Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 15 September 2007, Vol. 110, No. 6, pp. 2197-2200.
Prepublished online as a Blood First Edition Paper on May 23, 2007; DOI 10.1182/blood-2007-04-083162.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
blood-2007-04-083162v1
110/6/2197    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gieseke, F.
Right arrow Articles by Müller, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gieseke, F.
Right arrow Articles by Müller, I.
Related Collections
Right arrow Stem Cells in Hematology
Right arrow Brief Reports
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

STEM CELLS IN HEMATOLOGY

Brief Report

Human multipotent mesenchymal stromal cells inhibit proliferation of PBMCs independently of IFN{gamma}R1 signaling and IDO expression

Friederike Gieseke1, Burkhardt Schütt2, Susanne Viebahn1, Ewa Koscielniak3, Wilhelm Friedrich4, Rupert Handgretinger1, and Ingo Müller1

1 University Children's Hospital, Department of General Pediatrics, Hematology and Oncology, Tübingen; 2 University Children's Hospital, Division of Pediatric Endocrinology, Tübingen; 3 Olga-Hospital, Stuttgart; 4 University Children's Hospital Ulm, Ulm, Germany


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 Authorship
 References
 
Multipotent mesenchymal stromal cells (MSCs) inhibit proliferation, helper, and effector functions in most if not all peripheral blood mononuclear cell (PBMC) subpopulations in vitro. The molecular mechanism is widely thought to imply tryptophan degradation by the interferon-{gamma} (IFN{gamma})–induced expression of indoleamine 2,3-dioxygenase (IDO). However, IDO inhibitors were not able to restore proliferation of PBMCs in each case. Moreover, human MSCs with an IFN{gamma} receptor 1 (R1) defect inhibited proliferation of HLA-mismatched PBMCs to a similar extent as control MSCs. In contrast to healthy MSCs, IFN{gamma}R1-deficient MSCs showed no detectable mRNA for IDO—neither in the absence nor in the presence of recombinant human IFN{gamma}, nor in coculture with HLA-mismatched PBMCs. Based on gene expression profiling, we were able to show that insulin-like growth factor (IGF)–binding proteins contribute to the inhibitory mechanism of MSCs. Taken together, human MSCs exert important immunomodulatory functions in the absence of IFN{gamma}R1 signaling and IDO, partially accounted for by IGF-binding proteins.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 Authorship
 References
 
Human multipotent mesenchymal stromal cells (MSCs) can be readily expanded from bone marrow aspirates by ex vivo culture and characterized by immunophenotype and plasticity.1 These cells maintain plasticity for classical mesenchymal tissues and others to a lesser extent.2 Moreover, expanded MSCs display immunomodulatory properties (ie, inhibition of antigen presentation, maturation of dendritic cells, cytotoxicity of natural killer [NK] cells, and proliferation of peripheral blood mononuclear cells [PBMCs]) in response to polyclonal stimulation or in alloresponses.35 These immunoregulatory features of MSCs led to their clinical application in pediatric and adult patients.68 However, the identity of soluble factors necessary for the inhibition exerted by MSCs remains unclear. Particularly, the type of mitogens used for stimulation of PBMCs may have consequences for the predominant inhibitory pathway engaged by MSC-derived factors.9 Among others, interferon-{gamma} (IFN{gamma}) has been proposed as a prime candidate for initiation of MSC-mediated immune regulation.912 A well-known IFN{gamma}-inducible gene in this context is indoleamine 2,3-dioxygenase (IDO).13 IDO initiates degradation of the essential amino acid tryptophan and, in concert with other enzymes, might possibly give rise to metabolites of tryptophan, which inhibit PBMC activation. Blocking this enzyme in cocultures of MSCs and HLA-mismatched PBMCs almost completely abrogated the inhibitory effects of MSCs on the proliferating allogeneic PBMCs.11,12 However, other researchers could not find an effect of IDO in their experimental system.14 Moreover, IFN{gamma} itself has also been shown to turn MSCs into antigen-presenting cells.15 Some antiproliferative effects are mediated by insulin-like growth factor–binding proteins (IGFBPs), in particular IGFBP3.16 This family of proteins has been involved in growth inhibition in several experimental settings relevant for the system studied here.17,18 In order to address the relevance of IFN{gamma}-induced IDO expression for the inhibitory function of human MSCs in alloresponses, we analyzed human IFN{gamma} receptor 1 (R1)—deficient MSCs


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 Authorship
 References
 
These studies were approved by the Institutional Review Board (IRB) of the University Hospital Tübingen, Germany.

