA was isolated using the RNeasy Mini Kit system (Qiagen, Venlo, The Netherlands) and treated with RQ1 RNase-Free DNase (Promega, Leiden, The Netherlands) and reverse transcribed using oligo (dT) primer and Moloney murine leukemia virus reverse transcriptase (Invitrogen, Breda, The Netherlands). Reverse-transcription–polymerase chain reactions (RT-PCRs) were performed in a LightCycler (Roche) apparatus using the following conditions: 5-minute 95°C hot-start, followed by 40 cycles of amplification (95°C for 15 seconds, 60°C for 5 seconds, 72°C for 20 seconds). For quantification, standard curves were constructed by PCR on serial dilutions of a concentrated cDNA, and data were analyzed using LightCycler software. Gene expression is presented as a ratio of the expression of the housekeeping gene ß2-microglobulin.31 Primers used for murine PAI-1 were as follows: mPAI-1 S1019, ATCCTGCCTAAGTTCTCTCTG; mPAI-1 AS1164, ACCTCGATCCTGACCTTTTG. Primers for the housekeeping gene were as follows: mB2M S74, TGGTCTTTCTGGTGCTTGTCT; mB2M AS231, ATTTTTTTCCCGTTCTTCAGC. Oligonucleotides were derived from Eurogentec (Seraing, Belgium). Visualization of PAI-1 mRNA by in situ hybridization was performed as described previously using radiolabeled [35S]-UTP (Amersham, Arlington Heights, IL) human (NM_;000602, bp 76-1109) and mouse (NM_;008871) PAI-1–specific riboprobes.32

Determination of survival and bacterial outgrowth

For survival studies, mice (n = 12-16 per group) were monitored every 12 hours for 10 days after infection. Bacterial loads were determined as described (n = 8 per group).29,30

Histologic examination

Hematoxylin and eosin–stained lung and liver slides were scored according to the following parameters: (1) the number of thrombi counted in 5 fields at a magnification of x 200 (lungs) or x 100 (liver); (2) the presence and degree of inflammation, which included the presence of interstitial influx of leukocytes, endothelialitis, edema, pleuritis, and bronchitis; and (3) for liver only, the presence and degree of necrosis. All parameters were rated from 0 to 3, wherein 0 = absent, 1 = occasionally, 2 = regularly, and 3 = massively.

Slides were mounted with glycergel (DAKO, Glostrup, Denmark) and stained with hematoxylin (inset images in Figures 3, 5, and 7 were stained with Ly6G). Images were visualized using an Olympus BX51 microscope, and were acquired using an Olympus DP70 camera as well as DPController software version 1.2 and DP Manager software version 1.2 (Olympus Optical, Zoeterwoude, The Netherlands). Objectives used were as follows: 10x/0.30 numerical aperture (NA) UPlanF1 (Figures 1, 3, 4), 20x/0.50 NA UPlan F1 (Figures 3 insets, 5, 5 insets, 6, and 7), or 40x/0.85 NA UPlanApo (Figure 7 insets).

Adenovirus-mediated transfer of PAI-1 gene

The replication-defective adenoviral vector expressing human PAI-1 cDNA (Ad.PAI-1) was generated as described.33,34 After transfection, recombinant viral plaques were harvested and amplified as described.35,36 To overexpress PAI-1 in the lung, we administered 5 x 108 plaque-forming units (PFU) Ad.PAI-1 diluted in sterile NaCl 0.9% to a final volume of 50 µL intranasally. As a control adenovirus, Ad.RR5 was used at the same dose. The dose of 5 x 108 PFU was based on previous studies using adenoviral gene transfer to murine lungs.3740

Statistical analysis

All data are expressed as means ± SEM. Comparisons between groups were conducted using the Mann-Whitney U test. Survival was compared by Kaplan-Meier analysis followed by a log-rank test. Significance was set at P values less than .05.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Authorship
 References
 
Endogenous PAI-1 is up-regulated during Klebsiella pneumonia

To obtain insight into local PAI-1 concentrations in the lungs, we measured PAI-1 protein levels in lung homogenates of uninfected Wt mice and Wt mice with a respiratory tract infection with K pneumoniae (Figure 1A). PAI-1 was detected at levels of 2.5 to 4.1 ng/mL in lung homogenates of uninfected mice. Klebsiella pneumonia was associated with a mean 9-fold increase in lung PAI-1 levels at 24 hours and a 7-fold increase at 48 hours after infection (both P < .05 versus controls). This rise in PAI-1 protein was a result of an increased expression of PAI-1 mRNA in the lungs during infection, as shown by RT-PCR (Figure 1B) and in situ hybridization (Figure 1C-D). Pulmonary PAI-1 expression was mostly colocalized with vessel walls and inflammatory infiltrates.


Figure 1
View larger version (80K):
[in this window]
[in a new window]

 
Figure 1. Endogenous PAI-1 levels increase during Klebsiella pneumonia. PAI-1 protein concentrations in lung homogenates (A) and mRNA levels in lung tissues (B) were determined before and at 24 and 48 hours after intranasal (i.n.) administration of K pneumoniae. Data are means ± SE. n = 6 per group. *P < .05 versus 0 hours (uninfected mice). Murine PAI-1 in situ hybridization was performed on lung tissues before (C) and 48 hours after (D) infection. Positive signal is indicated in black. Magnification, x 100.

 
Fibrinolysis is enhanced in PAI-1–/– mice during K pneumoniae pneumonia

Since PAI-1 is the main inhibitor of the fibrinolytic system, we wanted to investigate whether PAI-1 deficiency influenced the fibrinolytic activity in the lungs during K pneumoniae pneumonia. Therefore, we measured the levels of D-dimer, an end-product derived from plasmin-mediated degradation of cross-linked fibrin clots, in lung homogenates of Wt and PAI-1–/– mice at 0, 24, and 48 hours after intranasal inoculation of K pneumoniae. As expected, PAI-1–/– mice showed a stronger increase in D-dimer levels during infection than Wt mice (Figure 2A).


Figure 2
View larger version (10K):
[in this window]
[in a new window]

 
Figure 2. PAI-1 deficiency impairs host defense against Klebsiella pneumonia. (A-C) Wt and PAI-1–/– mice were inoculated intranasally with 104 CFU K pneumoniae. D-dimer was measured in lung homogenates at 0, 24, and 48 hours after infection (A). Survival was monitored (B) and bacterial load was determined at 24 and 48 hours after infection (C). Data are means ± SE of 8 mice per genotype at each time point. Survival was evaluated using 12 mice per genotype. *P < .05 versus Wt mice at the same time point. **P < .01.

