Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 1 May 2007, Vol. 109, No. 9, pp. 3895-3905.
Prepublished online as a Blood First Edition Paper on January 18, 2007; DOI 10.1182/blood-2006-08-040147.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Tables and Figure
Right arrow All Versions of this Article:
blood-2006-08-040147v1
109/9/3895    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Agrawal, S.
Right arrow Articles by Müller-Tidow, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Agrawal, S.
Right arrow Articles by Müller-Tidow, C.
Related Collections
Right arrow Neoplasia
Right arrow Oncogenes and Tumor Suppressors
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

NEOPLASIA

The C/EBP{delta} tumor suppressor is silenced by hypermethylation in acute myeloid leukemia

Shuchi Agrawal1, Wolf-Karsten Hofmann2, Nicola Tidow1, Mathias Ehrich3, Dirk van den Boom3, Steffen Koschmieder1, Wolfgang E. Berdel1, Hubert Serve1, and Carsten Müller-Tidow1

1 Department of Medicine, Hematology and Oncology, University of Münster, Germany; 2 Department of Oncology and Hematology, University Hospital Benjamin Franklin, Berlin, Germany; 3 Sequenom, San Diego, CA


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Authorship
 References
 
Aberrant DNA methylation is the most frequent molecular alteration in acute myeloid leukemia (AML). To identify methylation-silenced genes in AML, we performed microarray analyses in U937 cells exposed to the demethylating agent 5-aza-deoxy-cytidine. Overall, 274 transcripts were significantly induced. Interestingly, C/EBP{delta} expression was significantly induced (more than 10-fold) by demethylation whereas expression of all other C/EBP family members remained unchanged. The C/EBP{delta} promoter was strongly methylated in different leukemic cell lines and showed signs of a repressed chromatin state. Analyses of the promoter regions of the entire C/EBP family ({alpha}, ß, {gamma}, {delta}, {epsilon}, {zeta}) in bone marrow samples from AML patients (n = 80) and controls (n = 15) by mass spectrometry revealed that C/EBP{delta} is the most commonly hypermethylated C/EBP gene in AML. Hypermethylation occurred in more than 35% of AML patients at primary diagnosis. A significant correlation (P = .016) was observed between hypermethylation of the C/EBP{delta} promoter and low expression of C/EBP{delta} in AML patients. C/EBP{delta} promoter activity was strongly repressed by methylation in vitro, and transcriptional repression partially depended on MeCP2 activity. C/EBP{delta} exhibited growth-inhibitory properties in primary progenitor cells as well as in Flt3-ITD–transformed cells. Taken together, C/EBP{delta} is a novel tumor suppressor gene in AML that is silenced by promoter methylation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Authorship
 References
 
The CCAAT/enhancer binding proteins (C/EBPs) constitute a family of transcription factors involved in tissue differentiation, metabolism, and immune responses.1,2 C/EBP proteins play important roles in growth regulation of hematopoietic as well as nonhematopoietic tissues

In the hematopoietic system, all members of the C/EBP family ({alpha}, ß, {delta}, {gamma}, {epsilon}, {zeta}) are expressed during myeloid development.35 C/EBP{alpha}, C/EBPß, and C/EBP{delta} are predominantly expressed in granulocytes, monocytes, and eosinophils while C/EBP{epsilon} is found at later stages of differentiation of granulocytes and T cells.68 Overexpression of either C/EBP{alpha}, C/EBPß, C/EBP{delta}, or C/EBP{epsilon} induces granulocytic differentiation in myeloblastic cell lines.913 Neutrophilic differentiation of BCR-ABL–positive CML cell lines was induced by ectopic expression of C/EBP{delta}.14

Outside of the hematopoietic system, C/EBP{alpha}, C/EBPß, and C/EBP{delta} are key proteins mediating the differentiation of preadipocytes to adipocytes and playing an important role in normal functions of the liver.15 C/EBPß regulates the growth of ovarian granulosa cells, mammary epithelial cells, and keratinocytes.2 C/EBP{delta} appears to play a role in the growth and differentiation of lung epithelial cells1618 and mammary epithelial cells1921 as shown by overexpression studies. A growth inhibitory role in prostate cancer has been demonstrated.22 Huang et al recently showed that loss of C/EBP{delta} leads to chromosomal instability, suggesting an involvement of C/EBP{delta} in tumor suppression.23 Nonetheless, no mutations in C/EBP{delta} have been reported, raising doubts as to its potential role as a tumor suppressor.24

In the pathogenesis of leukemias and other cancers, gene silencing by aberrant DNA methylation is a frequent event.25,26 Promoter hypermethylation of bona fide tumor suppressor genes has been identified in different types of cancers including leukemias.2628 In hematopoietic malignancies, hypermethylation of genes including E-cadherin, DAP kinase, estrogen receptor (ER) alpha, and the cell cycle regulators p15INK4B and p16INK4A are associated with gene inactivation.2932

Here, we used a genomewide screening to identify methylation-silenced genes. Our findings demonstrate that C/EBP{delta} is frequently silenced by methylation in acute myeloid leukemia (AML). Its unique methylation pattern among all members of the C/EBP family suggests a role in AML pathogenesis. Strong growth inhibitory effects in primary bone marrow cells and Flt3–internal tandem duplication (Flt3-ITD)–transformed cells provide evidence that C/EBP{delta} acts as a growth suppressor.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Authorship
 References
 
Cell culture

The U937 cell line was cultured in RPMI media containing 10% heat-inactivated fetal calf serum (FCS) and the 32Dcl3 cells in RPMI medium supplemented with 10% WEHI as a source of interleukin-3 and 10% FCS. Media for all cells were supplemented with 100 U/mL penicillin, 100 mg/mL streptomycin, and 20 mM glutamine. Cells were cultured in 5% CO2 at 37°C in a humified atmosphere. For aza-deoxy-cytidine (Aza) treatment, U937 cells were seeded at a density of 5 x 105/mL with 5-aza-deoxy-cytidine (Sigma, St Louis, MO) at 100 nM concentration. Cells were harvested after 2, 4, and 6 days of treatment for RNA preparation.

Microarray analysis

Total RNA was extracted from U937 cells using RNAeasy kit (Qiagen, Hilden, Germany). Ten micrograms of total RNA were reverse transcribed into cDNA with an oligo(dT)–T7 polymerase primer. Subsequently, T7 polymerase was used for in vitro transcription. During transcription, cRNA was labeled with biotinylated oligonucleotides. The resulting labeled cRNAs were fragmented and hybridized to human U133A oligonucleotide microarrays containing probes for approximately 22 000 independent transcripts (Affymetrix, Santa Clara, CA) as described previously.33 The microarray hybridizations were performed according to the MAIME (minimum information about a microarray experiment) standards.34 Three independent arrays were hybridized for each sample, and analyses were performed comparing results from 3 untreated control versus 3 Aza-treated arrays. Differentially expressed genes were identified using the significance analysis of microarrays (SAM) analysis with a false discovery rate set at 20%. Genes that scored positive according to the SAM algorithm and were induced at least 2-fold were considered to be significant.

Quantitative real-time RT-PCR

Real-time reverse transcriptase–polymerase chain reactions (RT-PCRs) were performed as described.35 Primer sequences used for expression analyses are provided in Table S1 (available on the Blood website; see the Supplemental Materials link at the top of the online article). For C/EBP{delta} expression analysis, specific primers were used in combination with a probe labeled with 5'-FAM and 3'-TAMRA in a real-time PCR master mix (Eurogentec, San Diego, CA). Relative gene expression levels were calculated using standard curves generated by serial dilutions of U937 cDNA (before and after Aza treatment) for human cell lines samples. The expression level of GAPDH was used as an internal standard. Statistical analyses were done with SPSS 12.0 (Chicago, IL), and the nonparametric Mann-Whitney U test was used to compare the expression levels of C/EBP{delta} between AML and controls.