Cell culture

After informed consent was obtained in accordance with the Declaration of Helsinki, cryoconserved bone marrow aspirates from a boy with a frameshift mutation in the IFN{gamma}-R1 subunit of the IFN{gamma} receptor were thawed. Control specimens of MSCs were derived from excess material of standard bone marrow biopsies in children treated for leukemia (IRB approval 241/2005V). MSC cultures were established as reported earlier.19 The deletion of a T at position 523 in the IFN{gamma}-R1 subunit was verified by conventional sequence analysis of a reverse transcriptase–polymerase chain reaction (RT-PCR) product (data not shown). Plasticity assays and flow cytometry were carried out as described elsewhere (data not shown).20

Proliferation assays

HLA-mismatched PBMCs were obtained from healthy volunteers (IRB approval 279/2003V). PBMCs were stained with CFSE and analyzed by flow cytometry after the incubation times indicated according to standard protocols.19 The PBMCs were stimulated with IL-2 and OKT3 as described previously.19 A total of 75 000 PBMCs were added per well of a 96-well plate (Greiner, Frickenhausen, Germany) already containing 10 000, 20 000, or 30 000 MSCs where indicated. A total of 200 U/mL rhIFN{gamma} (R&D Systems, Minneapolis, MN) or 1 mM 1-methyltryptophan (Sigma, München, Germany) was added in specified samples.

RT-PCR

Isolation of RNA from MSCs and conversion to cDNA were performed as described previously.19 PCR amplification was done using the following primer: ß-actin forward: CAGTGGGGATGTCTTCATAA, reverse: AGTCCGCCTAGAAGCA; IDO forward: ATCACCATGGCATATGTGTGGG, reverse: GTGAAACACTTGAAGGGCTTTCTC.

IGFBP affinity chromatography

Briefly, 1 mg rhIGF (kindly provided by Kabi Pharmacia, Erlangen, Germany) was immobilized on a 1 mL High-Trap NHS-activated sepharose column (Amersham, Uppsala, Sweden). Using these columns, media conditioned by cocultures of wild-type MSCs (MSCwt) and PBMCs as well as MSCIFN{gamma}R1– and PBMCs was depleted from free IGF-binding proteins. Reduction of IGFBP was monitored by radioimmunoassay (RIA) for IGFBP2 and IGFBP3.


    Results and discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 Authorship
 References
 
Functional characterization of a protein in vivo is frequently based on knockout experiments in animal models. In the human system, naturally occurring mutations can provide similar information. Hence, we established MSCs from a bone marrow aspirate of a boy with defective IFN{gamma} receptor using standard culture conditions.19 We reconfirmed a frameshift mutation (523delT) in subunit 1 of the receptor by PCR sequencing (data not shown). The clinical course with disseminated atypical mycobacteriosis in our patient correlated with this dominant mutation.21,22 In vitro, MSCIFN{gamma}R1– did not up-regulate activation markers such as HLA-DR in response to IFN{gamma}, in contrast to what is known for MSCwt.15 MSCIFN{gamma}R1– showed the same morphology, growth behavior, immunophenotype, and differentiation potential into adipocytes and osteoblasts as MSCwt (data not shown). Immunologic functions of MSCs are typically assessed by the capacity to inhibit proliferation of PBMCs after polyclonal stimulation or in a mixed-lymphocyte reaction. Therefore, MSCwt and MSCIFN{gamma}R1– were cocultured with HLA-mismatched PBMCs in the presence of IL-2 and OKT3 as polyclonal stimulators. Based on the literature, one would have expected a stronger inhibition of PBMC proliferation due to IFN{gamma}-induced up-regulation of IDO in MSCwt in contrast to MSCIFN{gamma}R1–.12 Interestingly, PBMCs were inhibited by both MSCwt and MSCIFN{gamma}R1– in a cell-number–dependent fashion (Figure 1A,B). In contrast to the anticipated outcome, PBMCs cocultured with MSCs proliferated even more vigorously in the presence of exogenous IFN{gamma} (Figure 1C,D). This was due to a direct stimulation of PBMCs by rhIFN{gamma} (data not shown).


