|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, 1 March 2007, Vol. 109, No. 5, pp. 2210-2216. Prepublished online as a Blood First Edition Paper on October 31, 2006; DOI 10.1182/blood-2006-06-029868.
RED CELLS Transcriptional interference among the murine ß-like globin genes1 Department of Microbiology/Immunology and Norris Cotton Cancer Center, Dartmouth Medical School, Hanover, NH; 2 Department of Medicine, Division of Hematology, Albert Einstein College of Medicine, Bronx, NY; 3 Department of Cell and Developmental Biology, University of Michigan Medical School, Ann Arbor; 4 Department of Genetics and Norris Cotton Cancer Center, Dartmouth Medical School, Hanover, NH; 5 Center for Human Genetics and Molecular Pediatric Disease and Department of Biophysics and Biochemistry, University of Rochester, NY; 6 Basic Sciences Division, Fred Hutchinson Cancer Research Center, Seattle, WA
Mammalian ß-globin loci contain multiple genes that are activated at different developmental stages. Studies have suggested that the transcription of one gene in a locus can influence the expression of the other locus genes. The prevalent model to explain this transcriptional interference is that all potentially active genes compete for locus control region (LCR) activity. To investigate the influence of transcription by the murine embryonic genes on transcription of the other ß-like genes, we generated mice with deletions of the promoter regions of Ey and ßh1 and measured transcription of the remaining genes. Deletion of the Ey and ßh1 promoters increased transcription of ßmajor and ßminor 2-fold to 3-fold during primitive erythropoiesis. Deletion of Ey did not affect ßh1 nor did deletion of ßh1 affect Ey, but Ey deletion uniquely activated transcription from ßh0, a ß-like globin gene immediately downstream of Ey. Protein analysis showed that ßh0 encodes a translatable ß-like globin protein that can pair with alpha globin. The lack of transcriptional interference between Ey and ßh1 and the gene-specific repression of ßh0 did not support LCR competition among the embryonic genes and suggested that direct transcriptional interference from Ey suppressed ßh0.
The mammalian ß-globin loci consist of multiple genes that are activated at different developmental stages in a tissue-specific manner. In the mouse, 2 "embryonic" ß-like globin genes, Ey and ßh1, are transcribed at high levels only during primitive erythropoiesis in the embryonic yolk sac. The "adult" expressed ß-type globin genes—ß-major and ß-minor—are expressed at low levels in embryos and at high levels during fetal and adult definitive erythropoiesis. This developmental up-regulation of the adult ß-like globin genes is coincident with the silencing of the embryonic ß-like globin genes and is hypothesized to be mechanistically related to the silencing of the embryonic genes. Regulatory elements of each ß-like globin gene include a promoter and associated gene proximal cis-regulatory elements bound by multiple-tissue specific or ubiquitous transcription factors. High-level expression of all the genes at the locus requires a gene distal cis-regulatory element, the locus control region (LCR), which is located 5 to 22 kb upstream of the embryonic Ey gene in the mouse locus (for a review, see Stamatoyannopoulos and Grosveld1). The role, if any, of the LCR in the developmental regulation of individual genes within the locus is unclear.
Previous studies of ß-globin gene regulation in transgenic mice carrying portions of the human ß-globin locus have suggested that developmental expression of the embryonic and adult genes is regulated through different mechanisms. For the embryonic genes, the developmental silencing is gene autonomous and is achieved through binding or dissociation of specific transcription factors to or from the gene proximal cis-regulatory elements. When directly linked to the LCR, the human embryonic
The human ß-globin gene is not autonomously suppressed in the embryo. When directly linked to the LCR or inserted in place of the endogenous embryonic gene in a transgene containing the entire human locus, the adult ß gene is activated at all developmental stages.6–9 Therefore, neither gene proximal cis-elements nor trans-acting factors in primitive erythroid cells directly suppress transcription of the adult ß-globin gene during the embryonic stage. However, insertion of a LCR–gene interaction and gene competition studies have been performed with small LCR–gene constructs or human ß-globin YAC constructs in which the general organization of the locus has been altered. This disturbance of the locus structure complicates the interpretation of those studies. Furthermore, because even large, intact, wild-type human b-globin YAC transgenes can occasionally have little or no expression11,12 or experience some degree of variegation at a higher frequency,13 concerns remain that the YACs do not, in fact, harbor the full cis-regulatory requirements of the endogenous human locus. Therefore, it is important to reexamine the conclusions drawn from transgene constructs at the endogenous mouse locus with minimal disturbance of the overall structure.