Western blot analyses

Cell lysates were prepared as described.36 Antibodies against C/EBP{delta} (Active Motif Europe, Rixensart, Belgium), G-CSFR, c-myc (Santa Cruz Biotechnology, Santa Cruz, CA), or actin (Sigma) were used, and Western blots were performed as described.37 Densitometric analysis was performed by using a high-sensitive charged-coupled device camera (INTAS, Göttingen, Germany), and the bands were quantified using the GelPro Analyzer software (INTAS), according to the manufacturer's instructions.

In vitro methylation and luciferase reporter assay

The C/EBP{delta}-pGL3 (generous gift from Dr J. De Wille), C/EBP{alpha},38 (kind gift from Dr G. Behre), cyclin E, and c-myc35 promoter luciferase reporter constructs were in vitro methylated by SssI methylase (New England Biolabs, Ipswich, MA) treatment following manufacturer's instructions. The 32D cells were transfected by electroporation with 15 µg of methylated or mock-methylated pGL3 promoter constructs together with Renilla vector pRLSV40 (300 ng). S2 Drosophila cells were transfected as described.39 Luciferase activity was analyzed after 24 hours using a dual reporter assay (Promega, Madison, WI). Luciferase experiments were independently repeated 3 times.

Transduction of mouse hematopoietic progenitors cells and colony assays

Bone marrow cells for transduction were obtained from the long bones of C3H/j mice as described.35 Cells were transduced with retroviral supernatants collected from Phoenix packaging cells transfected with ER-inducible pBabe-puro-C/EBP{delta} (kind gift from Dr Alan D. Friedman) or pBabe-puro empty vector control. Transduced cells were selected with 1 µg/mL puromycin for 2 days and seeded in IL-3, IL-6, and SCF-supplemented methylcellulose dishes in the presence of puromycin (1 µg/mL). ß-estradiol (Sigma) was added for C/EBP{delta} activation. Ethanol was used as solvent control. After 10 days, colonies were collected from methylcellulose and replated (5000 cells per dish) on fresh methylcellulose medium with supplements. The remaining cells from the colony assays were used for Western blot analysis. The morphology of C/EBP{delta} cells cultured in the presence or absence of ß-estradiol was analyzed by Wright-Giemsa staining.

Generation of stable 32D cell lines

Stable cell lines were generated as described.40 Briefly, 32D-Flt3-ITD cells were electroporated with 10 µg pBabe-puro-C/EBP{delta} ER-inducible construct or empty pBabe-puro vector as control. Cells were selected with puromycin (1 mg/mL). Blasticidin was added to the cultures to ensure Flt3-ITD expression. Selected cells were analyzed for C/EBP{delta} expression by Western blotting.

Growth curve and colony assay

Stable 32D-Flt3-ITD cells expressing C/EBP{delta} ER-inducible or empty vector were seeded at a density of 1 x 105/mL in growth medium (RPMI and 10% FCS) without WEHI or IL-3. A total of 1 µM ß-estradiol was added to the medium, and ethanol was used as solvent control. Cell growth was analyzed by counting viable cells using trypan blue dye exclusion method for 4 consecutive days. For colony assays, cells with ER-inducible C/EBP{delta} or empty vector were seeded at a density of 103 cells per dish in triplicate in 35 x 10-mm dishes containing Iscove modified Dulbecco medium (IMDM; Life Technologies, Grand Island, NY), 1% methylcellulose, 20% FCS, 20 ng/mL G-CSF, and 1 µM ß-estradiol or ethanol as solvent control. Colonies (more than 50 cells) were counted on day 12. Experiments were performed independently 3 times. Photographs of the colony assays were taken with an Olympus C5050 digital camera attached to an Olympus CKX1 inverted microscope with an Olympus Plan 2x/0.05 NA objective lens (Olympus, Hamburg, Germany).

For analysis of morphology, the C/EBP{delta}-overexpressing 32D-Flt3-ITD cells or the empty vector cells were treated with ß-estradiol or ethanol for 7 days. Cytospins were prepared and stained with Wright-Giemsa. Photographs were taken with a digital camera from Diagnostic Instruments (model 2.3.1; Vision System, Puchheim, Germany) attached to a Zeiss fluorescent microscope equipped with a Zeiss 100x/1.30 NA oil objective lens (Zeiss, Jena, Germany).

Detection of CpG methylation in cell lines

Genomic DNA was extracted using DNAzol (Gibco Life Technology, Invitrogen, Carlsbad, CA). The DNA was treated with bisulfite using the CpG genome kit (Chemicon R, Temecula, CA) following manufacturer's instructions. A nested PCR was performed using primers designed by MethPrimer program (UCLA, San Francisco, CA).41 Primers sequences were TTTTTTAYGGGTTTTTATTTTTYGT (outer-F), CCTTTTCTAACCCCRACTAACRTA (outer-R), GATTTTATTTTTAATTTYGAGGAGY (nested, forward), and CCTTTTCTAACCCCRACTAACRTA (nested, reverse). The PCR product (356 bp) was blunt-end cloned into pST1-blue vector (Novagen, EMD Biosciences, Beeston, Nottingham, United Kingdom). At least 10 clones were sequenced for each cell line using T7 sequencing primer.

Chromatin immunoprecipitations

The chromatin immunoprecipitations were performed as described with minor modifications.42 Briefly, U937 cells were treated with Aza for 6 days. Cells were crosslinked with 1% formaldehyde for 10 minutes. After washing with ice-cold PBS, the cell pellets were resuspended in lysis buffer (150 mM NaCl/25 mM Tris HCl [pH 7.5], 5 mM EDTA, 1% Triton X-100, 0.1% SDS, 0.5% sodium deoxycholate) and sonicated for 90 seconds at 30% amplitude. The lysates were incubated either with 10 µL anti-K4 methylated histone H3 antibody or antiacetylated histone H3 antibody (Upstate Biotechnology, Lake Placid, NY) at 4°C overnight. Isotype control IgG antibody was used as a negative control. Protein A/G plus agarose beads (Santa Cruz Biotechnology) were added for 1 hour at 4°C. After washing, the immunoprecipitates were eluted by incubating with elution buffer (0.1 M NaHCO3, 1% SDS). Samples were treated with RNaseA (50 µg/mL) and incubated overnight at 65°C to reverse the crosslinks. Proteins were removed by treatment with EDTA, 1 M Tris Cl (pH 6.5), and proteinase K for 1 hour at 42°C. DNA was extracted using a PCR purification kit (Qiagen) and eluted in 100 µL ddH2O. C/EBP{delta} promoter sequences were amplified in the immunoprecipitates by real-time PCR using primers GGCCAAGTCCTGGTTTTGATT (forward), GCCTTCTCTTCTTCCTGTTTGTG (reverse), and probe FAM-CCCGAGGAGCGAGGAGGTTCCA-TAMRA.

Methylation analyses in AML patients

Genomic DNA was isolated by means of standard procedures from bone marrow samples obtained for diagnostic reasons from patients with acute myeloid leukemia or nonmalignant diseases for control purposes. The more sequential and detailed clinical information about all AML patients and controls are provided in Table S2. Informed consent was obtained from all patients and controls.

The target regions were amplified using bisulfite-modified DNA and the primer pairs described in Table 1The PCR reactions were carried out in a total volume of 5 µL using 1 pmol of each primer, 40 µM dNTP, 0.1 unit of Hot Star Taq DNA polymerase (Qiagen), 1.5 mM MgCl2, and buffer supplied with the enzyme (final concentration 1 x). The reaction mix was preactivated for 15 minutes at 95°C. The reactions were amplified in 45 cycles of 95°C for 20 seconds, 62°C for 30 seconds, and 72°C for 30 seconds followed by 72°C for 3 minutes. Unincorporated dNTPs were dephosphorylated by adding 1.7 µL H2O and 0.3 units of shrimp alkaline phosphatase (SAP; Sequenom, San Diego, CA). The reaction was incubated at 37°C for 20 minutes, and SAP was then heat inactivated for 10 minutes at 85°C.