Figure 1
View larger version (21K):
[in this window]
[in a new window]

 
Figure 1. MSCIFN{gamma}R1– and MSCwt inhibit proliferation of PBMCs to a similar extent. (A) Proliferation of HLA-mismatched PBMCs in the absence ({blacksquare}) or presence (sqdiagf) of MSCwt; representative result of 5 independent experiments. MSCs inhibited PBMC proliferation in a dose-dependent manner. (B) PBMCs were inhibited by MSCs with IFN{gamma}R1 defect to a similar extent as by MSCwt (representative of n = 5). (C) Proliferation of HLA-mismatched PBMCs in the absence ({blacksquare}) or presence ({image}) of MSCwt, when human rIFN{gamma} was added to the cultures. PBMCs cocultured with MSCwt proliferated more vigorously in presence of rhIFN{gamma} (representative of n = 5). (D) This effect mediated by rhIFN{gamma} was even stronger when PBMCs were cocultured with MSCIFN{gamma}R1– (representative of n = 3). Data are shown as means of triplicates plus or minus standard deviation (±SD) of one representative experiment.

 
In a second set of experiments we addressed the role of IDO, which is an IFN{gamma}–responsive gene and known to induce tolerance in vivo. Interestingly, addition of the IDO inhibitor 1-methyltryptophan partially restored the proliferation rate of PBMCs in the presence of IL-2 and OKT3 as well as MSCwt, whereas 1-methyltryptophan had no effect in the cocultures of PBMCs with MSCIFN{gamma}R1– (Figure 2A,B). This result indicated that IDO was involved in the inhibition of PBMCs by MSCwt, but not by MSCIFN{gamma}R1–. Subsequently, we studied expression of IDO by RT-PCR in MSCwt and MSCIFN{gamma}R1–, which were cocultured in a standard proliferation assay with allogeneic PBMCs either in direct cell-cell contact or separated by a semipermeable membrane. Figure 2C shows that IDO expression was indeed completely absent in MSCIFN{gamma}R1– in the presence of allogeneic PBMCs and IL-2 and OKT3. Expectedly, exogenously added IFN{gamma} did not elicit IDO transcription in these cells either. Nevertheless, MSCIFN{gamma}R1– did inhibit proliferation of these allogeneic PBMCs. In conclusion, MSCs can exert immunomodulatory effects in the absence of normal IFN{gamma} receptor function and independently of IDO. We compared the gene expression profile of MSCwt and MSCIFN{gamma}R1– using the Affymetrix cDNA chips (Affymetrix, Santa Clara, CA). Among other candidate molecules with minor functional effects in our hands, IGFBPs were expressed by both MSCwt and MSCIFN{gamma}R1–. Conditioned media from cocultures of PBMCs with MSCwt or MSCIFN{gamma}R1–, respectively, was depleted from free IGFBPs by affinity chromatography using immobilized human recombinant IGF. Depletion was monitored exemplarily for IGFBP2 and IGFBP3 by RIA (data not shown). Figure 2D indicates that conditioned media was sufficient to inhibit PBMC proliferation. Depletion of free IGFBPs reduced the inhibitory effect. These results indicate that the IGF/IGFBP system, among other molecules, contribute to the inhibitory effect of MSCs on PBMCs.