In addition, none of these experiments explicitly addressed how genes expressed at the same developmental stage influence one another. Given that the mouse genome can be modified through homologous recombination (HR) in embryonic stem (ES) cells to generate mutant mice and that there are multiple genes for each development stage, the murine ß-globin locus provides an excellent alternative system to study the interactions among the ß-like globin genes. Previous studies in our laboratory and in others have found that when the endogenous ßmajor
To investigate the gene interaction mechanisms at the endogenous locus, we previously produced and reported analyses of the individual deletions of the promoters of each of the 2 major murine embryonic genes, Ey (
Generation of Ey and ßh1 promoter replacement and deletion mice Targeting constructs used for Ey promoter deletion (pEyprd-Hygro) and for ßh1 promoter deletion (pßh1prd-Neo) have been described.15 To generate mice with Ey and ßh1 promoters deleted in cis, embryonic stem cell (ES) clones with the ßh1 promoter targeted by pßh1prd-Neo were electroporated with the pEyprd-Hygro construct. ES clones correctly targeted in cis with both promoter replacements were used to generate promoter replacement chimeric mice. Southern blot assay for ES cell and mouse genotyping Mouse tail DNA was prepared with the PureGene DNA Isolation kit (catalog no. D-70KB; Gentra Systems, Minneapolis, MN). The probe used for Southern blotting is a 0.7-kb BamHI/XbaI fragment located upstream of ßh1 (BamH1 site is 7633 bp and XbaI site is 8307 bp from the transcription start site of Ey). RT-PCR assay of expression of ß-like globin genes The assay system uses polymorphisms in the gene-coding regions between mice with the diffuse Hbb(d), (D) haplotype, on which the mutations are made, and mice with the single Hbb(s), (S) haplotype of ß-like globin. The assay compares expression from the S allele to expression from the D allele in D/S heterozygous mice that are either wild-type or mutant at the D allele. The PCR primers and the system for the assay of Ey, ßh1, ß-major, and ß-minor have been described.16 In short, the primers are exact matches for genes from the D and S haplotypes, but within the amplified region of the cDNA is a restriction site found in one haplotype but not the other. Amplified products were labeled with radioactive nucleotides during the last cycle of the PCR, digested with the appropriate restriction enzyme, and separated by size on an acrylamide gel, and the product of each allele was quantitated. Each product was amplified and assayed by itself with no multiplexing, and each gene-specific PCR had its own optimized number of cycles, as reported.16 The ßh0 expression was achieved with RT-PCR to amplify the ßh0 and the ßh1 cDNA and with RFLP differences between the amplified regions to compare levels of ßh0 with levels of ßh1. Primers for ßh0 expression were 5'CTCTGGGAAGGCTCCTGATTG3' and 5'CCCAGGAGCTTGAAGTTCTC3'. PCR products (242 bp) were digested with BslI to differentiate amplicons from ßh1 (242 bp) and ßh0 (131 bp and 111 bp) cDNA. For this assay in cells that are D/S, the total ßh1 signal from the S allele (the S allele lacks ßh0 because of a natural deletion) and the D allele was divided by 2 to represent the ßh1 transcripts from one allele. Primers for ßh2 expression were 5'GTGCTGCCACTGAAGGTA3' and 5'CTCAAAAGCAGCTTGCAGTG3'. Primers for ßh3 expression were 5'ACTTTGGCAAGGAATTCAA3' and 5'GGCCTCTGTGGTACTTGTG3'. Primers are perfect matches for ßh3 and imperfect matches for Ey, and the products can be differentiated by restriction digest. Protein assays of ß-like globin components in primitive and definitive erythroid cells Circulating primitive blood was collected from embryonic day 10.5 (e10.5) wild-type or mutant embryos. As described previously, HPLC analyses were performed with a 3-step acetonitrile gradient ranging from 35% to approximately 55% after treatment of the samples with cystamine.17 Protein identification by LC-FTMS Soluble protein samples were digested with trypsin (Promega, Madison, WI) in ammonium bicarbonate buffer (50 mM) overnight at 37°C, followed by acidification with 5% formic acid and desalting on STAGE tips.18 Liquid chromatography–tandem mass spectrometry (LC-MS/MS) was performed using an LTQFT hybrid linear (2-D) ion trap-Fourier transform ion cyclotron resonance (FTICR) mass spectrometer (ThermoElectron, San Jose, CA) as described previously.19,20