 
PAI-1 deficiency accelerates lethality due to K pneumoniae pneumonia

To study the contribution of endogenous PAI-1 to the outcome of Klebsiella pneumonia, Wt and PAI-1–/– mice were intranasally inoculated with K pneumoniae and monitored for 10 days (Figure 2B). Although the first deaths occurred after 2 days in both strains, lethality was significantly accelerated among PAI-1–/– mice thereafter (P < .05). Indeed, after 3 days 64% of PAI-1–/– versus 18% of Wt mice had died, after 4 days 82% of PAI-1–/– versus 45% of Wt mice had died, and after 6 days 91% of PAI-1–/– versus 55% of Wt mice had died. Thus, the lack of PAI-1 rendered mice more susceptible to K pneumoniae–induced death.

PAI-1 deficiency facilitates bacterial outgrowth and dissemination

To investigate whether the enhanced lethality of PAI-1–/– mice was associated with changes in bacterial outgrowth, we examined the bacterial loads in the lungs of PAI-1–/– and Wt mice at 24 and 48 hours after induction of pneumonia (ie, directly before the first mice started dying). At 24 hours, bacterial counts in the lungs were similar in PAI-1–/– and Wt mice. However, after 48 hours the number of Klebsiella CFU was almost 50-fold higher in the lungs of PAI-1–/– mice when compared with Wt mice (P < .01; Figure 2C). To obtain insight into the dissemination of the infection, we examined the number of positive blood cultures in PAI-1–/– and Wt mice. At 24 hours after infection, 60% of the PAI-1–/– mice showed positive blood cultures compared with 40% of the Wt mice; at 48 hours, all PAI-1–/– mice were bacteremic compared with 62.5% of the Wt mice. Moreover, PAI-1–/– mice with positive blood cultures had a higher bacterial load in their circulation than WT mice with positive cultures (24 hours: 1.45 ± 0.89 x 103 CFU/mL versus 12.46 ± 3.55 x 103 CFU/mL, respectively [P < .05]; 48 hours: 2.14 ± 2.12 x 107 CFU/mL versus 3.48 ± 2.46 x 107 CFU/mL, respectively [not significant]). Thus, endogenous PAI-1 serves to limit the outgrowth of K pneumoniae in the lung and the ensuing dissemination to the blood stream.

Influence of PAI-1 deficiency on pulmonary neutrophil recruitment during pneumonia

Pneumonia results in inflammatory-cell recruitment and local inflammation, which is an integral part of the host immune response.26,41 Therefore, we performed semiquantitative analyses of lung histologic slides prepared from PAI-1–/– and Wt mice 48 hours after infection. At this time point, all mice showed inflammatory infiltrates, characterized by interstitial inflammation together with endothelialitis, bronchitis, pleuritis, and edema (Figure 3A-B). Although there was no difference in total lung histopathology scores between PAI-1–/– and Wt mice (Figure 3C), the lungs of PAI-1–/– mice clearly contained fewer infiltrating neutrophils as visualized by Ly-6 staining (Figure 3A-B insets). The reduced neutrophil influx in PAI-1–/– mice was confirmed by measurements of MPO levels in whole lung homogenates. Indeed, whereas at 24 hours after infection MPO concentrations were similar in the lungs of PAI-1–/– and Wt mice, at 48 hours lung MPO levels were lower in the former mouse strain (P < .05, Figure 3E). Since cytokines and chemokines are important regulators of the inflammatory response to bacterial pneumonia,26,41 we also measured the levels of KC, MIP-2, TNF-{alpha}, IL-6, IFN-{gamma}, and IL-10 in lung homogenates obtained at 24 and 48 hours after infection. No differences were found between PAI-1–/– and Wt mice with the exception of IL-6 levels after 48 hours, which were higher in PAI-1–/– mice (data not shown). In light of recent findings described by Arndt et al,42 revealing reduced neutrophil influx in BALF of PAI-1–/– mice after inhalation of LPS aerosols in the presence of elevated KC plasma levels, we measured the concentrations of this mouse CXC chemokine in plasma samples obtained 24 and 48 hours after infection with Klebsiella (Figure 3F). Indeed, PAI-1–/– mice displayed higher KC plasma levels than Wt mice at both time points (P < .05). Together, these data indicate that the major differences between PAI-1–/– and Wt mice with respect to the inflammatory response to Klebsiella pneumonia were a diminished recruitment of neutrophils into lung tissue combined with increased intravascular KC.


Figure 3
View larger version (101K):
[in this window]
[in a new window]

 
Figure 3. Influence of PAI-1 deficiency on lung inflammation during Klebsiella pneumonia. Representative HE stainings of lung tissue of Wt (A) and PAI-1–/– (B) mice at 48 hours after intranasal inoculation of 104 CFU K pneumoniae. Original magnification, x 100. Insets show representative neutrophil stainings at the same time point; original magnification, x 200. (C) Graphic representation of the degree of lung inflammation, determined according to the scoring system described in "Histologic examination." As a reference, normal mouse lung tissue is shown in panel D. (E) MPO levels and (F) plasma KC levels were determined at 24 and 48 hours after infection. (C,E-F) Data are means ± SE. n = 8 per group at each time point. *P < .05 versus Wt mice at the same time point.

 
Effect of PAI-1 deficiency on distant organ injury

Considering that PAI-1–/– mice displayed an accelerated lethality together with more frequent bacteremia, we determined whether the enhanced dissemination of the infection had led to distant organ injury. Therefore, we performed histopathologic analyses of liver tissue and evaluated liver injury and kidney function by clinical chemistry at 48 hours after infection in both PAI-1–/– and Wt mice. At this time point, all mice showed evidence of hepatic injury, as characterized by inflammation of liver tissue (the influx of leukocytes into the hepatic parenchyma), thrombi formation, and foci of liver necrosis; the mean liver histology scores were similar in PAI-1–/– and Wt mice (2.7 ± 0.7 versus 3.4 ± 0.6, respectively). In accordance, the plasma levels of ASAT and ALAT, indicative of hepatocellular injury, were indistinguishable in both mouse strains (data not shown). Moreover, plasma creatinine and urea levels were similar in PAI-1–/– and Wt mice (data not shown). Hence, these data suggest that PAI-1 deficiency does not have a significant impact on distant organ injury during K pneumoniae pneumonia and sepsis, at least not during the first 48 hours after infection.