View this table:
[in this window]
[in a new window]

 
Table 1. Regions of CEBP family members analyzed by MALDI-TOF MS

 
Two microliters of the PCR reaction were directly used as template in a 6.5 µL transcription reaction. Twenty units of T7 DNA polymerase (Epicentre, Madison, WI) were used to incorporate either dCTP or dTTP in the transcripts. Ribonucleotides were used at 1 mM and the dNTP substrate at 2.5 mM; other components in the reaction were as recommended by the supplier. In the same step, RNase A (Sequenom) was added to cleave the in vitro transcript. The mixture was then further diluted with H2O to a final volume of 27 µL. Conditioning of the phosphate backbone prior to matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) was achieved by the addition of 6 mg CLEAN Resin (Sequenom). Further experimental details have been described elsewhere.43

Mass spectrometry measurements

Fifteen microliters of the cleavage reactions were robotically dispensed onto silicon chips preloaded with matrix (SpectroCHIP; Sequenom). Mass spectra were collected using a MassARRAY mass spectrometer (Bruker-Sequenom, Billerica, MA). Spectra were analyzed using proprietary peak picking and spectra interpretation tools.

Analyses of the data

To analyze methylation status of CEBP genes in bone marrow samples from AML or controls, the mean fraction of methylation for each CpG of the controls was analyzed. The number of hypermethylated CpGs (higher than mean plus 2 times the standard deviation in controls) was counted for each gene and each sample. Statistical analyses were done with SPSS 12.0. Nonparametric tests were used to compare differences in methylation levels.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Authorship
 References
 
Aberrant DNA hypermethylation has emerged as a major contributing factor in tumor suppressor silencing. We performed a genomewide expression analysis to identify methylation-silenced genes in leukemia using an Aza–based demethylation assay. Global gene expression profiles of U937 cells were obtained before and after 6 days of Aza treatment. There was no significant cell death observed by Aza treatment (11.2% ± 1.58% after 6 days of treatment). The resulting expression data set was normalized with BRB Array Tools, and significance analysis of microarrays (SAM) was performed to identify genes differentially expressed between Aza-exposed (3 arrays) and control cells (3 arrays). Genes scored as positive by SAM and with induction levels more than 2-fold were regarded as significant (Figure 1A-B). Overall, 276 genes were consistently induced by demethylation (Table S3). Pathway analysis using the PANTHER (Protein Analysis Through Evolutionary Relationships) Classification System44,45 revealed several pathways with an increased number of induced transcripts (Figure 1C). Among these were genes involved in folic acid metabolism. Folic acid metabolism is closely associated with methyltransferase activity, and induction of this pathway might represent a cellular response mechanism to Aza treatment.4648 To confirm the microarray results, we performed real-time PCR analyses for expression of several genes that were induced by demethylation. For all tested genes (n = 8), significant mRNA induction was observed in response to Aza treatment compared with nonexposed controls (Figure 1D).


Figure 1
View larger version (23K):
[in this window]
[in a new window]

 
Figure 1. Microarray analysis of Aza-treated U937 cells reveals multiple differentially regulated genes. (A) SAM of a paired analysis between Aza-exposed or nonexposed U937 cells to identify genes that are induced by Aza treatment. The scatter plot indicates the expected as well as the observed variability. Induced and repressed genes are indicated in red and green, respectively. (B) The scatter plot depicts the induced expression of genes (2-fold) by 6 days of Aza treatment of U937 cells. Red dots indicate 274 genes that were significantly induced after 6 days of Aza treatment. (C) Pathway analysis by PANTHER Classification System indicates biochemical pathways to be regulated by Aza treatment of U937 cells for all differentially expressed genes or for genes that were 2-fold induced (n = 274). (D) Relative levels of mRNA expression of transcripts identified from microarray analysis. Real-time RT-PCR was performed using mRNA from U937 cells treated with Aza for the indicated time. Expression levels for each gene were normalized to GAPDH levels.

 
Among these genes, C/EBP{delta} was highly induced (more than 10-fold) after 6 days of Aza treatment (Figure 1D). The expression of other C/EBP proteins ({alpha}, ß, {gamma}, {epsilon}) remained unchanged after Aza treatment whereas C/EBP{delta} mRNA was induced by several folds (Figure 2A). The discovery of C/EBP{delta} as a methylation-silenced gene was intriguing because it is a member of the C/EBP family of transcription factors, which are known to play an important role in lineage commitment and differentiation.2 The induction of C/EBP{delta} expression in response to Aza treatment was confirmed on RNA as well as on the protein level (Figure 2B-D). Treatment with the histone deacetylase (HDAC) inhibitor trichostatin A (TSA) did not influence C/EBP{delta} expression (data not shown).


Figure 2
View larger version (35K):
[in this window]
[in a new window]

 
Figure 2. Aza treatment induced the expression of C/EBP{delta}. (A) Relative levels of mRNA expression of C/EBP family members' transcripts in Aza-cytidine–exposed and nonexposed U937 cells. Indicated are means and standard deviations. (B) Relative levels of C/EBP{delta} mRNA in Aza-treated or untreated U937 and NB4 cells by real-time RT-PCR. Expression levels were normalized to GAPDH levels. Results shown are mean ± SD of 3 independent experiments. (C) Western blot analysis of C/EBP{delta} expression in lysates from Aza-treated U937 cells. (D) Densitometry of the Western blot shown in panel C normalized to actin verified induction of C/EBP{delta} protein after Aza treatment of U937 cells. (E) Western blot showing expression of C/EBP{delta} in different leukemic cell lines. Total protein lysate was subjected to Western blotting and probed with anti-C/EBP{delta} and antiactin antibodies. (F) Bisulfite sequencing for C/EBP{delta} promoter methylation analysis in leukemic cell lines. Filled squares indicate methylated and open squares nonmethylated CpG dinucleotides. The transcriptional start site and the location of the analyzed CpGs (n = 32) are indicated. Individual clones were sequenced.

 
C/EBP{delta} expression is negatively regulated by methylation in leukemic cell lines

We analyzed C/EBP{delta} expression in several leukemic cell lines including U937 (Figure 2E). C/EBP{delta} was expressed in HL-60, NB4, KCL22, MOLT-4, and MV411 cells, but several other leukemic cells such as KG1, ML-1, and U937 did not show detectable expression of C/EBP{delta}. To evaluate promoter methylation we analyzed the C/EBP{delta} upstream region for CpG islands. The 5' upstream region of C/EBP{delta} promoter contains a CpG island with high GC content (75%). We performed bisulfite sequencing of the region between –408 to +24 relative to the transcription start site, which contains 32 CpG dinucleotides. Four cell lines (U937, HL-60, NB4, and NB4R2) with different levels of C/EBP{delta} expression were chosen for the analysis. We found a high degree of methylation for U937 and NB4R2, moderate levels in HL-60, and low methylation levels in NB4 cells (Figure 2F). In U937 cells, methylation decreased after Aza treatment (Figure 2F). This finding is in line with the induced expression of C/EBP{delta} after Aza exposure in U937 cells (Figure 2B-C). Also, in other cell lines a close association between methylation and loss of expression was observed. The NB4 (PML-RAR{alpha} fusion protein positive) and NB4R2 (ATRA-resistant PML-RAR{alpha} fusion protein positive) cells differed in C/EBP{delta} promoter methylation status and expression (Figure 2E-F). These data indicated that C/EBP{delta} expression is negatively correlated with promoter methylation in leukemic cell lines.

DNA methylation suppresses C/EBP{delta} promoter activity

To analyze the effects of DNA methylation on promoter activity, we used a C/EBP{alpha} promoter luciferase construct (–393) treated with or without SssI methylase enzyme to methylate the promoter in vitro. In vitro–methylated or mock-methylated C/EBP{alpha} promoter constructs were transfected into 32D cells along with a Renilla expression plasmid. C/EBP{alpha} promoter activity was strongly repressed by methylation (Figure 3A). Methyl CpG binding protein (MeCP2), a member of the MBD family of proteins, is known to induce transcriptional repression of methylated CpG promoters by recruiting histone deacetylases (HDACs).49 MeCP2 is thought to be active in the presence of multiple methylated CpG dinucleotides such as the CpG-dense C/EBP{alpha} promoter. Therefore, we analyzed whether repression of the methylated C/EBP{alpha} promoter was MeCP2 dependent. Because MeCP2 does not have a homolog in Drosophila, we cotransfected S2 Drosophila cells with in vitro–methylated or mock-methylated –393 C/EBP{alpha} promoter constructs in the presence or absence of MeCP2 expression construct. Activity of the methylated promoter was further repressed 4-fold in the presence of MeCP2, which indicates that MeCP2 might play a role in suppression of the transcriptional activity of the methylated C/EBP{alpha} promoter (Figure 3B).