Production of the double embryonic gene promoter deletion mice
Mice were generated with the promoter regions of Ey and ßh1 deleted in cis through sequential homologous recombination (Figure 1A). Each deleted region roughly measured 1.1 kbp, spanning from 700 bp 5' to the transcription start site to near the 3' end of exon 2 of each gene.15 One of the ES clones previously targeted to replace the ßh1 promoter with neo (
Mice derived from double-promoter replacement ES cells (  Eyhygroßh1neo) were generated by standard techniques and bred with CMV-Cre transgenic mice to delete the selectable marker. The deletion was efficient and generated 2 new strains, denoted Eyßh1 and Ey(inv)ßh1 (Figure 1C). Because 2 Lox P sites in opposing orientations were retained in the locus, the Cre recombinase induced an additional inversion of the intergenic sequence between Ey and ßh1, which is flanked by the 2 Lox P sites to produce Ey(inv) ßh1. In the Ey(inv) ßh1 strain, the ßh0 gene was relocated 5 kbp further from the LCR and was transcribed in the direction opposite that of the endogenous gene (Figure 1A). To maintain genotype stability, Eyßh1 and Ey(inv) ßh1 mice were bred with 129 SvJ mice, and offspring were screened for the Cre gene by PCR. Only Cre-negative mice were used to generate mice for subsequent studies
Because the major embryonic ß-like globins are not expressed from the Transcription of other ß-type globin genes in the Ey and ßh1 promoter-deleted embryos
Viability of homozygous
Based on DNA sequence and gene structure, 3 ß-like globin genes—ßh0, ßh2, and ßh3—have been predicted in the mouse D allele; however, these putative genes have not been analyzed extensively. ßh0 is located 3' of Ey, whereas ßh2 and ßh3 are located 3' of ßh1 (Figure 3A). Low-level expression of ßh0 has been observed,21 but no expression of ßh2 or ßh3 has been reported and they have been considered pseudogenes, though their intron/exon structure is that of a normal globin gene. To determine whether the new protein peak is encoded by any of these genes, we designed RT-PCR assays to examine their potential transcription.
Gene-specific PCR primers designed to assay ßh2 are in different putative exons; thus, amplified cDNA is distinguishable from genomic DNA by its smaller size. As shown in Figure 3B, the ßh2 gene-specific primers did not detect spliced ßh2 mRNA from e10.5 yolk sac and only detected contaminating genomic DNA or background bands that were not the expected size and did not show different levels with different mouse genotypes. Thus, ßh2 was not expressed in any of the mutant mice. To detect ßh3 cDNA, a pair of primers was designed to perfectly match and amplify ßh3. When these primers were used under normal annealing conditions, no products were amplified from the cDNA of wild-type or mutant mouse e10.5 yolk sacs. Primers contained mismatches for Ey (2 mismatches on each primer), and, by lowering the annealing temperature, cDNA was amplified from all samples. Any ßh3 amplicon should be digested with NcoI but not with PvuII, whereas amplified Ey cDNA should be digested with PvuII but not NcoI. As shown in Figure 3C, the amplification product was not digestible with NcoI and was completely digestible with PvuII, indicating that amplified cDNA was from Ey and that no transcription from ßh3 was detected. Activated transcription of ßh0 correlates with deletion of the Ey promoter