Transgenic overexpression of PAI-1 reduces lethality and limits bacterial outgrowth during Klebsiella pneumonia

Having established that endogenous PAI-1 contributes to an effective host defense against Klebsiella pneumonia, we next determined whether enhanced expression of PAI-1 would be of benefit to the host in the same model. For this, we used Ad.PAI-1, which previously has been used successfully to enhance systemic PAI-1 expression after intravenous administration.14 Considering that intrapulmonary delivery of adenoviral vectors has been demonstrated to result in increased expression of various transgenes in the respiratory tract,3740 we here examined whether intranasal administration of Ad.PAI-1 led to expression of human PAI-1 in the lungs. Indeed, human PAI-1 protein was present in the lungs (but not in plasma); human PAI-1 lung concentrations peaked at 24 hours after inoculation and remained elevated for at least 2 more days (Figure 4A). In addition, in situ hybridization was performed on lung tissues obtained 24 hours after intranasal administration of a control adenovirus Ad.RR5 or Ad.PAI-1 (Figure 4B and C, respectively). Transgenic PAI-1 expression was absent in the Ad.RR5-inoculated mice. In the Ad.PAI-1–treated mice, human PAI-1 mRNA expression was found diffuse throughout the lungs. As expected, human PAI-1 mRNA was not detected in livers (data not shown), suggesting that human PAI-1 expression remained confined to the pulmonary compartment. Based on these experiments, we decided to determine the effect of enhanced pulmonary PAI-1 expression on host defense during pneumonia by intranasal administration of Ad.PAI-1 or Ad.RR5 24 hours prior to intranasal infection with K pneumoniae. Mice treated with Ad.PAI-1 showed strongly reduced D-dimer levels during pneumonia compared with Ad.RR5-treated mice, indicating that the overexpression of human PAI-1 in murine lungs resulted in local inhibition of the fibrinolytic system (Figure 4D). Furthermore, mice treated with Ad.PAI-1 showed a significantly delayed mortality (P < .001 versus mice treated with Ad.RR5; Figure 4E). Whereas control mice started dying after 3 days and all had died by day 6, mice that had received Ad.PAI-1 did not show clear signs of illness up to 6 days after infection, with the first deaths occurring shortly thereafter. Furthermore, antibacterial defense was clearly improved in Ad.PAI-1–treated mice, as shown by 100-fold lower bacterial loads compared with Ad.RR5-treated mice at both 24 and 48 hours after induction of pneumonia (P < .001 at both time points; Figure 4F). Moreover, dissemination of the infection to the circulation, as measured by positive blood cultures for K pneumoniae after 48 hours, was present in only 12.5% of Ad.PAI-1–treated mice compared with 75% of Ad.RR5-treated control mice.


Figure 4
View larger version (42K):
[in this window]
[in a new window]

 
Figure 4. Transgenic PAI-1 expression improves host defense against Klebsiella pneumonia. (A) Wt mice were intranasally inoculated with 5 x 108 PFU Ad.PAI-1, and human PAI-1 levels were measured in lung homogenates after 0 and 24, 48, and 72 hours. Human PAI-1 in situ hybridization (B-C) showed a strong expression of PAI-1 mRNA in murine lung tissues 24 hours after Ad.PAI-1 intranasal (C) but not after Ad.RR5 (B) inoculation. Positive signal is indicated in black. Magnification, x 100. (D-F) Klebsiella pneumonia was induced in Wt mice at 24 hours after intranasal inoculation with 5 x 108 PFU Ad.PAI-1 or Ad.RR5; D-dimer was measured in lung homogenates at 0, 24, and 48 hours after infection (D), survival was monitored (E), and bacterial load was determined at 24 and 48 hours after infection (F). Data are means ± SE of 8 mice per genotype at each time point (A,D,F). Survival was evaluated using 16 mice per genotype. *P < .05 versus Ad.RR5-treated mice at the same time point.

 
PAI-1 overexpression attenuates neutrophil recruitment and lung inflammation during Klebsiella pneumonia

Upon histopathologic examination at 48 hours after K pneumoniae infection, the lungs of all Ad.RR5-treated mice showed inflammatory infiltrates, characterized by interstitial inflammation together with pleuritis, bronchitis, and edema (Figure 5A). In contrast, only 12% of the mice that had received Ad.PAI-1 showed any infiltrated areas in their lungs, which were also of a lesser extent compared with Ad.RR5-treated mice (Figure 5B). In accordance, the total histopathology score of the lungs (quantified according to the scoring system described in "Materials and methods") was significantly reduced in the Ad.PAI-1–treated mice (P < .01; Figure 5C). Ly-6 stainings of lung tissue slides revealed a strongly reduced influx of neutrophils in Ad.PAI-1–treated mice when compared with Ad.RR5-administered control mice (Figure 5A-B insets). In line with these findings, mice that had received Ad.PAI-1 showed strongly reduced MPO levels in lung homogenates at 24 and 48 hours after infection with Klebsiella (P < .05 versus Ad.RR5-treated mice; Figure 5D). In addition, the lung concentrations of TNF-{alpha}, IL-6, IFN-{gamma}, IL-10, KC, and MIP-2 were markedly diminished in Ad.PAI-1–treated mice at 24 and 48 hours after induction of Klebsiella pneumonia (Table 1).


Figure 5
View larger version (80K):
[in this window]
[in a new window]

 
Figure 5. Transgenic PAI-1 expression reduces lung inflammation during Klebsiella pneumonia. Representative HE stainings of lung (A-B) tissue at 48 hours after intranasal inoculation of 104 CFU K pneumoniae. Mice were pretreated with 5 x 108 PFU Ad.PAI-1 or Ad.RR5 intranasally at 24 hours before infection. Magnification, x 200. Insets show representative neutrophil stainings of the same time point; magnification, x 200. (C) Graphic representation of the degree of lung inflammation, determined according to the scoring system described in "Histologic examination." (D) MPO levels were determined at 24 and 48 hours after infection. Data are means ± SE. n = 8 per group at each time point. *P < .01, **P < .001 versus Ad.RR5-treated mice at the same time point.