Figure 3
View larger version (26K):
[in this window]
[in a new window]

 
Figure 3. C/EBP{delta} promoter activity is suppressed by methylation. (A) Luciferase assays showing C/EBP{delta} promoter repression in response to methylation. Methylated (SssI) or mock-methylated C/EBP{delta} promoter reporter constructs were transfected into 32D cells. The fold repression was calculated as 1/activity (normalized to Renilla values) with the control set as 1. The results are shown as the mean ± SD of 3 independent experiments. (B) Luciferase assay in S2 Drosophila cells, indicating that C/EBP{delta} promoter repression is dependent on MeCP2 activity. Methylated or mock-methylated reporter constructs were transfected into S2 Drosophila cells along with an Sp1 expression plasmid and either an empty vector or a MeCP2 expression vector. Fold repression was calculated as 1/relative activity, with the control set as 1. The results are shown as the mean ± SD of 3 independent experiments. (C) Luciferase assay showing fold repression in promoter activity of C/EBP{delta}, C/EBP{alpha}, cyclin E, and c-myc promoters after SssI methylase treatment. Methylated (SssI) or mock-methylated C/EBP{delta} promoter reporter constructs were transfected into 32D cells. The results are shown as the mean ± SD of 3 independent experiments. (D) Chromatin modification of histone H3-K4 methylation and histone H3 acetylation. Chromatin immunoprecipitations were performed with Aza-exposed U937 cells. Antibodies against histone H3-methylated K4 (K4-Me), acetylated histone H3, or IgG isotype control were used. Real-time PCR was performed using C/EBP{delta} promoter–specific primers and probe. The results shown are mean ± SD of 2 independent experiments.

 
We compared the effects of C/EBP{alpha} promoter methylation with the effects of methylation on several other promoters: C/EBP{alpha}, cyclin E, and c-myc. Interestingly, C/EBP promoters ({alpha} and {delta}) were strongly repressed by SssI treatment compared with cyclin E and c-myc. These results suggest that the C/EBP{delta} promoter is by far the most sensitive promoter with regard to methylation (Figure 3C). Nonetheless, these in vitro analyses cannot be directly extended to the in vivo situations. Therefore, we analyzed the association between DNA methylation and chromatin formation of the C/EBP{delta} promoter in vivo.

Chromatin modifications by demethylation of the C/EBP{delta} promoter

Epigenetic repression by DNA methylation is associated with corresponding histone modifications that contribute to gene repression and heterochromatin formation. To determine whether the reexpression of C/EBP{delta} induced by Aza treatment altered the chromatin structure, we performed chromatin immunoprecipitation for histone modifications using antibodies against methylated lysine-4 histone H3 and acetylated histone H3. Lysine-4 dimethylation of histone H3 and especially histone acetylation were significantly increased in response to Aza treatment of U937 cells (Figure 3D).

Methylation analysis of the C/EBP gene family in AML patient samples

C/EBP genes play important roles in hematopoietic differentiation. Due to functional redundancy, the role of individual C/EBP proteins is difficult to assess. For C/EBP{delta} to be considered a tumor suppressor, it would be important to elucidate its methylation status in comparison with other C/EBP family members in AML patients. Genomic DNA from AML patients (n = 81) and healthy controls (n = 15) was bisulfite treated and subsequently PCR amplified with primers that bound irrespective of methylation. Quantitative methylation analysis was performed using a specialized MALDI-TOF assay. This method allows the quantitative analysis of a large number of CpG dinucleotides.43,50 Background methylation levels were calculated for each CpG using 15 control samples. Hypermethylation of a CpG was defined as the mean methylation level in controls plus 2 times the standard deviation. Subsequently, the number of hypermethylated CpGs was calculated for each sample and each gene (Figure 4A). Significant differences in the number of methylated CpG dinucleotides between AML and control samples were found for C/EBPß and C/EBP{delta}, whereas no significant differences were found for the other C/EBP members. These analyses included the region of the C/EBP{alpha} promoter (–837 to –1266) that has been shown to be methylated in lung cancer.51 Importantly, more than 35% of all AML samples showed higher levels of C/EBP{delta} methylation than all controls. In contrast, none of the other C/EBP family members were methylated in more than 20% of the patient samples (Figure 4B). No association between C/EBP methylation and age of the patients or stage of disease was found. These data demonstrate the occurrence of aberrant promoter methylation of C/EBP{delta} in primary leukemic samples. These findings indicate that the C/EBP{delta} promoter is the most abundantly methylated C/EBP gene in AML.


Figure 4
View larger version (31K):
[in this window]
[in a new window]

 
Figure 4. The C/EBP{delta} promoter is hypermethylated in acute myeloid leukemia. (A) The number of hypermethylated CpGs in the promoter region of the C/EBP family members was analyzed in AML patients and controls by MALDI-TOF. Hypermethylation was defined as methylation above the mean methylation levels in controls plus 2 times the controls' standard deviation. The number of hypermethylated CpGs was analyzed for each sample and each gene. (B) The C/EBP{delta} promoter was methylated at a high frequency in AML. The bars indicate the percent of AML patients' samples hypermethylated for the different C/EBP genes as assessed by MALDI-TOF. (C-D) Correlation between C/EBP{delta} promoter methylation and mRNA expression. C/EBP{delta} promoter methylation was associated with decreased C/EBP{delta} expression levels (P = .005). The scatter plot indicates the relative mRNA expression levels normalized to GAPDH with regard to a low (up to 5 hypermethylated CpGs), intermediate (6 to 15 hypermethylated CpGs), and high (more than 150 methylated CpGs) degree of C/EBP{delta} promoter methylation (P = .016, nonparametric test). The median level of expression is indicated for each group with a horizontal line.

 
Promoter methylation is associated with C/EBP{delta} silencing in AML

Next, we analyzed whether methylation of the promoter influences the expression of C/EBP{delta} in AML patients. C/EBP{delta} is usually expressed in human CD34+ primary progenitor cells at low levels with induction upon granulocytic differentiation (real-time RT-PCR data not shown).

Real-time RT-PCR was performed on cDNA samples obtained from the patients' samples used for methylation analysis. We found a close correlation between a higher number of methylated CpGs and low expression of C/EBP{delta} mRNA (P = .005) (Figure 4C). We divided all samples into 3 groups based on the number of methylated CpGs (low, up to 5 methylated CpGs; intermediate, 6 to 15 methylated CpGs; high, more than 15 methylated CpGs). Samples with high CpG methylation levels showed significantly lower C/EBP{delta} mRNA expression compared with samples containing low numbers of methylated CpGs (mean, 3.45 versus 10.92; P = .016). Samples grouped as intermediate showed mean relative expression levels of 6.32 (Figure 4D).

C/EBP{delta} possesses growth suppressive functions in primary hematopoietic progenitors

A role of C/EBP{delta} in inducing granulopoiesis has been suggested in cell lines.12 We analyzed whether C/EBP{delta} has growth inhibitory effects on primary bone marrow cells. C/EBP{delta}-ER–inducible or empty vector (kind gift from Dr A. Friedman) were transduced by retroviral transduction into primary cells obtained from murine bone marrow. Transduced cells were selected with puromycin for 2 days and then cultured in methylcellulose with growth factors in the presence or absence of ß-estradiol to induce C/EBP{delta} activity. We used 4 different concentrations of ß-estradiol (0.03 µM, 0.1 µM, 0.3 µM, 1 µM) to find the lowest concentration that did not affect the growth of control cells. Addition of ß-estradiol inhibited colony growth of control cells to some extent, but in C/EBP{delta}-overexpressing cells we observed a dose-dependent decrease on colony growth (Figure 5A). C/EBP{delta} expression markedly reduced the number of granulocyte macrophage colony-forming unit (CFU-GM), macrophage CFU (CFU-M), and granulocyte, erythroid, macrophage, megakaryocyte CFU (CFU-GEMM) colonies compared with control (Figure 5A). Expression of C/EBP{delta} in the colonies was confirmed by Western blotting (Figure 5B).