ßh0 is highly homologous to ßh1 in the coding and the promoter regions. To distinguish the transcription of ßh0 from that of ßh1, we designed primers to perfectly match ßh0 and ßh1 cDNA. Primers recognized ßh1 from either the D or the S haplotype, and the S haplotype had a deletion of the promoter and the first exon of ßh0. The amplified region contained an RFLP at which BslI uniquely digested the PCR product from ßh0. This RFLP allowed us to quantify PCR products from ßh0 relative to ßh1 after BslI digestion (Figure 4A). RT-PCR analysis of e10.5 yolk sac cDNA generated from wild-type D/S and
To further dissect the mechanism underlying ßh0 regulation, we assayed ßh0 expression in our single-promoter deletion mutants, Ey and ßh1. As reported previously,15 the transcription of ßh1 was not changed by the deletion of the Ey promoter. Hence, the transcription level of ßh0 could be compared with that of ßh1 directly, even on the Ey allele. Assays of Ey/S and ßh1/S animals showed that ßh0 was activated in Ey/S animals (Figure 4C) but not in ßh1/S animals (Figure 4D). The activation of ßh0 correlated with deletion of the Ey promoter, and, when activated, its transcription level was comparable to that of ßh1 because the ßh0/ßh1 ratio was close to 1 (Figure 4E). The ßh0 expression level in Ey and Eyßh1 was more than 20-fold higher than in wild-type mice. In the Ey/S mutants, ßh0 expression was similar to the level in Eyßh1/S mutants. These results demonstrated that the activation of ßh0 was caused by the deletion of the Ey promoter and that the deletion of the ßh1 promoter did not have a detectable influence on ßh0 transcription. Transcription of ßh0 is inversely proportional to transcription levels of Ey It has been reported, by us and by others,22–24 that the transcription of one gene can suppress the transcription of other genes linked in cis through direct transcriptional interference (TI), which could involve multiple mechanisms. The physical relationship of the genes involved in TI influences the degree of suppression of each gene.22 It is possible that transcription from Ey suppresses ßh0 through direct transcriptional interference rather than competition for the LCR. If direct transcriptional interference were involved, any change in cis or trans that resulted in reduced Ey transcription would increase the level of ßh0. Recently, Tanabe et al (O.T., Yannan Shen, Shoko Kobayashi, David McPhee, William Brandt, Xia Jang, Andrew D. Campbell, Yei-Tsung Chen, Chawnshang Chang, Masayuki Yamamoto, Keiji Tanimoto, and J.D.E., manuscript submitted) generated mice overexpressing the orphan receptors TR2 and TR4. These orphan receptors form a complex that suppresses Ey but does not suppress the ßh1 or adult ß-globin genes in primitive erythrocytes (O. Tanabe et al, manuscript submitted). Consistent with this, 2 independent transgenic TR2/TR4 lines expressing elevated levels of TR2 and TR4 displayed correspondingly lowered accumulation of Ey mRNA. We found that ßh0 is also activated in the yolk sac of those transgenic mice (Figure 5) and that the transcript level of ßh0 is inversely proportional to the level of Ey expression. Line 1, which expresses less of the TR2/TR4 transgene than line 2, has 2-fold higher levels of Ey and half the amount of ßh0 than line 2. Therefore, a trans alteration that reduced the transcription of Ey increased the transcription of ßh0 inversely to the reduction of Ey.
We generated mice in which the Ey promoter was replaced by the PGK-hygro selectable marker transcribed away from ßh0. In this strain, the expression of ßh0 in yolk sac was well above the amount expressed from a wild-type allele but approximately 60% of the level expressed from an allele with the Ey promoter deleted and in which the selectable marker was removed (Figure 6A).