 


View this table:
[in this window]
[in a new window]

 
Table 1. Effect of PAI-1 on cytokine levels during Klebsiella pneumonia

 
PAI-1 overexpression reduces distant organ injury

To obtain insight into the effect of intrapulmonary transgenic PAI-1 expression on the development of distant organ damage during Klebsiella pneumonia, livers were harvested for histologic examination at 48 hours after bacterial infection (Figure 6A-B). Seventy-five percent of Ad.RR5-treated mice showed profound liver injury, as characterized by inflammation (influx of leukocytes into the hepatic parenchyma) and foci of necrosis; in 50% of these mice vascular thrombi were observed. In contrast, no liver necrosis or thrombi were seen in mice treated with Ad.PAI-1, and only 25% of these mice showed any sign of hepatic inflammation. In line with these findings, the total liver histopathology score of Ad.PAI-1–treated mice was significantly lower than that in Ad.RR5-treated mice (P < .01; Figure 6C). These differences in liver injury found upon histopathologic examination were confirmed by the plasma concentrations of ALAT and ASAT, which were much lower in transgenic PAI-1–expressing mice (both P < .05; Figure 6D-E). Furthermore, to evaluate the effect of Ad.PAI-1 on kidney function during Klebsiella pneumonia, we measured urea and creatinine in plasma of both groups of mice at 48 hours after infection. Both urea and creatinine levels were lower in Ad.PAI-1–treated mice (both P < .05; Figure 6F-G).


Figure 6
View larger version (48K):
[in this window]
[in a new window]

 
Figure 6. Transgenic PAI-1 expression reduces distant organ injury during Klebsiella pneumonia. Representative HE stainings of liver (A-B) tissue at 48 hours after intranasal inoculation of 104 CFU K pneumoniae. Mice were pretreated with 5 x 108 PFU Ad.PAI-1 or Ad.RR5 intranasally at 24 hours before infection. Magnification, x 200. Livers of Ad.RR5-injected mice (A) showed inflammation, necrosis (*), and thrombi (arrow). (C) Graphic representation of the degree of liver damage at 48 hours after infection, determined according to the scoring system described in "Histologic examination." ASAT (D), ALAT (E), urea (F), and creatinine (G) were measured in plasma at the same time point. Data are means ± SE of 8 mice per genotype. *P < .05, **P < .01 versus Ad.RR5-treated mice.

 
PAI-1 overexpression also reduces bacterial loads and neutrophil recruitment in PAI-1–/– mice

We next wished to establish whether transgenic expression of PAI-1 in the lungs of PAI-1–/– mice has effects similar to those in Wt mice. Therefore, PAI-1–/– mice were intranasally administered with either Ad.PAI-1 or Ad.RR5 24 hours prior to infection with Klebsiella. In accordance with the effects observed in Wt mice, at 48 hours after induction of pneumonia, Ad.PAI-1–treated PAI-1–/– mice displayed much lower bacterial loads in their lungs (Ad.PAI-1: 7.53 ± 5.81 x 104 CFU/mL; Ad.RR5: 1.04 ± 0.54 x 107 CFU/mL, P < .01). In addition, Ad.PAI-1 treatment was associated with a reduced recruitment of neutrophils to the lungs, as reflected by neutrophil stainings of lung tissue slides (data not shown).

Transgenic expression of PAI-1 induces lung inflammation in healthy mice

Having established that enhanced pulmonary expression of PAI-1 confers resistance to Klebsiella pneumonia, we speculated about possible underlying mechanisms and hypothesized that elevated PAI-1 levels might influence the inflammatory milieu in the respiratory tract in a way that facilitates an immediate immune response to K pneumoniae. To test this hypothesis, we examined lung tissues obtained from healthy mice 24 hours after intranasal administration of Ad.RR5 or Ad.PAI-1, at which time point mice were infected with K pneumoniae. Indeed, whereas mice treated with Ad.RR5 showed little if any evidence of lung inflammation, mice administered with Ad.PAI-1 displayed a clear inflammatory reaction in their lungs as assessed by histopathology (Figure 7A-B) and confirmed by histopathologic scores (P < .05 versus Ad.RR5 control mice; Figure 7C). In addition, PAI-1 gene transfer was associated with influx of neutrophils into lung tissue as indicated by Ly-6 stainings (Figure 7A-B insets) and lung MPO levels (P < .001 versus Ad.RR5 control mice; Figure 7D). Moreover, the levels of TNF-{alpha}, IL-6, IFN-{gamma}, and the chemokine KC were all increased in lungs of Ad.PAI-1–treated mice compared with Ad.RR5-administered control mice (all P < .001, Table 2). IL-10 and MIP-2 levels were not different. Together, these data show that elevated PAI-1 levels exert a proinflammatory effect in the pulmonary compartment.


Figure 7
View larger version (81K):
[in this window]
[in a new window]

 
Figure 7. Transgenic PAI-1 expression induces inflammation in healthy lungs. Representative HE stainings of lung tissue at 24 hours after intranasal inoculation of healthy mice with 5 x 108 PFU Ad.RR5 (A) or Ad.PAI-1 (B). Original magnification, x 200. Insets show representative neutrophil stainings of the same time point; original magnification, x 400. (C) Graphic representation of the degree of lung inflammation, determined according to the scoring system described in "Histologic examination." (D) MPO levels. Data are means ± SE. n = 8 per group. *P < .01 versus Ad.RR5-treated mice.

 


View this table:
[in this window]
[in a new window]

 
Table 2. PAI-1 induces proinflammatory cytokines in healthy lungs

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Authorship
 References
 
Severe pneumonia is associated with the concurrent local activation of various mediator systems, in particular the inflammatory, procoagulant, and fibrinolytic responses. PAI-1 is an important inhibitor of the fibrinolytic system of which the production is up-regulated during pneumonia and sepsis in humans.211 Although numerous clinical studies have documented a strong correlation between elevated PAI-1 concentrations and a poor outcome of either sepsis or pneumonia,4,611 it remains unknown whether PAI-1 causally affects antibacterial host defense in vivo. We here used a model of Gram-negative pneumonia and sepsis to determine the role of PAI-1 in the host response to severe infection. In line with clinical studies, we found an up-regulation of endogenous PAI-1 mRNA and protein in the lungs of mice during Klebsiella pneumonia. We then demonstrated that endogenous PAI-1 has a protective function during Klebsiella pneumonia, as reflected by an enhanced bacterial outgrowth and dissemination and a reduced survival in PAI-1–/– mice. Furthermore, we show that the opposite approach, accomplished by transgenic overexpression of PAI-1 in the pulmonary compartment, conferred a significant protective effect in the same model, not only limiting the outgrowth and dissemination of the infection, but also reducing distant organ failure and delaying mortality. Together our data provide the first evidence for a protective role of PAI-1 during severe infection in vivo.