Figure 5
View larger version (48K):
[in this window]
[in a new window]

 
Figure 5. C/EBP{delta} suppresses growth of primary hematopoietic progenitors. (A) Colony assays showing the growth inhibitory effect of C/EBP{delta} on hematopoietic progenitor cells. Murine bone marrow cells were transduced with an ER-inducible C/EBP{delta} construct or empty vector as a control. After 48 hours of transduction, cells were puromycin selected for 2 days. Colony assays were performed in the presence of ß-estradiol to activate C/EBP{delta}. The results are shown as the mean ± SD of 3 independent experiments. (B) Western blot analysis of the colonies obtained in panel A. Blots were probed with anti-C/EBP{delta} and antiactin antibodies to confirm ectopic expression of C/EBP{delta} in the colonies. (C) C/EBP{delta}-transduced primary bone marrow cells in colony assay after replating. C/EBP{delta} expression completely abolished the colony growth of primary cells on replating. Photograph of representative areas of the plates demonstrates the lack of colony growth after replating in C/EBP{delta}-overexpressing cells in the presence of ß-estradiol. (D) The bars indicate the inhibitory effect of C/EBP{delta} on colony formation in replating experiments. Results show mean ± SD of triplicates of 2 independent experiments. (E) Western blot analysis with G-CSFR and c-myc antibodies in total protein lysate from C/EBP{delta} or empty vector control–transduced bone marrow cells. The blot was stripped and rehybridized with actin antibodies. (F) Wright-Giemsa–stained cytospin slides under light microscopy. C/EBP{delta} or the empty vector–transduced primary bone marrow cells were incubated with ß-estradiol for induction of C/EBP{delta}. Representative morphologic changes seen at day 7 of ß-estradiol treatment are shown.

 
The replating potential of CFU-GMs is an indicator of self-renewal capacity of progenitor cells. We performed replating experiments by pooling the colonies from C/EBP{delta}-transduced colonies in the absence of ß-estradiol. Cells were replated in methylcellulose in the presence or absence of ß-estradiol (0.03 µM, 0.1 µM, 0.3 µM, 1 µM). Colonies from empty vector control in ethanol were also picked and replated in the presence of ß-estradiol for control purposes. C/EBP{delta} induction completely abrogated the colony growth of replated cells in all 4 concentrations of ß-estradiol while empty vector control–transduced cells showed a slight reduction in colony number in the presence of ß-estradiol (Figure 5C-D). These findings confirmed the growth inhibitory role of C/EBP{delta} in primary myeloid progenitor cells. We next analyzed the expression of G-CSFR and c-myc in response to C/EBP{delta} induction in the primary cells from colony assay. Western blot analysis showed that G-CSFR protein expression increased and c-myc expression decreased in the presence of ß-estradiol in C/EBP{delta}-overexpressing cells compared with control (Figure 5E).

Cell morphology was examined by cytospin and staining with Wright-Giemsa. Within 7 days of ß-estradiol treatment, many of the C/EBP{delta}-overexpressing bone marrow cells underwent myeloid maturation with reduction in the nuclear-cytoplasmic ratio (Figure 5F). Control vector–transduced cells contained more promyelocytes compared with C/EBP{delta}-overexpressing cells, whereas the number of completely differentiated granulocytes was higher in C/EBP{delta}-expressing bone marrow (Figure 5F).

C/EBP{delta} inhibits the growth of 32D cells transformed by Flt3 mutations

Based on the finding that C/EBP{delta} is a growth inhibitor of myeloid progenitor cells, we analyzed the potential of C/EBP{delta} to act as a suppressor of leukemogenic transformation. We overexpressed the estrogen-inducible C/EBP{delta} construct in 32D cells, which were transformed by oncogenic Flt3 receptor with ITDs.40,52 These mutations are among the most frequent in AML. Ectopic expression of C/EBP{delta}-ER fusion protein was verified by Western blot analysis (Figure 6A). Cells were seeded in IL-3–free medium in the presence or absence of ß-estradiol and were counted every 24 hours. A significant decrease in the cell number was observed in C/EBP{delta}-overexpressing cells in the presence of ß-estradiol compared with vector control or C/EBP{delta} cells in ethanol (Figure 6B). We next assessed the ability of these cells to form colonies in methylcellulose. Cells were seeded in methylcellulose containing G-CSF in the presence of ß-estradiol or ethanol. There was a 10-fold decrease in the colony number in the presence of ß-estradiol compared with ethanol in C/EBP{delta}-overexpressing cells. No decrease in colony numbers was observed in empty vector cells in the presence of ß-estradiol (Figure 6C). These findings suggest that C/EBP{delta} inhibits growth and colony-forming ability of Flt3-ITD–transformed cells. Overexpression of C/EBP{delta} in normal 32D cells induced granulocytic differentiation (data not shown), which is in line with previous findings 12. To analyze the effect of C/EBP{delta} on differentiation of 32D-Flt3-ITD cells, we analyzed the change in cell morphology by cytospin and staining with Wright-Giemsa. The activation of C/EBP{delta} induces morphologic changes toward granulocytic differentiation after 7 days of ß-estradiol treatment (Figure 6D). Most of the cells had a reduction in the nuclear-cytoplasmic ratio with segmented nuclei, a typical characteristic of mature granulocytes. In contrast, the morphology of empty vector control cells did not show any signs of granulocytic differentiation (Figure 6D). The expression of secondary granule proteins was also analyzed after 4 days of ß-estradiol treatment. The G-CSFR and lysozyme expression was significantly induced in C/EBP{delta}-overexpressing cells in the presence of ß-estradiol compared with control cells (Figure S1). No induction was observed in MPO and neutrophil elastase RNA after C/EBP{delta} activation (Figure S1).


Figure 6
View larger version (47K):
[in this window]
[in a new window]

 
Figure 6. C/EBP inhibits the growth of Flt3-ITD–transformed cells. (A) Western blot analysis of transfected 32D-Flt3-ITD cells. The 32D-Flt3-ITD stable cells were transfected with an ER-inducible C/EBP{delta} construct or empty vector. Cells were puromycin selected. Lysates were probed with anti-C/EBP{delta} and antiactin antibody. (B) Growth curve of C/EBP{delta}-expressing 32D-Flt3-ITD cells. 32D-Flt3-ITD cells with C/EBP{delta} or control cells were seeded in suspension cultures at the density of 2 x 105/mL in the presence of ß-estradiol or ethanol. Cells were counted every 24 hours by trypan blue exclusion method. The results are shown as the mean ± SD of 2 independent experiments. (C) Colony assays were performed with 32D-Flt3-ITD cells expressing the C/EBP{delta} ER construct. A total of 1000 cells were seeded per dish with either ß-estradiol or ethanol. Colonies were analyzed on day 8. Each bar represents the mean ± SD of a representative triplicate experiment. (D) Wright-Giemsa–stained cytospin slides under light microscopy. C/EBP{delta} or the empty vector–transduced 32D-Flt3-ITD cells were incubated with ß-estradiol for induction of C/EBP{delta}. Representative morphologic changes seen at day 7 of ß-estradiol treatment are shown.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Authorship
 References
 
C/EBP genes are believed to be critically involved in hematopoietic differentiation and leukemogenesis.1,53 So far, especially C/EBP{alpha} has been implicated in leukemia pathogenesis, most strikingly due to the occurrence of mutations in AML with myeloblastic differentiation.54

Here, we demonstrate that C/EBP{delta} is specifically and frequently inactivated by promoter hypermethylation in acute myeloid leukemia. Methylation of C/EBP genes in AML most frequently occurs at the C/EBP{delta} promoter. Our findings indicate that C/EBP{delta} inactivation is likely to play a role in the pathogenesis of a significant number of AMLs.