Figure 2
View larger version (28K):
[in this window]
[in a new window]

 
Figure 2. MSCwt and MSCIFN{gamma}R1- inhibit proliferation of PBMCs in the absence of IDO—contribution of IGFBPs. Proliferation of HLA-mismatched PBMCs in the absence ({blacksquare}) or presence (sqdiagf) of MSCwt compared with PBMCs in the presence of 1 mM of the IDO inhibitor 1-methyltryptophan ({square}). (A) 1-methyltryptophan partially restored the proliferation of PBMCs cocultured with MSCwt (representative of n = 5). (B) By contrast, 1-methyltryptophan had no effect on cocultures of MSCIFN{gamma}R1– and PBMCs (representative of n = 3). (C) RT-PCR of RNA isolated from MSCs. IDO was not constitutively expressed (lane a) in either MSCwt or MSCIFN{gamma}R1–. IDO was induced in MSCwt when they were cocultured with PBMCs in the presence of IL-2 and OKT3 (lane b, separated by a semipermeable membrane; lane c, in direct cell-cell contact) or when IFN{gamma} was added (lane d) (representative of n = 3). (D) IL-2/OKT3-induced proliferation of PBMCs in media conditioned by PBMCs alone, by cocultures of MSCwt/PBMCs or by MSCIFN{gamma}R1–/PBMCs, respectively, for 3 days. Media conditioned by MSCwt/PBMCs and by MSCIFN{gamma}R1–/PBMCs inhibited proliferation of PBMCs (sqdiagf). Inhibition was partially reverted by depletion of free IGFBP from the media of both cocultures, MSCwt/PBMCs and MSCIFN{gamma}R1–/PBMCs ({square}) (representative of n = 3). Data are shown as means of triplicates (±SD) of one representative experiment.

 
MSCs have elicited great clinical interest as a tool for immune modulation based on the in vitro data. However, in vivo data from mice clearly demonstrated that these effects do not prevent rejection of MHC-mismatched MSCs in an immunocompetent host.23 Despite the expression of IDO, which was found to be involved in induction of tolerance, MSCs were unable to achieve a long-term engraftment.12,13 We and others have demonstrated that clinical application of MSCs can be successful in some, but not all patients who developed severe graft-versus-host disease (GVHD) or hemophagocytosis following allogeneic stem-cell transplantation.7,8 As there are experimental settings where MSCs in the presence of IFN{gamma} do not inhibit, but rather stimulate PBMC proliferation, clearly a detailed understanding of the molecular mechanisms would allow a more promising application in patients.15 Obviously, IFN{gamma} plays an ambiguous role in various in vitro settings and may be different in vivo. Human MSCs defective in the IFN{gamma} receptor were able to inhibit PBMC proliferation. This is striking evidence that IFN{gamma}R1-mediated effects of IFN{gamma} are dispensable for the inhibitory effect of human MSCs on the proliferation of PBMCs.

The role of IDO and the exact nature of the inhibitory mechanism imposed by IDO beyond depletion of the essential amino acid tryptophan in the current setting is unclear. The rejection of erythropoietin-producing MSCs in the immunocompetent mouse model did already argue against a significant role in MSC-induced inhibition of PBMCs, but in vitro evidence from knock-down or IDO-deficient MSCs of human origin was missing.23 In our experiments, we were able to show that the immunomodulatory effects of human MSCs in vitro were independent of detectable IDO transcription. Taken together, inhibition of PBMC proliferation by human MSCs in vitro is independent of functional IFN{gamma} receptor and IDO expression. From expression profiling and functional analyses we obtained evidence that the IGF/IGFBP system is involved in the inhibitory mechanism of human MSCs. The IGF/IGFBP system is known to play a regulatory role in lymphocyte proliferation, where IGF induces proliferation, and IGFBP may inhibit this effect. This effect and others that may play a minor role for human MSCs in vitro may be more important in vivo. Further experiments are under way to analyze the role of IGFs and individual IGFBPs in greater detail.


    Authorship
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 Authorship
 References
 
Contribution: F.G. designed and performed research; B.S. designed and performed research; S.V. performed research; E.K. collected data; W.F. contributed vital new reagents; R.H. wrote the paper; and I.M. designed research and wrote the paper.

Conflict-of-interest disclosure: The authors declare no competing financial interests.

Correspondence: Ingo Müller, University Children's Hospital, Hoppe-Seyler-St 1, 72076 Tübingen, Germany; e-mail: ingo.mueller{at}med.uni-tuebingen.de.