The respiratory tract is the most common primary site of infection in sepsis.12,13 Klebsiella species is the second most commonly isolated Gram-negative organism in sepsis13,43 and a frequent causative pathogen in pneumonia.1,27,28 In severe Gram-negative pneumonia, nonsurvivors showed significantly higher PAI-1 levels in bronchoalveolar lavage fluid compared with survivors.4 Furthermore, in sepsis patients increased PAI-1 activity predicts lethality in a very sensitive manner.611 In line with these findings, a (4G/5G) promoter deletion/insertion polymorphism in the PAI-1 gene (which has been linked to higher circulating levels of PAI-1) was found to influence the risk of the development of septic shock and to be associated with a poor outcome in patients with sepsis caused by Neisseria meningitides.44,45 These observational studies have suggested a harmful role for enhanced PAI-1 expression in the course of severe pneumonia and sepsis. However, the current data clearly indicate that the production of PAI-1 contributes to an effective host response to Klebsiella pneumonia and sepsis.

PAI-1 may play a role in the regulation of several processes implicated in the pathogenesis of sepsis. First, PAI-1 is a strong inhibitor of intravascular fibrinolysis. In line with these findings, PAI-1–/– mice have an accelerated spontaneous whole blood clot lysis.46 We here add to this that endogenous PAI-1 plays a role in the regulation of the fibrinolytic activity in the lung during pneumonia. Indeed, pneumonia was associated with a rise in D-dimer concentrations in lungs, and this increase was stronger in PAI-1–/– mice, providing evidence for an in vivo role for PAI-1 in inhibiting pulmonary plasmin generation. Second, PAI-1 can prevent the association between vitronectin with integrins and uPAR, which inhibits cell adhesion and migration. uPAR has been implicated as an important positive regulator of neutrophil migration during Gram-negative infection, as indicated by diminished neutrophil recruitment to the lungs of uPAR–/– mice with Pseudomonas pneumonia.47 Our present data suggest that PAI-1 does not inhibit this uPAR function. On the contrary, PAI-1 deficiency was associated with a reduced neutrophil influx into the pulmonary compartment during Klebsiella pneumonia. In addition, transgenic overexpression of PAI-1 in healthy mouse lungs resulted in neutrophil recruitment. While our studies were in progress, Arndt et al provided further support for a role of PAI-1 as a positive regulator of neutrophil recruitment during Gram-negative inflammation in the lungs.42 Indeed, these authors found a diminished influx of neutrophils into BALF of PAI-1–/– mice after aerosol LPS exposure, which was associated with elevated intravascular KC levels.42 We here confirm and extend these data by showing that PAI-1 deficiency also results in elevated plasma KC levels in the setting of Gram-negative pneumonia. Intratracheal administration of plasmin also caused a rise in plasma KC concentrations in mice with LPS-induced lung inflammation42; together with our present finding, these data strongly suggest that PAI-1 deficiency negatively regulates neutrophil influx into the alveolar space at least in part by augmenting intravascular KC levels (thereby "trapping" neutrophils in the intravascular compartment) by a plasmin-dependent mechanism. Our findings are also in line with the results obtained in a model of bleomycin-induced lung injury, in which PAI-1 deficiency protected against inflammation-induced lung damage and overexpression of PAI-1 enhanced the accumulation of leukocytes in the lung.15 Furthermore, in an antigen-induced arthritis model, PAI-1–/– mice showed significantly reduced joint inflammation.18 Also, during glomerulonephritis PAI-1 deficiency reduced the number of infiltrating leukocytes in the glomeruli and mice overexpressing PAI-1 showed a profound increase in leukocyte infiltration.21 Together, these data strongly suggest that the role of PAI-1 in inflammatory-cell migration is often stimulatory rather than inhibitory. Of note, our laboratory recently did not find a role for endogenous PAI-1 during Gram-positive pneumonia caused by S pneumoniae.5 The discrepancy with our current findings might be due to the fact that the mechanisms of cell recruitment to the lung in response to Gram-positive and Gram-negative bacteria appear to be different. In particular, neutrophil migration toward Gram-negative bacterial stimuli present in the lung occurs via a ß2 integrin–dependent mechanism, while Gram-positive stimuli elicit ß2 integrin–independent leukocyte migration.4850 The absence of an effect on neutrophil recruitment during S pneumoniae pneumonia5 may also explain why PAI-1–/– mice had an unremarkable host defense against this infection.

Since the recruitment of neutrophils is an important part of host defense against pneumonia,26,41 the increased local bacterial load, higher occurrence of bacteremia, and the increased mortality in the PAI-1–/– mice were most likely the result of the impaired inflammatory response. Conversely, transgenic overexpression of PAI-1 was associated with a proinflammatory response in the normal lung. The fact that such a response was not seen after intranasal administration of the empty adenoviral vector strongly suggests that locally induced PAI-1 stimulates inflammation, in particular neutrophil influx and cytokine release. Multiple studies have shown that an early local inflammatory response (influx of neutrophils and/or production of proinflammatory cytokines) is of utmost importance for host defense against bacterial pneumonia26,41; hence, this proinflammatory milieu likely was at least in part responsible for the improved host defense in mice treated with Ad.PAI-1. Our current observation that PAI-1 can induce proinflammatory effects (and thereby protect the host against infection) is supported by a very recent report by Kwak et al51 showing that PAI-1 potentiates LPS-induced neutrophil activation in vitro through a c-Jun N-terminal kinase–mediated pathway.51 The fact that Ad PAI-1–treated animals displayed a reduced inflammatory response at 24 and 48 hours after the induction of pneumonia, as reflected by histopathology, a reduced neutrophil influx into the lungs, and strongly reduced cytokine levels in lung homogenates likely was the consequence of the strongly reduced outgrowth of Klebsiella, resulting in a diminished proinflammatory stimulus provided by bacteria in the lung. Thus, it is our hypothesis that overexpression of PAI-1 elicits an inflammatory response in the lungs at the time of infection (Table 2; Figure 7), which limits the subsequent growth of bacteria; and that as a result of the reduced growth of Klebsiella, the bacterial loads in lungs were much lower in Ad.PAI-1–treated mice at later phases during the infection (24 and 48 hours), which can explain the reduced inflammation in these animals at these time points. These results also suggest that the proinflammatory effects of Ad.PAI-1 (as measured at t = 0 h) are transient and have disappeared at 24 or 48 hours after infection. In this respect, it is worth mentioning that the differences in bacterial loads between PAI-1–/– mice and Wt mice were much lower than the differences in bacterial numbers between Ad.PAI-1– and Ad.RR5-treated mice; whereas the lung inflammation observed in PAI-1–/– mice overall was similar to that in Wt mice, with the exception of neutrophil influx, Ad.PAI-1–treated mice displayed a strong reduction in all lung inflammatory parameters measured when compared with Ad.RR5-treated mice. These data suggest that extent of lung inflammation is at least in part dependent on the bacterial load, an assumption supported by several investigations on experimental pneumonia.52,53 Notably, whereas mice treated with Ad.RR5 all died between 3 and 6 days, Ad.PAI-1–treated mice did not get sick initially and survived the first 6 days of infection. However, at day 6 they also became clinically ill and they all died between 6 and 10 days. These data are in line with the kinetics of transgenic expression after adenoviral gene transfer to the lungs, which shows a peak at 24 hours with a strong decline thereafter and disappearing after 7 to 10 days.54 Thus, the strong decrease in PAI-1 expression at 7 days after adenoviral administration (which coincides with 6 days after infection) might have abolished the protection against mortality in these mice.