We used a genomewide screen to identify methylation-silenced genes in leukemia. The microarray data were verified by real-time PCR. Genes involved in several pathways were significantly induced as indicated by gene distribution in the PANTHER Classification System.44,45 Alterations in these pathways are not necessarily the result of tumor suppressor gene reactivation. For example, induction of the folate biosynthesis pathway is more likely to represent the cellular response to an overall decrease in DNA methylation.46,55 Thus, identification of genes induced by demethylating agents needs to be complemented by direct DNA methylation analysis. In the current study, we chose to concentrate on C/EBP{delta} that was induced more than 10-fold in real-time RT-PCR analyses, and its 5' upstream region contains a CpG island with a dense population of CpG dinucleotides. Our further experiments indicated that this CpG island is methylated in several leukemia cell lines that do not express C/EBP{delta}, whereas absence of methylation was associated with gene expression. In primary patient samples, more than 35% exhibited significant levels of C/EBP{delta} methylation, which again was associated with reduced expression levels. In vitro analyses confirmed that C/EBP{delta} promoter methylation was associated with strong transcriptional repression partially induced by MeCP2 and posttranslational histone modifications. Reversal of DNA methylation increases C/EBP{delta} histone acetylation, which suggests that DNA methylation might play a role in the hypoacetylated state of the promoter. These findings conclusively establish the association between C/EBP{delta} promoter methylation and loss of expression.

C/EBP{delta} promoter methylation has not been reported in leukemia. A recent paper described infrequent and weak C/EBP{delta} methylation in breast cancer specimens.56 Similar to C/EBP{alpha} mutations and inactivation that occur not only in leukemia but also in solid tumors,57 C/EBP{delta} inactivation might be more widespread in hematologic and solid tumor malignancies.

Two important questions arose from our findings of C/EBP{delta} methylation in acute myeloid leukemia. First, how specific is C/EBP{delta} methylation in leukemogenesis? To analyze this in detail we used an innovative MALDI-TOF–based technique to quantitate methylation of a huge number of CpG dinucleotides of many C/EBP family members. Importantly, C/EBP{delta} and C/EBPß were the only genes with increased methylation levels in AML samples compared with normal bone marrow samples. Importantly, neither C/EBP{alpha}, C/EBP{gamma}, C/EBP{epsilon}, nor C/EBP{zeta} were significantly methylated. Because the MALDI-TOF method is the most sensitive and quantitative method to be used for methylation analysis of a huge number of CpG dinucleotides43,50 (the number of analyzed CpGs in this study was 260), these findings are conclusive. Aberrant methylation commonly occurred in 2 genes whose 5' upstream regions contained a CpG island (ß and {delta}) but not in C/EBP{alpha}, which also contains a CpG island.

C/EBP{alpha} methylation has recently been reported in lung cancer.51 Our analyses that included the region methylated in lung cancer indicate that a few AML patient samples may have increased C/EBP{alpha} methylation as well but that C/EBP{alpha} methylation is a rather rare event in AML. This is in line with previous findings.58

DNA hypermethylation of CpG islands regulating tumor suppressor gene expression is now recognized as an important feature of human neoplasia. Especially in leukemia, inactivation of several tumor suppressor genes by promoter hypermethylation has been a topic of considerable interest in the last few years. Acute myeloid leukemia blasts show frequent hypermethylation of ER, p15, MyoD, PITX2, GPR37, and SDC4 genes.55,59,60 Our findings concerning C/EBP{delta} methylation raise the question of C/EBP{delta} tumor suppressor functions. Growth inhibitory effects of C/EBP{delta} have been shown in human breast cancer61 and prostate cancer.22 In hematopoietic cells, involvement of C/EBP{delta} as an inducer of granulocytic differentiation has been demonstrated in BCR-ABL–positive CML cell lines and the 32D cell line.12,14 Importantly, loss of C/EBP{delta} can promote genomic instability.23 These data provide evidence that C/EBP{delta} has growth inhibitory properties in cell lines, but analyses of the effects on primary cells has been lacking. In the current study, we used an ER-inducible C/EBP{delta} to show that C/EBP{delta} has a growth inhibitory effect on primary bone marrow cells, which was enhanced on replating. These findings may indicate a decreased self-renewal capacity of C/EBP{delta}-expressing hematopoietic progenitor cells. C/EBP{alpha} has also been implicated in regulating self-renewal.62 Growth inhibitory effects of C/EBP{delta} had so far not been reported for AML-specific oncogenes. In the current study we used 32D cells transformed by the mutant form of the fms-like tyrosine kinase Flt3.40 Again, C/EBP{delta} suppressed proliferation of Flt3-ITD–transformed cells. These results provide further evidence that C/EBP{delta} is a tumor suppressor gene that is frequently silenced by methylation in acute myeloid leukemia.

Taken together, a genomewide screening approach identified C/EBP{delta} as a frequently methylated tumor suppressor gene in acute myeloid leukemia. These findings strengthen the hypothesis that C/EBP proteins are important tumor suppressors in acute myeloid leukemia, and strategies to reinduce these factors in AML cells may prove useful for antileukemic therapy in the future.


    Authorship
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Authorship
 References
 
Contribution: S.A., H.S., and C.M.-T. designed the research, analyzed the data, and wrote the manuscript; S.A. performed most of the experiments; W.K.H. performed microarray hybridizations; M.E. and D.v.d.B. performed MALDI-TOF MS experiments; N.T., S.K., W.E.B., H.S., and C.M.-T. provided analytical tools and analyzed the data; and all authors checked the final version of the manuscript.

Conflict-of-interest disclosure: M.E. and D.v.d.B. are employed by Sequenom and hold Sequenom stocks. The other authors declare no competing financial interests.

Correspondence: Carsten Müller-Tidow, Department of Medicine A, Hematology and Oncology, University of Münster, Domagkstr.3, 48129 Münster, Germany; e-mail: muellerc{at}uni-muenster.de.


    Acknowledgments
 
This work was supported by a Heisenberg grant from the Deutsche Forschungsgemeinschaft (C.M.-T.), the Nationales Genomforschungsnetz (NGFN)–2 LeukemiaNet, the José-Carreras Leukämiestiftung, and the Deutsche Krebshilfe. We are grateful to Sandra Doths, Barabara Mlody, Linda Kamp, and Annette Westermann for excellent technical assistance. We thank Dr A. D. Friedman for C/EBP{delta} expression constructs; Dr J. W. DeWille for C/EBP{delta} promoter constructs, and Dr G. Behre for C/EBP{alpha} promoter construct.


    Footnotes
 
Submitted August 10, 2006; accepted December 26, 2006.

Prepublished online as Blood First Edition Paper, January 18, 2007 DOI: 10.1182/blood-2006-08-040147

The online version of this manuscript contains a data supplement.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 USC section 1734.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Authorship
 References
 

  1. Tenen DG, Hromas R, Licht JD, Zhang DE. Transcription factors, normal myeloid development, and leukemia. Blood 1997; 90:489–519.[Free Full Text]

  2. Ramji DP and Foka P. CCAAT/enhancer-binding proteins: structure, function and regulation. Biochem J 2002; 365:561–575.[Medline] [Order article via Infotrieve]

  3. Zhang DE, Hetherington CJ, Meyers S, et al. CCAAT enhancer-binding protein (C/EBP) and AML1 (CBF alpha2) synergistically activate the macrophage colony-stimulating factor receptor promoter. Mol Cell Biol 1996; 16:1231–1240.[Abstract]

  4. Verbeek W, Lekstrom-Himes J, Park DJ, et al. Myeloid transcription factor C/EBPepsilon is involved in the positive regulation of lactoferrin gene expression in neutrophils. Blood 1999; 94:3141–150.[Abstract/Free Full Text]

  5. Yamada T, Tsuchiya T, Osada S, Nishihara T, Imagawa M. CCAAT/enhancer-binding protein delta gene expression is mediated by autoregulation through downstream binding sites. Biochem Biophys Res Commun 1998; 242:88–92.[CrossRef][Medline] [Order article via Infotrieve]

  6. Chih DY, Chumakov AM, Park DJ, Silla AG, Koeffler HP. Modulation of mRNA expression of a novel human myeloid-selective CCAAT/enhancer binding protein gene (C/EBP epsilon). Blood 1997; 90:2987–2994.[Abstract/Free Full Text]