Previous studies with human transgenic loci have shown that changing the distance of a ß-like gene from the LCR could affect its developmental expression pattern.8,9,25,26 It is less clear whether distance from the LCR directly affected expression level. During the removal of the selectable markers by Cre, mice were generated with an inversion of the region between Ey and ßh1, including the ßh0 gene. In the Ey(inv)ßh1 mutants, the ßh0 gene is relocated 5 kbp further from the LCR compared with its wild-type location and is transcribed in the reverse direction. To determine how these alterations in location and transcriptional orientation might affect gene expression, we assayed ßh0 expression in e10.5 yolk sac from the Ey(inv)ßh1 mutants (Figure 6B). Compared with ßh0 transcription in Ey and Eyßh1mutants (Figure 6C), transcription of ßh0 in Ey(inv)ßh1 was reduced approximately 2.5-fold. Figure 6C summarizes the levels of ßh0 expression in all genotypes of mice assayed.
Bh0 protein is produced and forms a complex with The demonstration that ßh0 message is increased by at least 20-fold after deletion of the Ey promoter strongly suggests that the unknown protein peak in Figure 2 is ßh0. Experiments using mass spectrometry in conjunction with HPLC were undertaken to definitively determine whether ßh0 was expressed at the protein level and corresponded to the unknown peak in Figure 2.
Protein extracts of homozygous Deletion of the Ey or ßh1 gene promoters induces ß-major and ß-minor expression in primitive erythroid cells To test the hypothesis that transcription of the embryonic ß-globin genes suppresses transcription of the fetal/adult ß-globin genes during embryonic erythropoiesis, we analyzed the transcription and translation of the murine fetal/adult ß-major and ß-minor genes in the yolk sac primitive erythroid cells from the embryonic gene promoter deletion embryos.
Transcription of ß-major and ß-minor from the wild-type D allele or the mutant D allele was normalized to the transcription of ßs and ßt from the wild-type S allele. Results revealed that the deletion of both embryonic gene promoters (
Embryonic globin genes were not expressed in definitive cells of the murine fetus or the adult. No effect of embryonic promoter deletion on ß-major and ß-minor transcription in definitive cells was observed in the Eyßh1/S mutants (Figure 7C-D). Protein quantification by HPLC analysis confirmed the results of RT-PCR assays (data not shown).
Transcriptional interference (TI) is a broad term that describes situations in which the transcription of one gene suppresses the transcription of nearby genes. A variety of mechanisms can be involved in transcriptional interference. It has been reported, primarily from studies of human transgenes in mice, that the transcription of one gene at the ß-globin locus can suppress the transcription of other genes. The physical arrangement of genes at the locus is thought to be important for developmental gene regulation through transcriptional interference. The prevalent hypothesis regarding TI among genes at the ß-globin locus is that ß-like globin genes compete for LCR interaction. It is hypothesized that LCR–promoter interaction is accomplished by a looping mechanism that brings the LCR and the activated promoter in contact in a physical interaction required for transcriptional activation.27 Other possible mechanisms proposed for the TI effects include tracking28 or linking29 of proteins from the LCR and direct transcriptional interference.30 Results reported here suggest that multiple mechanisms are involved in TI among the ß-like globin genes and that the mechanisms influencing the embryonic genes differ from those influencing the fetal/adult genes. It has been shown that high-level transcriptional activation of the embryonic genes at the endogenous locus requires the LCR.35 Therefore, if all the murine embryonic ß-like globin genes competed for LCR interaction, deletion of one embryonic gene would increase transcription of the other embryonic ß-like globin genes, but this was not the case. As reported previously and reiterated here, deletion of the Ey promoter did not increase ßh1 transcription, and deletion of ßh1 did not increase Ey transcription. Deletion of the Ey promoter did dramatically increase ßh0 transcription, but deletion of ßh1 had no effect on ßh0. Although these data demonstrated no direct competition between Ey and ßh1, Ey transcription interfered with ßh0. The observed ßh0 suppression by Ey could have occurred through 2 possible mechanisms, directionally polar LCR competition or direct transcriptional interference. Given that Ey is upstream of ßh0, any of the 3 LCR–gene interaction models could potentially explain how Ey suppresses ßh0. However, because all the LCR–gene interaction models