It should be noted that the survival curves of the respective control groups shown in Figures 2B and Figures 4E are somewhat different. Several issues deserve attention in this respect. The control groups used in these studies differed in that they received either no treatment (Figure 2B) or Ad.RR5 (Figure 4E). Possibly, Ad.RR5 has a modest impact on the outcome of Klebsiella pneumonia; in fact, this is exactly why Ad.RR5 was given in the experiments shown in Figure 4: it is the empty control vector for Ad.PAI-1.

Notably, we induced high lung levels of human PAI-1 in mice. Although human PAI-1 clearly was active in mice (as reflected, for example, by reduced D-dimer levels in Ad.PAI-1–treated mice), it is not excluded that human PAI-1 acts differently in mice than in humans. Therefore, with respect to transgene delivery of human PAI-1, our data should be interpreted with caution. In addition, the effects of exogenous PAI-1 (the experiments with Ad.PAI-1) were stronger than the effects of endogenous PAI-1 (the studies with PAI-1–/– mice), which may have been caused by the fact that Ad.PAI-1 treatment produced much higher PAI-1 levels than endogenous PAI-1 concentrations in Wt mice.

PAI-1 production and release are strongly up-regulated during severe pneumonia and sepsis. In spite of a strong positive association between PAI-1 concentrations and an adverse outcome, the functional role of this enhanced PAI-1 production during severe infection had not been investigated thus far. To our knowledge, this study is the first to show that the local rise in PAI-1 levels plays an important protective role during Gram-negative pneumonia and the ensuing sepsis syndrome induced by K pneumoniae.


    Authorship
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Authorship
 References
 
Contribution: R.R. designed and performed the research, analyzed the data, and wrote the paper; J.J.T.H.R. and S.F. analyzed the pathology slides and took part in writing the corresponding sections of the paper; P.I.B. and C.J.M.V. performed the in situ hybridization of murine and human PAI-1; M.L., P.C., and C.V.V. contributed vital reagents and analytical tools; T.V.D.P. designed and supervised the research and took part in writing the paper.

Conflict-of-interest disclosure: The authors declare no competing financial interests.

Correspondence: Rosemarijn Renckens, Center for Experimental and Molecular Medicine, Academic Medical Center, Room G2-132, Meibergdreef 9, 1105 AZ Amsterdam, The Netherlands; e-mail: r.renckens{at}amc.uva.nl.


    Acknowledgments
 
This work was supported by a grant from The Netherlands Heart Foundation (no. 2001B114) to R.R.

We thank Regina de Beer and Joost Daalhuisen for providing expert technical assistance.


    Footnotes
 
Submitted May 23, 2006; accepted September 25, 2006.

Prepublished online as Blood First Edition Paper, October 10, 2006 DOI: 10.1182/blood-2006-05-025197

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 USC section 1734.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Authorship
 References
 

  1. Burwen DR, Banerjee SN, Gaynes RP. Ceftazidime resistance among selected nosocomial gram-negative bacilli in the United States: National Nosocomial Infections Surveillance System. J Infect Dis 1994; 170:1622–1625.[Medline] [Order article via Infotrieve]

  2. Gunther A, Mosavi P, Heinemann S, et al. Alveolar fibrin formation caused by enhanced procoagulant and depressed fibrinolytic capacities in severe pneumonia: comparison with the acute respiratory distress syndrome. Am J Respir Crit Care Med 2000; 161:454–462.[Abstract/Free Full Text]

  3. Choi G, Schultz MJ, van Till JW, et al. Disturbed alveolar fibrin turnover during pneumonia is restricted to the site of infection. Eur Respir J 2004; 24:786–789.[Abstract/Free Full Text]

  4. El-Solh AA, Okada M, Pietrantoni C, Aquilina A, Berbary E. Procoagulant and fibrinolytic activity in ventilator-associated pneumonia: impact of inadequate antimicrobial therapy. Intensive Care Med 2004; 30:1914–1920.[CrossRef][Medline] [Order article via Infotrieve]

  5. Rijneveld AW, Florquin S, Bresser P, et al. Plasminogen activator inhibitor type-1 deficiency does not influence the outcome of murine pneumococcal pneumonia. Blood 2003; 102:934–939.[Abstract/Free Full Text]

  6. Pralong G, Calandra T, Glauser MP, et al. Plasminogen activator inhibitor 1: a new prognostic marker in septic shock. Thromb Haemost 1989; 61:459–462.[Medline] [Order article via Infotrieve]

  7. Paramo JA, Perez JL, Serrano M, Rocha E. Types 1 and 2 plasminogen activator inhibitor and tumor necrosis factor alpha in patients with sepsis. Thromb Haemost 1990; 64:3–6.[Medline] [Order article via Infotrieve]

  8. Mesters RM, Florke N, Ostermann H, Kienast J. Increase of plasminogen activator inhibitor levels predicts outcome of leukocytopenic patients with sepsis. Thromb Haemost 1996; 75:902–907.[Medline] [Order article via Infotrieve]

  9. Lorente JA, Garcia-Frade LJ, Landin L, et al. Time course of hemostatic abnormalities in sepsis and its relation to outcome. Chest 1993; 103:1536–1542.