  7. Scott LM, Civin CI, Rorth P, Friedman AD. A novel temporal expression pattern of three C/EBP family members in differentiating myelomonocytic cells. Blood 1992; 80:1725–1735.[Abstract/Free Full Text]

  8. Friedman AD. Transcriptional regulation of granulocyte and monocyte development. Oncogene 2002; 21:3377–3390.[CrossRef][Medline] [Order article via Infotrieve]

  9. Kowenz-Leutz E and Leutz A. A C/EBP beta isoform recruits the SWI/SNF complex to activate myeloid genes. Mol Cell 1999; 4:735–743.[CrossRef][Medline] [Order article via Infotrieve]

  10. Radomska HS, Huettner CS, Zhang P, Cheng T, Scadden DT, Tenen DG. CCAAT/enhancer binding protein alpha is a regulatory switch sufficient for induction of granulocytic development from bipotential myeloid progenitors. Mol Cell Biol 1998; 18:4301–4314.[Abstract/Free Full Text]

  11. Park DJ, Chumakov AM, Vuong PT, et al. CCAAT/enhancer binding protein epsilon is a potential retinoid target gene in acute promyelocytic leukemia treatment. J Clin Invest 1999; 103:1399–1408.[Medline] [Order article via Infotrieve]

  12. Wang QF and Friedman AD. CCAAT/enhancer-binding proteins are required for granulopoiesis independent of their induction of the granulocyte colony-stimulating factor receptor. Blood 2002; 99:2776–2785.[Abstract/Free Full Text]

  13. Duprez E, Wagner K, Koch H, Tenen DG. C/EBPbeta: a major PML-RARA-responsive gene in retinoic acid-induced differentiation of APL cells. EMBO J 2003; 22:5806–5816.[CrossRef][Medline] [Order article via Infotrieve]

  14. Gery S, Tanosaki S, Hofmann WK, Koppel A, Koeffler HP. C/EBPdelta expression in a BCR-ABL-positive cell line induces growth arrest and myeloid differentiation. Oncogene 2005; 24:1589–1597.[CrossRef][Medline] [Order article via Infotrieve]

  15. Samuelsson L, Stromberg K, Vikman K, Bjursell G, Enerback S. The CCAAT/enhancer binding protein and its role in adipocyte differentiation: evidence for direct involvement in terminal adipocyte development. EMBO J 1991; 10:3787–3793.[Medline] [Order article via Infotrieve]

  16. Breed DR, Margraf LR, Alcorn JL, Mendelson CR. Transcription factor C/EBPdelta in fetal lung: developmental regulation and effects of cyclic adenosine 3',5'-monophosphate and glucocorticoids. Endocrinology 1997; 138:5527–5534.[Abstract/Free Full Text]

  17. Sugahara K, Sadohara T, Sugita M, Iyama K, Takiguchi M. Differential expression of CCAAT enhancer binding protein family in rat alveolar epithelial cell proliferation and in acute lung injury. Cell Tissue Res 1999; 297:261–270.[CrossRef][Medline] [Order article via Infotrieve]

  18. Cassel TN, Nordlund-Moller L, Andersson O, Gustafsson JA, Nord M. C/EBPalpha and C/EBPdelta activate the clara cell secretory protein gene through interaction with two adjacent C/EBP-binding sites. Am J Respir Cell Mol Biol 2000; 22:469–480.[Abstract/Free Full Text]

  19. O'Rourke JP, Hutt JA, DeWille J. Transcriptional regulation of C/EBPdelta in G(0) growth-arrested mouse mammary epithelial cells. Biochem Biophys Res Commun 1999; 262:696–701.[CrossRef][Medline] [Order article via Infotrieve]

  20. O'Rourke JP, Newbound GC, Hutt JA, DeWille J. CCAAT/enhancer-binding protein delta regulates mammary epithelial cell G0 growth arrest and apoptosis. J Biol Chem 1999; 274:16582–16589.[Abstract/Free Full Text]

  21. Gigliotti AP, Johnson PF, Sterneck E, DeWille JW. Nulliparous CCAAT/enhancer binding proteindelta (C/EBPdelta) knockout mice exhibit mammary gland ductal hyperlasia. Exp Biol Med (Maywood) 2003; 228:278–285.[Abstract/Free Full Text]

  22. Sanford DC and DeWille JW. C/EBPdelta is a downstream mediator of IL-6 induced growth inhibition of prostate cancer cells. Prostate 2005; 63:143–154.[CrossRef][Medline] [Order article via Infotrieve]

  23. Huang AM, Montagna C, Sharan S, Ni Y, Ried T, Sterneck E. Loss of CCAAT/enhancer binding protein delta promotes chromosomal instability. Oncogene 2004; 23:1549–1557.[CrossRef][Medline] [Order article via Infotrieve]

  24. Vegesna V, Takeuchi S, Hofmann WK, et al. C/EBP-beta-C/, EBP-delta, PU.1, AML1 genes: mutational analysis in 381 samples of hematopoietic and solid malignancies. Leuk Res 2002; 26:451–457.[CrossRef][Medline] [Order article via Infotrieve]

  25. Esteller M. Aberrant DNA methylation as a cancer-inducing mechanism. Annu Rev Pharmacol Toxicol 2005; 45:629–656.[CrossRef][Medline] [Order article via Infotrieve]

  26. Baylin SB and Herman JG. DNA hypermethylation in tumorigenesis: epigenetics joins genetics. Trends Genet 2000; 16:168–174.[CrossRef][Medline] [Order article via Infotrieve]

  27. Issa JP, Baylin SB, Herman JG. DNA methylation changes in hematologic malignancies: biologic and clinical implications. Leukemia 1997; 11:suppl 1, S7–S11.[Medline] [Order article via Infotrieve]

  28. Chim CS, Liang R, Kwong YL. Hypermethylation of gene promoters in hematological neoplasia. Hematol Oncol 2002; 20:167–176.[CrossRef][Medline] [Order article via Infotrieve]

  29. Herman JG, Civin CI, Issa JP, Collector MI, Sharkis SJ, Baylin SB. Distinct patterns of inactivation of p15INK4B and p16INK4A characterize the major types of hematological malignancies. Cancer Res 1997; 57:837–841.[Abstract/Free Full Text]

  30. Katzenellenbogen RA, Baylin SB, Herman JG. Hypermethylation of the DAP-kinase CpG island is a common alteration in B-cell malignancies. Blood 1999; 93:4347–4353.[Abstract/Free Full Text]

  31. Melki JR, Vincent PC, Brown RD, Clark SJ. Hypermethylation of E-cadherin in leukemia. Blood 2000; 95:3208–3213.[Abstract/Free Full Text]

  32. Ng MH, Chung YF, Lo KW, Wickham NW, Lee JC, Huang DP. Frequent hypermethylation of p16 and p15 genes in multiple myeloma. Blood 1997; 89:2500–2506.[Abstract/Free Full Text]

  33. Xiao L, Yuan X, Sharkis SJ. Activin A maintains self-renewal and regulates fibroblast growth factor, Wnt, and bone morphogenic protein pathways in human embryonic stem cells. Stem Cells 2006; 24:1476–1486.[CrossRef][Medline] [Order article via Infotrieve]

  34. Brazma A, Hingamp P, Quackenbush J, et al. Minimum information about a microarray experiment (MIAME)-toward standards for microarray data. Nat Genet 2001; 29:365–371.[CrossRef][Medline] [Order article via Infotrieve]

  35. Muller-Tidow C, Steffen B, Cauvet T, et al. Translocation products in acute myeloid leukemia activate the Wnt signaling pathway in hematopoietic cells. Mol Cell Biol 2004; 24:2890–2904.[Abstract/Free Full Text]

  36. Muller-Tidow C, Ji P, Diederichs S, et al. The cyclin A1-CDK2 complex regulates DNA double-strand break repair. Mol Cell Biol 2004; 24:8917–2898.[Abstract/Free Full Text]

