| |
|
|
|
|
|
|
|||
|
Blood, 15 September 2007, Vol. 110, No. 6, pp. 2197-2200. Prepublished online as a Blood First Edition Paper on May 23, 2007; DOI 10.1182/blood-2007-04-083162.
STEM CELLS IN HEMATOLOGY
Human multipotent mesenchymal stromal cells inhibit proliferation of PBMCs independently of IFN
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Abstract |
|---|
|
|
|---|
(IFN
)–induced expression of indoleamine 2,3-dioxygenase (IDO). However, IDO inhibitors were not able to restore proliferation of PBMCs in each case. Moreover, human MSCs with an IFN
receptor 1 (R1) defect inhibited proliferation of HLA-mismatched PBMCs to a similar extent as control MSCs. In contrast to healthy MSCs, IFN
R1-deficient MSCs showed no detectable mRNA for IDO—neither in the absence nor in the presence of recombinant human IFN
, nor in coculture with HLA-mismatched PBMCs. Based on gene expression profiling, we were able to show that insulin-like growth factor (IGF)–binding proteins contribute to the inhibitory mechanism of MSCs. Taken together, human MSCs exert important immunomodulatory functions in the absence of IFN
R1 signaling and IDO, partially accounted for by IGF-binding proteins. | Introduction |
|---|
|
|
|---|
(IFN
) has been proposed as a prime candidate for initiation of MSC-mediated immune regulation.9–12 A well-known IFN
-inducible gene in this context is indoleamine 2,3-dioxygenase (IDO).13 IDO initiates degradation of the essential amino acid tryptophan and, in concert with other enzymes, might possibly give rise to metabolites of tryptophan, which inhibit PBMC activation. Blocking this enzyme in cocultures of MSCs and HLA-mismatched PBMCs almost completely abrogated the inhibitory effects of MSCs on the proliferating allogeneic PBMCs.11,12 However, other researchers could not find an effect of IDO in their experimental system.14 Moreover, IFN
itself has also been shown to turn MSCs into antigen-presenting cells.15 Some antiproliferative effects are mediated by insulin-like growth factor–binding proteins (IGFBPs), in particular IGFBP3.16 This family of proteins has been involved in growth inhibition in several experimental settings relevant for the system studied here.17,18 In order to address the relevance of IFN
-induced IDO expression for the inhibitory function of human MSCs in alloresponses, we analyzed human IFN
receptor 1 (R1)—deficient MSCs | Materials and methods |
|---|
|
|
|---|
Cell culture
After informed consent was obtained in accordance with the Declaration of Helsinki, cryoconserved bone marrow aspirates from a boy with a frameshift mutation in the IFN
-R1 subunit of the IFN
receptor were thawed. Control specimens of MSCs were derived from excess material of standard bone marrow biopsies in children treated for leukemia (IRB approval 241/2005V). MSC cultures were established as reported earlier.19 The deletion of a T at position 523 in the IFN
-R1 subunit was verified by conventional sequence analysis of a reverse transcriptase–polymerase chain reaction (RT-PCR) product (data not shown). Plasticity assays and flow cytometry were carried out as described elsewhere (data not shown).20
Proliferation assays
HLA-mismatched PBMCs were obtained from healthy volunteers (IRB approval 279/2003V). PBMCs were stained with CFSE and analyzed by flow cytometry after the incubation times indicated according to standard protocols.19 The PBMCs were stimulated with IL-2 and OKT3 as described previously.19 A total of 75 000 PBMCs were added per well of a 96-well plate (Greiner, Frickenhausen, Germany) already containing 10 000, 20 000, or 30 000 MSCs where indicated. A total of 200 U/mL rhIFN
(R&D Systems, Minneapolis, MN) or 1 mM 1-methyltryptophan (Sigma, München, Germany) was added in specified samples.