  10. Zeerleder S, Schroeder V, Hack CE, Kohler HP, Wuillemin WA. TAFI and PAI-1 levels in human sepsis. Thromb Res 2006; 118:205–212.[CrossRef][Medline] [Order article via Infotrieve]

  11. Iba T, Kidokoro A, Fukunaga M, Sugiyama K, Sawada T, Kato H. Association between the severity of sepsis and the changes in hemostatic molecular markers and vascular endothelial damage markers. Shock 2005; 23:25–29.[CrossRef][Medline] [Order article via Infotrieve]

  12. Abraham E, Reinhart K, Opal S, et al. Efficacy and safety of tifacogin (recombinant tissue factor pathway inhibitor) in severe sepsis: a randomized controlled trial. JAMA 2003; 290:238–247.[Abstract/Free Full Text]

  13. Bernard GR, Vincent JL, Laterre PF, et al. Efficacy and safety of recombinant human activated protein C for severe sepsis. N Engl J Med 2001; 344:699–709.[Abstract/Free Full Text]

  14. Carmeliet P, Moons L, Lijnen R, et al. Inhibitory role of plasminogen activator inhibitor-1 in arterial wound healing and neointima formation: a gene targeting and gene transfer study in mice. Circulation 1997; 96:3180–3191.

  15. Eitzman DT, McCoy RD, Zheng X, et al. Bleomycin-induced pulmonary fibrosis in transgenic mice that either lack or overexpress the murine plasminogen activator inhibitor-1 gene. J Clin Invest 1996; 97:232–237.[Medline] [Order article via Infotrieve]

  16. Luttun A, Lupu F, Storkebaum E, et al. Lack of plasminogen activator inhibitor-1 promotes growth and abnormal matrix remodeling of advanced atherosclerotic plaques in apolipoprotein E-deficient mice. Arterioscler Thromb Vasc Biol 2002; 22:499–505.[Abstract/Free Full Text]

  17. Bajou K, Noel A, Gerard RD, et al. Absence of host plasminogen activator inhibitor 1 prevents cancer invasion and vascularization. Nat Med 1998; 4:923–928.[CrossRef][Medline] [Order article via Infotrieve]

  18. Van Ness K, Chobaz-Peclat V, Castellucci M, So A, Busso N. Plasminogen activator inhibitor type-1 deficiency attenuates murine antigen-induced arthritis. Rheumatology (Oxford) 2002; 41:136–141.

  19. Kaikita K, Fogo AB, Ma L, Schoenhard JA, Brown NJ, Vaughan DE. Plasminogen activator inhibitor-1 deficiency prevents hypertension and vascular fibrosis in response to long-term nitric oxide synthase inhibition. Circulation 2001; 104:839–844.

  20. Lijnen HR, Alessi MC, Van Hoef B, Collen D, Juhan-Vague I. On the role of plasminogen activator inhibitor-1 in adipose tissue development and insulin resistance in mice. J Thromb Haemost 2005; 3:1174–1179.[CrossRef][Medline] [Order article via Infotrieve]

  21. Kitching AR, Kong YZ, Huang XR, et al. Plasminogen activator inhibitor-1 is a significant determinant of renal injury in experimental crescentic glomerulonephritis. J Am Soc Nephrol 2003; 14:1487–1495.[Abstract/Free Full Text]

  22. Chapman HA. Plasminogen activators, integrins, and the coordinated regulation of cell adhesion and migration. Curr Opin Cell Biol 1997; 9:714–724.[CrossRef][Medline] [Order article via Infotrieve]

  23. Kjoller L, Kanse SM, Kirkegaard T, et al. Plasminogen activator inhibitor-1 represses integrin- and vitronectin-mediated cell migration independently of its function as an inhibitor of plasminogen activation. Exp Cell Res 1997; 232:420–429.[CrossRef][Medline] [Order article via Infotrieve]

  24. Stefansson S, Haudenschild CC, Lawrence DA. Beyond fibrinolysis: the role of plasminogen activator inhibitor-1 and vitronectin in vascular wound healing. Trends Cardiovasc Med 1998; 8:175–180.

  25. Marshall LJ, Ramdin LS, Brooks T, DPhil PC, Shute JK. Plasminogen activator inhibitor-1 supports IL-8-mediated neutrophil transendothelial migration by inhibition of the constitutive shedding of endothelial IL-8/heparan sulfate/syndecan-1 complexes. J Immunol 2003; 171:2057–2065.[Abstract/Free Full Text]

  26. Zhang P, Summer WR, Bagby GJ, Nelson S. Innate immunity and pulmonary host defense. Immunol Rev 2000; 173:39–51.[CrossRef][Medline] [Order article via Infotrieve]

  27. Podschun R and Ullmann U. Klebsiella spp. as nosocomial pathogens: epidemiology, taxonomy, typing methods, and pathogenicity factors. Clin Microbiol Rev 1998; 11:589–603.[Abstract/Free Full Text]

  28. Yinnon AM, Butnaru A, Raveh D, Jerassy Z, Rudensky B. Klebsiella bacteraemia: community versus nosocomial infection. QJM 1996; 89:933–941.[Abstract/Free Full Text]

  29. Rijneveld AW, Weijer S, Florquin S, et al. Thrombomodulin mutant mice with a strongly reduced capacity to generate activated protein C have an unaltered pulmonary immune response to respiratory pathogens and lipopolysaccharide. Blood 2004; 103:1702–1709.[Abstract/Free Full Text]

  30. Branger J, Knapp S, Weijer S, et al. Role of Toll-like receptor 4 in gram-positive and gram-negative pneumonia in mice. Infect Immun 2004; 72:788–794.[Abstract/Free Full Text]

  31. Lupberger J, Kreuzer KA, Baskaynak G, Peters UR, le Coutre P, Schmidt CA. Quantitative analysis of beta-actin, beta-2-microglobulin and porphobilinogen deaminase mRNA and their comparison as control transcripts for RT-PCR. Mol Cell Probes 2002; 16:25–30.[CrossRef][Medline] [Order article via Infotrieve]

  32. Boot RG, van Achterberg TA, van Aken BE, et al. Strong induction of members of the chitinase family of proteins in atherosclerosis: chitotriosidase and human cartilage gp-39 expressed in lesion macrophages. Arterioscler Thromb Vasc Biol 1999; 19:687–694.[Abstract/Free Full Text]

  33. McGrory WJ, Bautista DS, Graham FL. A simple technique for the rescue of early region I mutations into infectious human adenovirus type 5. Virology 1988; 163:614–617.[CrossRef][Medline] [Order article via Infotrieve]

  34. Gomez-Foix AM, Coats WS, Baque S, Alam T, Gerard RD, Newgard CB. Adenovirus-mediated transfer of the muscle glycogen phosphorylase gene into hepatocytes confers altered regulation of glycogen metabolism. J Biol Chem 1992; 267:25129–25134.[Abstract/Free Full Text]

  35. Gerard RD and Meidell RS. Mammalian systems. In Hames BD and Glover D (Eds.). DNA Cloning: A Practical Approach1995;Oxford, United Kingdom Oxford University Press pp. 285–307.