  37. Tickenbrock L, Schwable J, Strey A, et al. Wnt signaling regulates transendothelial migration of monocytes. J Leukoc Biol 2006; 79:1306–1313.[Abstract/Free Full Text]

  38. Timchenko N, Wilson DR, Taylor LR, et al. Autoregulation of the human C/EBP alpha gene by stimulation of upstream stimulatory factor binding. Mol Cell Biol 1995; 15:1192–1202.[Abstract]

  39. Muller C, Readhead C, Diederichs S, et al. Methylation of the cyclin A1 promoter correlates with gene silencing in somatic cell lines, while tissue-specific expression of cyclin A1 is methylation independent. Mol Cell Biol 2000; 20:3316–3329.[Abstract/Free Full Text]

  40. Mizuki M, Fenski R, Halfter H, et al. Flt3 mutations from patients with acute myeloid leukemia induce transformation of 32D cells mediated by the Ras and STAT5 pathways. Blood 2000; 96:3907–3914.[Abstract/Free Full Text]

  41. Li LC and Dahiya R. MethPrimer: designing primers for methylation PCRs. Bioinformatics 2002; 18:1427–1431.[Abstract/Free Full Text]

  42. Kondo Y, Shen L, Issa JP. Critical role of histone methylation in tumor suppressor gene silencing in colorectal cancer. Mol Cell Biol 2003; 23:206–215.[Abstract/Free Full Text]

  43. Ehrich M, Nelson MR, Stanssens P, et al. Quantitative high-throughput analysis of DNA methylation patterns by base-specific cleavage and mass spectrometry. Proc Natl Acad Sci U S A 2005; 102:15785–15790.[Abstract/Free Full Text]

  44. Mi H, Lazareva-Ulitsky B, Loo R, et al. The PANTHER database of protein families, subfamilies, functions and pathways. Nucleic Acids Res 2005; 33:D284–D288.[Abstract/Free Full Text]

  45. Cho RJ and Campbell MJ. Transcription, genomes, function. Trends Genet 2000; 16:409–415.[CrossRef][Medline] [Order article via Infotrieve]

  46. Duthie SJ. Folic acid deficiency and cancer: mechanisms of DNA instability. Br Med Bull 1999; 55:578–592.[Abstract/Free Full Text]

  47. Friso S and Choi SW. Gene-nutrient interactions in one-carbon metabolism. Curr Drug Metab 2005; 6:37–46.[CrossRef][Medline] [Order article via Infotrieve]

  48. Zaina S, Lindholm MW, Lund G. Nutrition and aberrant DNA methylation patterns in atherosclerosis: more than just hyperhomocysteinemia? J Nutr 2005; 135:5–8.[Abstract/Free Full Text]

  49. Hendrich B and Bird A. Identification and characterization of a family of mammalian methyl-CpG binding proteins. Mol Cell Biol 1998; 18:6538–6547.[Abstract/Free Full Text]

  50. Jurinke C, Oeth P, van den Boom D. MALDI-TOF mass spectrometry: a versatile tool for high-performance DNA analysis. Mol Biotechnol 2004; 26:147–164.[CrossRef][Medline] [Order article via Infotrieve]

  51. Tada Y, Brena RM, Hackanson B, Morrison C, Otterson GA, Plass C. Epigenetic modulation of tumor suppressor CCAAT/enhancer binding protein alpha activity in lung cancer. J Natl Cancer Inst 2006; 98:396–406.[Abstract/Free Full Text]

  52. Mizuki M, Schwable J, Steur C, et al. Suppression of myeloid transcription factors and induction of STAT response genes by AML-specific Flt3 mutations. Blood 2003; 101:3164–3173.[Abstract/Free Full Text]

  53. Krug U, Ganser A, Koeffler HP. Tumor suppressor genes in normal and malignant hematopoiesis. Oncogene 2002; 21:3475–3495.[CrossRef][Medline] [Order article via Infotrieve]

  54. Nerlov C. C/EBPalpha mutations in acute myeloid leukaemias. Nat Rev Cancer 2004; 4:394–400.[CrossRef][Medline] [Order article via Infotrieve]

  55. Das PM and Singal R. DNA methylation and cancer. J Clin Oncol 2004; 22:4632–4642.[Abstract/Free Full Text]

  56. Tang D, Sivko GS, Dewille JW. Promoter methylation reduces C/EBPdelta (CEBPD) gene expression in the SUM-52PE human breast cancer cell line and in primary breast tumors. Breast Cancer Res Treat 2006; 95:161–170.[CrossRef][Medline] [Order article via Infotrieve]

  57. Halmos B, Huettner CS, Kocher O, Ferenczi K, Karp DD, Tenen DG. Down-regulation and antiproliferative role of C/EBPalpha in lung cancer. Cancer Res 2002; 62:528–534.[Abstract/Free Full Text]

  58. Chim CS, Wong AS, Kwong YL. Infrequent hypermethylation of CEBPA promotor in acute myeloid leukaemia. Br J Haematol 2002; 119:988–990.[CrossRef][Medline] [Order article via Infotrieve]

  59. Toyota M, Kopecky KJ, Toyota MO, Jair KW, Willman CL, Issa JP. Methylation profiling in acute myeloid leukemia. Blood 2001; 97:2823–2829.[Abstract/Free Full Text]

  60. Herman JG and Baylin SB. Gene silencing in cancer in association with promoter hypermethylation. N Engl J Med 2003; 349:2042–2054.[Free Full Text]

  61. Sivko GS and DeWille JW. CCAAT/Enhancer binding protein delta (c/EBPdelta) regulation and expression in human mammary epithelial cells: I. "Loss of function" alterations in the c/EBPdelta growth inhibitory pathway in breast cancer cell lines. J Cell Biochem 2004; 93:830–843.[CrossRef][Medline] [Order article via Infotrieve]

  62. Zhang P, Iwasaki-Arai J, Iwasaki H, et al. Enhancement of hematopoietic stem cell repopulating capacity and self-renewal in the absence of the transcription factor C/EBP alpha. Immunity 2004; 21:853–863.[CrossRef][Medline] [Order article via Infotrieve]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
C.-Y. Ko, H.-C. Hsu, M.-R. Shen, W.-C. Chang, and J.-M. Wang
Epigenetic Silencing of CCAAT/Enhancer-binding Protein {delta} Activity by YY1/Polycomb Group/DNA Methyltransferase Complex
J. Biol. Chem., November 7, 2008; 283(45): 30919 - 30932.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Kroeger, J. Jelinek, M. R. H. Estecio, R. He, K. Kondo, W. Chung, L. Zhang, L. Shen, H. M. Kantarjian, C. E. Bueso-Ramos, et al.
Aberrant CpG island methylation in acute myeloid leukemia is accentuated at relapse
Blood, August 15, 2008; 112(4): 1366 - 1373.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Zhou, J. Si, T. Liu, and J. W. DeWille
PIASy Represses CCAAT/Enhancer-binding Protein {delta} (C/EBP{delta}) Transcriptional Activity by Sequestering C/EBP{delta} to the Nuclear Periphery
J. Biol. Chem., July 18, 2008; 283(29): 20137 - 20148.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Muller-Tidow and S. Koschmieder
The hidden faces of C/EBP{beta}
Blood, March 15, 2008; 111(6): 2949 - 2950.
[Full Text] [PDF]


Home page
BloodHome page
B. J. Wouters, M. A. Jorda, K. Keeshan, I. Louwers, C. A. J. Erpelinck-Verschueren, D. Tielemans, A. W. Langerak, Y. He, Y. Yashiro-Ohtani, P. Zhang, et al.
Distinct gene expression profiles of acute myeloid/T-lymphoid leukemia with silenced CEBPA and mutations in NOTCH1
Blood, November 15, 2007; 110(10): 3706 - 3714.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Tables and Figure
Right arrow All Versions of this Article:
blood-2006-08-040147v1
109/9/3895    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Agrawal, S.
Right arrow Articles by Müller-Tidow, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Agrawal, S.
Right arrow Articles by Müller-Tidow, C.
Related Collections
Right arrow Neoplasia
Right arrow Oncogenes and Tumor Suppressors
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2007 by American Society of Hematology         Online ISSN: 1528-0020