| |
|
|
|
|
|
|
|||
|
Blood, 1 October 2007, Vol. 110, No. 7, pp. 2777-2778.
CORRESPONDENCE Antithrombin Cambridge II (A384S): prevalence in patients of the Paris Thrombosis Study (PATHROS)To the editor:The antithrombin (AT) Cambridge II (A384S), which results from a nucleotide (nt) G > T substitution at position 13268 of the gene (numbering system from Olds et al1), is a variant associated with borderline or mildly reduced antithrombin heparin cofactor activity, but normal immunologic level. This AT variant was initially reported in 4 unrelated heterozygotes, 3 of them being asymptomatic.2 Later, it was found in a cohort of 9669 blood donors in West Scotland in 10 nonrelated individuals (prevalence, 1.14 per 1000); despite former exposure of most of these donors to at-risk situations, only 1 of them had a history of venous thrombosis (VT),3 suggesting that the mutation may be a mild risk factor for VT; haplotype analysis performed in 18 families (including 12 families of blood donors) suggested that the mutation had at most 4 independent origins in the United Kingdom. Recently, Corral et al studied the prevalence of the AT A384S mutation in Spain.4 In this large case-control study of venous thromboembolism (1018 patients/1018 healthy volunteers), the AT Cambridge II was found in 0.2% of volunteers and 1.7% of patients (odds ratio [OR] 9.75; 95% confidence interval [95% CI], 2.2-42.5). The results suggested that the Cambridge II variant may be a prevalent genetic risk factor for VT and the most frequent cause of AT deficiency in European populations. We have investigated the prevalence of this mutation in patients from the case-control Paris Thrombosis Study (PATHROS). Recruitment criteria and the characteristics of this study were previously reported.5 The study was approved by local ethics committee, and all participants gave their informed consent. Briefly, consecutive patients with at least 1 established episode of deep VT or pulmonary embolism were recruited from a university hospital in Paris. A total of 88% of patients were born in Europe. Thrombophilia screening included AT activity measurement (Stachrom ATIII; Diagnostica Stago, Asnières, France). Genotyping for the AT A384S mutation was performed on genomic DNA by amplification-digestion; the exon 6 of the AT gene was amplified by polymerase chain reaction (PCR) using the primers 5'CTGCAGGTAAATGAAGAAGG3' and 5'GGAAGAGGTGCAAAGAATAAG3'; digestion by PvuII (New England Biolabs, Hitchin, United Kingdom) led to changes in size in the amplified wild-type DNA only. Confirmation of the presence of the 384s allele was performed by sequencing. A total of 2 (0.4%) of the 473 patients (95% CI, 0%-1%) were heterozygous for the AT Cambridge II variant, which was therefore significantly less frequent in PATHROS than in the Spanish patients (1.7%; 95% CI, 0.9%-2.4%: P = .02). Both were women who developed only 1 VT, at ages 32 and 75, respectively. Both had normal AT activity. These results suggest a possible heterogeneity in the geographic distribution of the Cambridge II variant, possibly due to a founder effect. Moreover, AT A384S was present in only 10 of 192 probands with AT deficiency who had AT gene sequencing in our laboratory since the year 2000. Altogether, these data do not argue for the AT Cambridge II being a prevalent genetic risk factor for thrombosis or a very frequent cause of AT deficiency in France. Authorship The participating members of the Paris Thrombosis Study are as follows: M. Alhenc-Gelas, J. Emmerich, E. Arnaud, J. N. Fiessinger, M. Aiach, AP-HP Hôpital Broussais and INSERM U428, Paris, France; V. Nicaud, INSERM U258, Paris, France. Conflict-of-interest disclosure: The authors declare no competing financial interests. Correspondence: Martine Alhenc-Gelas, Service d'Hématologie Biologique A, Hôpital Européen Georges Pompidou, 20 rue Leblanc, F75908 Paris cedex 15, France; e-mail: martine.alhenc-gelas{at}egp.aphp.fr.
References
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2007 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||