RT-PCR
Isolation of RNA from MSCs and conversion to cDNA were performed as described previously.19 PCR amplification was done using the following primer: ß-actin forward: CAGTGGGGATGTCTTCATAA, reverse: AGTCCGCCTAGAAGCA; IDO forward: ATCACCATGGCATATGTGTGGG, reverse: GTGAAACACTTGAAGGGCTTTCTC.
IGFBP affinity chromatography
Briefly, 1 mg rhIGF (kindly provided by Kabi Pharmacia, Erlangen, Germany) was immobilized on a 1 mL High-Trap NHS-activated sepharose column (Amersham, Uppsala, Sweden). Using these columns, media conditioned by cocultures of wild-type MSCs (MSCwt) and PBMCs as well as MSCIFN
R1– and PBMCs was depleted from free IGF-binding proteins. Reduction of IGFBP was monitored by radioimmunoassay (RIA) for IGFBP2 and IGFBP3.
| Results and discussion |
|---|
|
|
|---|
receptor using standard culture conditions.19 We reconfirmed a frameshift mutation (523delT) in subunit 1 of the receptor by PCR sequencing (data not shown). The clinical course with disseminated atypical mycobacteriosis in our patient correlated with this dominant mutation.21,22 In vitro, MSCIFN
R1– did not up-regulate activation markers such as HLA-DR in response to IFN
, in contrast to what is known for MSCwt.15 MSCIFN
R1– showed the same morphology, growth behavior, immunophenotype, and differentiation potential into adipocytes and osteoblasts as MSCwt (data not shown). Immunologic functions of MSCs are typically assessed by the capacity to inhibit proliferation of PBMCs after polyclonal stimulation or in a mixed-lymphocyte reaction. Therefore, MSCwt and MSCIFN
R1– were cocultured with HLA-mismatched PBMCs in the presence of IL-2 and OKT3 as polyclonal stimulators. Based on the literature, one would have expected a stronger inhibition of PBMC proliferation due to IFN
-induced up-regulation of IDO in MSCwt in contrast to MSCIFN
R1–.12 Interestingly, PBMCs were inhibited by both MSCwt and MSCIFN
R1– in a cell-number–dependent fashion (Figure 1A,B). In contrast to the anticipated outcome, PBMCs cocultured with MSCs proliferated even more vigorously in the presence of exogenous IFN
(Figure 1C,D). This was due to a direct stimulation of PBMCs by rhIFN
(data not shown).
|
–responsive gene and known to induce tolerance in vivo. Interestingly, addition of the IDO inhibitor 1-methyltryptophan partially restored the proliferation rate of PBMCs in the presence of IL-2 and OKT3 as well as MSCwt, whereas 1-methyltryptophan had no effect in the cocultures of PBMCs with MSCIFN
R1– (Figure 2A,B). This result indicated that IDO was involved in the inhibition of PBMCs by MSCwt, but not by MSCIFN
R1–. Subsequently, we studied expression of IDO by RT-PCR in MSCwt and MSCIFN
R1–, which were cocultured in a standard proliferation assay with allogeneic PBMCs either in direct cell-cell contact or separated by a semipermeable membrane. Figure 2C shows that IDO expression was indeed completely absent in MSCIFN
R1– in the presence of allogeneic PBMCs and IL-2 and OKT3. Expectedly, exogenously added IFN
did not elicit IDO transcription in these cells either. Nevertheless, MSCIFN
R1– did inhibit proliferation of these allogeneic PBMCs. In conclusion, MSCs can exert immunomodulatory effects in the absence of normal IFN
receptor function and independently of IDO. We compared the gene expression profile of MSCwt and MSCIFN
R1– using the Affymetrix cDNA chips (Affymetrix, Santa Clara, CA). Among other candidate molecules with minor functional effects in our hands, IGFBPs were expressed by both MSCwt and MSCIFN
R1–. Conditioned media from cocultures of PBMCs with MSCwt or MSCIFN
R1–, respectively, was depleted from free IGFBPs by affinity chromatography using immobilized human recombinant IGF. Depletion was monitored exemplarily for IGFBP2 and IGFBP3 by RIA (data not shown). Figure 2D indicates that conditioned media was sufficient to inhibit PBMC proliferation. Depletion of free IGFBPs reduced the inhibitory effect. These results indicate that the IGF/IGFBP system, among other molecules, contribute to the inhibitory effect of MSCs on PBMCs.