    Acknowledgments
 
We are grateful for experienced technical support by L. Dannecker and M. Pechan.

This work was supported in part by Deutsche José Carreras Leukämie-Stiftung (DJCLS 05120), Bauer Stiftung zur Förderung von Forschung und Wissenschaft, Förderverein für krebskranke Kinder Tübingen, and DFG-Graduiertenkolleg 794.


    Footnotes
 
Submitted April 2, 2007; accepted May 4, 2007.

Prepublished online as Blood First Edition Paper, May 23, 2007 DOI: 10.1182/blood-2007-04-083162

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 USC section 1734.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 Authorship
 References
 

  1. Dominici M, Le Blanc K, Mueller I, et al. Minimal criteria for defining multipotent mesenchymal stromal cells: the International Society for Cellular Therapy position statement. Cytotherapy 2006; 8:315–317.[CrossRef][Medline] [Order article via Infotrieve]

  2. Pittenger MF, Mackay AM, Beck SC, et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999; 284:143–147.[Abstract/Free Full Text]

  3. Le Blanc K. Immunomodulatory effects of fetal and adult mesenchymal stem cells. Cytotherapy 2003; 5:485–489.[CrossRef][Medline] [Order article via Infotrieve]

  4. Aggarwal S and Pittenger MF. Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood 2005; 105:1815–1822.[Abstract/Free Full Text]

  5. Sotiropoulou PA, Perez SA, Gritzapis AD, Baxevanis CN, Papamichail M. Interactions between human mesenchymal stem cells and natural killer cells. Stem Cells 2006; 24:74–85.[CrossRef][Medline] [Order article via Infotrieve]

  6. Le Blanc K, Rasmusson I, Sundberg B, et al. Treatment of severe acute graft-versus-host disease with third party haploidentical mesenchymal stem cells. Lancet 2004; 363:1439–1441.[CrossRef][Medline] [Order article via Infotrieve]

  7. Müller I, Holzwarth C, Kordowich S, et al. Animal-serum free culture conditions of human mesenchymal stromal cells and clinical application of MSC in seven children [abstract]. Bone Marrow Transplant 2006; 37:S21.

  8. Ringden O, Uzunel M, Rasmusson I, et al. Mesenchymal stem cells for treatment of therapy-resistant graft-versus-host disease. Transplantation 2006; 81:1390–1397.[CrossRef][Medline] [Order article via Infotrieve]

  9. Rasmusson I, Ringden O, Sundberg B, Le Blanc K. Mesenchymal stem cells inhibit lymphocyte proliferation by mitogens and alloantigens by different mechanisms. Exp Cell Res 2005; 305:33–41.[CrossRef][Medline] [Order article via Infotrieve]

  10. Kang HS, Habib M, Chan J, et al. A paradoxical role for IFN-gamma in the immune properties of mesenchymal stem cells during viral challenge. Exp Hematol 2005; 33:796–803.[CrossRef][Medline] [Order article via Infotrieve]

  11. Krampera M, Cosmi L, Angeli R, et al. Role for interferon-gamma in the immunomodulatory activity of human bone marrow mesenchymal stem cells. Stem Cells 2006; 24:386–398.[CrossRef][Medline] [Order article via Infotrieve]

  12. Meisel R, Zibert A, Laryea M, et al. Human bone marrow stromal cells inhibit allogeneic T-cell responses by indoleamine 2,3-dioxygenase-mediated tryptophan degradation. Blood 2004; 103:4619–4621.[Abstract/Free Full Text]

  13. Munn DH, Zhou M, Attwood JT, et al. Prevention of allogeneic fetal rejection by tryptophan catabolism. Science 1998; 281:1191–1193.[Abstract/Free Full Text]

  14. Tse WT, Pendleton JD, Beyer WM, Egalka MC, Guinan EC. Suppression of allogeneic T-cell proliferation by human marrow stromal cells: implications in transplantation. Transplantation 2003; 75:389–397.[CrossRef][Medline] [Order article via Infotrieve]