  36. Kopfler WP, Willard M, Betz T, Willard JE, Gerard RD, Meidell RS. Adenovirus-mediated transfer of a gene encoding human apolipoprotein A-I into normal mice increases circulating high-density lipoprotein cholesterol. Circulation 1994; 90:1319–1327.

  37. Greenberger MJ, Kunkel SL, Strieter RM, et al. IL-12 gene therapy protects mice in lethal Klebsiella pneumonia. J Immunol 1996; 157:3006–3012.[Abstract]

  38. Deng JC, Tateda K, Zeng X, Standiford TJ. Transient transgenic expression of gamma interferon promotes Legionella pneumophila clearance in immunocompetent hosts. Infect Immun 2001; 69:6382–6390.[Abstract/Free Full Text]

  39. Hashiba T, Suzuki M, Nagashima Y, et al. Adenovirus-mediated transfer of heme oxygenase-1 cDNA attenuates severe lung injury induced by the influenza virus in mice. Gene Ther 2001; 8:1499–1507.[CrossRef][Medline] [Order article via Infotrieve]

  40. Zeng X, Moore TA, Newstead MW, Hernandez-Alcoceba R, Tsai WC, Standiford TJ. Intrapulmonary expression of macrophage inflammatory protein 1alpha (CCL3) induces neutrophil and NK cell accumulation and stimulates innate immunity in murine bacterial pneumonia. Infect Immun 2003; 71:1306–1315.[Abstract/Free Full Text]

  41. Strieter RM, Belperio JA, Keane MP. Cytokines in innate host defense in the lung. J Clin Invest 2002; 109:699–705.[CrossRef][Medline] [Order article via Infotrieve]

  42. Arndt PG, Young SK, Worthen GS. Regulation of lipopolysaccharide-induced lung inflammation by plasminogen activator inhibitor-1 through a JNK-mediated pathway. J Immunol 2005; 175:4049–4059.[Abstract/Free Full Text]

  43. Fisher CJ Jr, Agosti JM, Opal SM, et al. Treatment of septic shock with the tumor necrosis factor receptor:Fc fusion protein: The Soluble TNF Receptor Sepsis Study Group. N Engl J Med 1996; 334:1697–1702.[Abstract/Free Full Text]

  44. Westendorp RG, Hottenga JJ, Slagboom PE. Variation in plasminogen-activator-inhibitor-1 gene and risk of meningococcal septic shock. Lancet 1999; 354:561–563.[CrossRef][Medline] [Order article via Infotrieve]

  45. Hermans PW, Hibberd ML, Booy R, et al. 4G/5G promoter polymorphism in the plasminogen-activator-inhibitor-1 gene and outcome of meningococcal disease: Meningococcal Research Group. Lancet 1999; 354:556–560.[CrossRef][Medline] [Order article via Infotrieve]

  46. Carmeliet P, Stassen JM, Schoonjans L, et al. Plasminogen activator inhibitor-1 gene-deficient mice, II: effects on hemostasis, thrombosis, and thrombolysis. J Clin Invest 1993; 92:2756–2760.[Medline] [Order article via Infotrieve]

  47. Gyetko MR, Sud S, Kendall T, Fuller JA, Newstead MW, Standiford TJ. Urokinase receptor-deficient mice have impaired neutrophil recruitment in response to pulmonary Pseudomonas aeruginosa infection. J Immunol 2000; 165:1513–1519.[Abstract/Free Full Text]

  48. Doerschuk CM, Winn RK, Coxson HO, Harlan JM. CD18-dependent and -independent mechanisms of neutrophil emigration in the pulmonary and systemic microcirculation of rabbits. J Immunol 1990; 144:2327–2333.[Abstract]

  49. Hellewell PG, Young SK, Henson PM, Worthen GS. Disparate role of the beta 2-integrin CD18 in the local accumulation of neutrophils in pulmonary and cutaneous inflammation in the rabbit. Am J Respir Cell Mol Biol 1994; 10:391–398.[Abstract]

  50. Wagner JG and Roth RA. Neutrophil migration mechanisms, with an emphasis on the pulmonary vasculature. Pharmacol Rev 2000; 52:349–374.[Abstract/Free Full Text]

  51. Kwak SH, Wang XQ, He Q, et al. Plasminogen activator inhibitor-1 potentiates LPS-induced neutrophil activation through a JNK-mediated pathway. Thromb Haemost 2006; 95:829–835.[Medline] [Order article via Infotrieve]

  52. Dallaire F, Ouellet N, Bergeron Y, et al. Microbiological and inflammatory factors associated with the development of pneumococcal pneumonia. J Infect Dis 2001; 184:292–300.[CrossRef][Medline] [Order article via Infotrieve]

  53. Wieland CW, Stegenga ME, Florquin S, Fantuzzi G, van der Poll T. Leptin and host defense against Gram-positive and Gram-negative pneumonia in mice. Shock 2006; 25:414–419.[CrossRef][Medline] [Order article via Infotrieve]

  54. Kaner RJ, Ladetto JV, Singh R, Fukuda N, Matthay MA, Crystal RG. Lung overexpression of the vascular endothelial growth factor gene induces pulmonary edema. Am J Respir Cell Mol Biol 2000; 22:657–664.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
G. B. Allen, M. E. Cloutier, Y. C. Larrabee, K. Tetenev, S. T. Smiley, and J. H. T. Bates
Neither fibrin nor plasminogen activator inhibitor-1 deficiency protects lung function in a mouse model of acute lung injury
Am J Physiol Lung Cell Mol Physiol, March 1, 2009; 296(3): L277 - L285.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Y.-J. Park, G. Liu, E. F. Lorne, X. Zhao, J. Wang, Y. Tsuruta, J. Zmijewski, and E. Abraham
PAI-1 inhibits neutrophil efferocytosis
PNAS, August 19, 2008; 105(33): 11784 - 11789.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. Schouten, W. J. Wiersinga, M. Levi, and T. van der Poll
Inflammation, endothelium, and coagulation in sepsis
J. Leukoc. Biol., March 1, 2008; 83(3): 536 - 545.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
blood-2006-05-025197v1
109/4/1593    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Renckens, R.
Right arrow Articles by van der Poll, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Renckens, R.
Right arrow Articles by van der Poll, T.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Immunobiology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2007 by American Society of Hematology         Online ISSN: 1528-0020