|
do not inhibit, but rather stimulate PBMC proliferation, clearly a detailed understanding of the molecular mechanisms would allow a more promising application in patients.15 Obviously, IFN
plays an ambiguous role in various in vitro settings and may be different in vivo. Human MSCs defective in the IFN
receptor were able to inhibit PBMC proliferation. This is striking evidence that IFN
R1-mediated effects of IFN
are dispensable for the inhibitory effect of human MSCs on the proliferation of PBMCs.
The role of IDO and the exact nature of the inhibitory mechanism imposed by IDO beyond depletion of the essential amino acid tryptophan in the current setting is unclear. The rejection of erythropoietin-producing MSCs in the immunocompetent mouse model did already argue against a significant role in MSC-induced inhibition of PBMCs, but in vitro evidence from knock-down or IDO-deficient MSCs of human origin was missing.23 In our experiments, we were able to show that the immunomodulatory effects of human MSCs in vitro were independent of detectable IDO transcription. Taken together, inhibition of PBMC proliferation by human MSCs in vitro is independent of functional IFN
receptor and IDO expression. From expression profiling and functional analyses we obtained evidence that the IGF/IGFBP system is involved in the inhibitory mechanism of human MSCs. The IGF/IGFBP system is known to play a regulatory role in lymphocyte proliferation, where IGF induces proliferation, and IGFBP may inhibit this effect. This effect and others that may play a minor role for human MSCs in vitro may be more important in vivo. Further experiments are under way to analyze the role of IGFs and individual IGFBPs in greater detail.
| Authorship |
|---|
|
|
|---|
Conflict-of-interest disclosure: The authors declare no competing financial interests.
Correspondence: Ingo Müller, University Children's Hospital, Hoppe-Seyler-St 1, 72076 Tübingen, Germany; e-mail: ingo.mueller{at}med.uni-tuebingen.de.
| Acknowledgments |
|---|
This work was supported in part by Deutsche José Carreras Leukämie-Stiftung (DJCLS 05120), Bauer Stiftung zur Förderung von Forschung und Wissenschaft, Förderverein für krebskranke Kinder Tübingen, and DFG-Graduiertenkolleg 794.
| Footnotes |
|---|
Prepublished online as Blood First Edition Paper, May 23, 2007
DOI: 10.1182/blood-2007-04-083162
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 USC section 1734.
| References |
|---|
|
|
|---|
–stimulated marrow stromal cells: a new type of nonhematopoietic antigen-presenting cell. Blood 2006; 107:2570–2577.This article has been cited by other articles:
![]() |
M. A. Haniffa, M. P. Collin, C. D. Buckley, and F. Dazzi Mesenchymal stem cells: the fibroblasts' new clothes? Haematologica, February 1, 2009; 94(2): 258 - 263. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. W Lee, H. Grifka, and S. Yu Gab2 Is a Key Determinant of Mononuclear Phagocyte Development and a Regulator of Macrophage Recruitment in Acute Inflammation Blood (ASH Annual Meeting Abstracts), November 16, 2008; 112(11): 3857 - 3857. [Abstract] |
||||
![]() |
Z. Selmani, A. Naji, I. Zidi, B. Favier, E. Gaiffe, L. Obert, C. Borg, P. Saas, P. Tiberghien, N. Rouas-Freiss, et al. Human Leukocyte Antigen-G5 Secretion by Human Mesenchymal Stem Cells Is Required to Suppress T Lymphocyte and Natural Killer Function and to Induce CD4+CD25highFOXP3+ Regulatory T Cells Stem Cells, January 1, 2008; 26(1): 212 - 222. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2007 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||