  15. Stagg J, Pommey S, Eliopoulos N, Galipeau J. Interferon-{gamma}–stimulated marrow stromal cells: a new type of nonhematopoietic antigen-presenting cell. Blood 2006; 107:2570–2577.[Abstract/Free Full Text]

  16. Katz J, Nasatzky E, Werner H, Le RD, Shemer J. Tumor necrosis factor alpha and interferon gamma–induced cell growth arrest is mediated via insulin-like growth factor binding protein-3. Growth Horm IGF Res 1999; 9:174–178.[CrossRef][Medline] [Order article via Infotrieve]

  17. Giannella-Neto D, Kamyar A, Sharifi B, et al. Platelet-derived growth factor isoforms decrease insulin-like growth factor I gene expression in rat vascular smooth muscle cells and selectively stimulate the biosynthesis of insulin-like growth factor binding protein 4. Circ Res 1992; 71:646–656.[Abstract/Free Full Text]

  18. Spoerri PE, Caballero S, Wilson SH, Shaw LC, Grant MB. Expression of IGFBP-3 by human retinal endothelial cell cultures: IGFBP-3 involvement in growth inhibition and apoptosis. Invest Ophthalmol Vis Sci 2003; 44:365–369.[Abstract/Free Full Text]

  19. Müller I, Kordowich S, Holzwarth C, et al. Animal serum-free culture conditions for isolation and expansion of multipotent mesenchymal stromal cells from human BM. Cytotherapy 2006; 8:437–444.[CrossRef][Medline] [Order article via Infotrieve]

  20. Müller I, Kustermann-Kuhn B, Holzwarth C, et al. In vitro analysis of multipotent mesenchymal stromal cells as potential cellular therapeutics in neurometabolic diseases in pediatric patients. Exp Hematol 2006; 34:1413–1419.[CrossRef][Medline] [Order article via Infotrieve]

  21. Remus N, Reichenbach J, Picard C, et al. Impaired interferon gamma-mediated immunity and susceptibility to mycobacterial infection in childhood. Pediatr Res 2001; 50:8–13.[Medline] [Order article via Infotrieve]

  22. Roesler J, Horwitz ME, Picard C, et al. Hematopoietic stem cell transplantation for complete IFN-gamma receptor 1 deficiency: a multi-institutional survey. J Pediatr 2004; 145:806–812.[CrossRef][Medline] [Order article via Infotrieve]

  23. Eliopoulos N, Stagg J, Lejeune L, Pommey S, Galipeau J. Allogeneic marrow stromal cells are immune rejected by MHC class I– and class II-mismatched recipient mice. Blood 2005; 106:4057–4065.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
DiabetesHome page
Y. Ding, D. Xu, G. Feng, A. Bushell, R. J. Muschel, and K. J. Wood
Mesenchymal Stem Cells Prevent the Rejection of Fully Allogenic Islet Grafts by the Immunosuppressive Activity of Matrix Metalloproteinase-2 and -9
Diabetes, August 1, 2009; 58(8): 1797 - 1806.
[Abstract] [Full Text] [PDF]


Home page
haematolHome page
M. A. Haniffa, M. P. Collin, C. D. Buckley, and F. Dazzi
Mesenchymal stem cells: the fibroblasts' new clothes?
Haematologica, February 1, 2009; 94(2): 258 - 263.
[Abstract] [Full Text] [PDF]


Home page
ASH ANNUAL MEETING ABSTRACTSHome page
A. W Lee, H. Grifka, and S. Yu
Gab2 Is a Key Determinant of Mononuclear Phagocyte Development and a Regulator of Macrophage Recruitment in Acute Inflammation
Blood (ASH Annual Meeting Abstracts), November 16, 2008; 112(11): 3857 - 3857.
[Abstract]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
blood-2007-04-083162v1
110/6/2197    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gieseke, F.
Right arrow Articles by Müller, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gieseke, F.
Right arrow Articles by Müller, I.
Related Collections
Right arrow Stem Cells in Hematology
Right arrow Brief Reports
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2007 by American Society of Hematology         Online ISSN: 1528-0020