predicted favored LCR interaction and, therefore, transcription of the LCR proximal gene, they all faced the dilemma of why ßh0—which is LCR proximal compared with ßh1—was suppressed by Ey transcription whereas the LCR distal ßh1 was not affected by Ey transcription. Given that the gene promoters of ßh1 and ßh0 were almost identical (Figure S3) and that they had similar transcription levels after the removal of the Ey promoter, it was unlikely that the preference resulted from intrinsic properties of different promoters. A plausible alternative explanation is that Ey did not suppress ßh0 by competing for the LCR but by direct transcriptional interference. This explanation is consistent with the fact that neither Ey nor ßh1 transcriptionally interfered with the other. The finding that the specific reduction in Ey by transgenic overexpression of TR2/TR4 also stimulated ßh0 expression supports the model that direct transcriptional interference accounted for the suppression of ßh0 by Ey. Clearly, multiple molecular mechanisms account for transcriptional interference, and they are poorly understood. Because of the proximity and tandem arrangement of the Ey and ßh0 genes, we propose that transcription from Ey disrupts the recruitment of transcriptional regulatory factors and transcription machinery to the ßh0 promoter (promoter occlusion), as has been demonstrated in other models.23,31 This possibility is related to the fact that mammalian polII proceeds past the polyA site and does not have a specific termination site (for a review, see Rosonina et al32). The data showing that PGK-hygro, which replaced the Ey promoter and was transcribed in the opposite direction, only mildly suppressed ßh0 supported the hypothesis that direct transcriptional interference by promoter occlusion was the primary mechanism by which Ey suppressed ßh0.
Contribution: X.H. designed and performed the research and wrote the paper; S.E. designed and performed the research; N.P. performed the research; E.E.B. designed and performed the research and wrote the paper; J.F. performed the research; O.T. contributed new reagents; S.A.G. designed and performed the research; M.B. designed and performed the research and wrote the paper; J.D.E. designed the research, contributed new reagents, and wrote the paper; M.G. designed the research and wrote the paper; and S.F. designed and performed the research and wrote the paper. Conflict of interest disclosure: The authors declare no competing financial interests. Correspondence: Steven Fiering, Department of Microbiology/Immunology and Norris Cotton Cancer Center, 622 Rubin, Dartmouth Hitchcock Medical Center, Dartmouth Medical School, Lebanon, NH 03756; e-mail: fiering{at}dartmouth.edu.
This work was supported by National Institutes of Health–National Institute of Diabetes and Digestive and Kidney Diseases grant RO1 DK54071 (S.F.) and by a Burroughs-Wellcome Fund Career Award (M.B.). We thank the staff at the Dartmouth Transgenic Mouse Facility of the Norris Cotton Cancer Center for producing the transgenic mice and Sandra Warner for assisting with ES cell culture.
Submitted June 20, 2006; accepted October 12, 2006.
Prepublished online as Blood First Edition Paper, October 31, 2006
DOI: 10.1182/blood-2006-06-029868
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 USC section 1734.
  CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2007 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
is expressed only at embryonic stages.
gene (which as a transgene is expressed during embryonic erythropoiesis) between the LCR and the adult ß-globin gene results in suppression of the adult ß gene during embryonic erythropoiesis.
) ß-like globin genes. (II) Ey and ßh1 genes with exons marked. Deleted regions from each gene are indicated by solid lines under the gene names. (III) Ey promoter was replaced by PGK-hygro, and ßh1 promoter was replaced by PGK-neo. (
) Selectable markers were each flanked by 2 convergent lox P sites and were removed by Cre recombinase-mediated deletion. (arrows) Selectable marker transcriptional start and orientation (IV). Cre recombinase also mediated an additional inversion of DNA between the 2 LoxP sites left from the deletion of the selectable markers and resulted in 2 double-promoter deletion alleles, 
-like globin chains. (B) HPLC of cell lysate of d10.5 circulating blood from 
) Selectable marker gene PGK-Hygro. (arrow) Its transcriptional direction. Representative gel and quantitation of ßh0 expression in e10.5 wild-type D/S and 
-globin was found in band 1, and bands 2 and 3 did not have significant amounts of ßh0. Hence, it appeared that ßh0 did not form a complex with 
intergenic region are not required for the stage-specific regulation of the human ß-globin locus. Proc Nat Acad U S A 2003; 100:3374–3379.
