Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 1 October 2007, Vol. 110, No. 7, pp. 2777-2778.

This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Picard, V.
Right arrow Articles by Alhenc-Gelas, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Picard, V.
Right arrow Articles by Alhenc-Gelas, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

CORRESPONDENCE

Antithrombin Cambridge II (A384S): prevalence in patients of the Paris Thrombosis Study (PATHROS)

To the editor:

The antithrombin (AT) Cambridge II (A384S), which results from a nucleotide (nt) G > T substitution at position 13268 of the gene (numbering system from Olds et al1), is a variant associated with borderline or mildly reduced antithrombin heparin cofactor activity, but normal immunologic level. This AT variant was initially reported in 4 unrelated heterozygotes, 3 of them being asymptomatic.2 Later, it was found in a cohort of 9669 blood donors in West Scotland in 10 nonrelated individuals (prevalence, 1.14 per 1000); despite former exposure of most of these donors to at-risk situations, only 1 of them had a history of venous thrombosis (VT),3 suggesting that the mutation may be a mild risk factor for VT; haplotype analysis performed in 18 families (including 12 families of blood donors) suggested that the mutation had at most 4 independent origins in the United Kingdom.

Recently, Corral et al studied the prevalence of the AT A384S mutation in Spain.4 In this large case-control study of venous thromboembolism (1018 patients/1018 healthy volunteers), the AT Cambridge II was found in 0.2% of volunteers and 1.7% of patients (odds ratio [OR] 9.75; 95% confidence interval [95% CI], 2.2-42.5). The results suggested that the Cambridge II variant may be a prevalent genetic risk factor for VT and the most frequent cause of AT deficiency in European populations.

We have investigated the prevalence of this mutation in patients from the case-control Paris Thrombosis Study (PATHROS). Recruitment criteria and the characteristics of this study were previously reported.5 The study was approved by local ethics committee, and all participants gave their informed consent. Briefly, consecutive patients with at least 1 established episode of deep VT or pulmonary embolism were recruited from a university hospital in Paris. A total of 88% of patients were born in Europe. Thrombophilia screening included AT activity measurement (Stachrom ATIII; Diagnostica Stago, Asnières, France).

Genotyping for the AT A384S mutation was performed on genomic DNA by amplification-digestion; the exon 6 of the AT gene was amplified by polymerase chain reaction (PCR) using the primers 5'CTGCAGGTAAATGAAGAAGG3' and 5'GGAAGAGGTGCAAAGAATAAG3'; digestion by PvuII (New England Biolabs, Hitchin, United Kingdom) led to changes in size in the amplified wild-type DNA only. Confirmation of the presence of the 384s allele was performed by sequencing.

A total of 2 (0.4%) of the 473 patients (95% CI, 0%-1%) were heterozygous for the AT Cambridge II variant, which was therefore significantly less frequent in PATHROS than in the Spanish patients (1.7%; 95% CI, 0.9%-2.4%: P = .02). Both were women who developed only 1 VT, at ages 32 and 75, respectively. Both had normal AT activity.

These results suggest a possible heterogeneity in the geographic distribution of the Cambridge II variant, possibly due to a founder effect. Moreover, AT A384S was present in only 10 of 192 probands with AT deficiency who had AT gene sequencing in our laboratory since the year 2000. Altogether, these data do not argue for the AT Cambridge II being a prevalent genetic risk factor for thrombosis or a very frequent cause of AT deficiency in France.

Authorship

The participating members of the Paris Thrombosis Study are as follows: M. Alhenc-Gelas, J. Emmerich, E. Arnaud, J. N. Fiessinger, M. Aiach, AP-HP Hôpital Broussais and INSERM U428, Paris, France; V. Nicaud, INSERM U258, Paris, France.

Conflict-of-interest disclosure: The authors declare no competing financial interests.

Correspondence: Martine Alhenc-Gelas, Service d'Hématologie Biologique A, Hôpital Européen Georges Pompidou, 20 rue Leblanc, F75908 Paris cedex 15, France; e-mail: martine.alhenc-gelas{at}egp.aphp.fr.

Véronique Picard, Isabelle Présot, Pierre-Yves Scarabin, Martine Aiach, Joseph Emmerich, and Martine Alhenc-Gelas

References

  1. Olds RJ, Lane DA, Chowdhury V, De Stefano V, Leone G, Thein SL. Complete nucleotide sequence of the antithrombin gene: evidence for homologous recombination causing thrombophilia. Biochemistry 1993; 32:4216–24.[CrossRef][Medline] [Order article via Infotrieve]

  2. Perry DJ, Daly M, Harper PL, et al. Antithrombin Cambridge II, 384 Ala to Ser: further evidence of the reactive center loop in the inhibitory function of the serpins. FEBS Lett 1991; 285:248–250.[CrossRef][Medline] [Order article via Infotrieve]

  3. Tait RC, Walker ID, Perry DJ, et al. Prevalence of antithrombin deficiency in the healthy population. Br J Haematol 1994; 87:106–112.[Medline] [Order article via Infotrieve]

  4. Corral J, Hernandez-Espinosa D, Soria JM, et al. Antithrombin Cambridge II (A384S): an underestimated genetic risk factor for venous thrombosis. Blood 2007; 109:4258–4263.[Abstract/Free Full Text]

  5. Alhenc-Gelas M, Arnaud E, Nicaud V, et al. Venous thromboembolic disease and the prothrombin, methylene tetra hydrofolate reductase and factor V genes. Thromb Haemost 1999; 81:506–510.[Medline] [Order article via Infotrieve]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?



This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Picard, V.
Right arrow Articles by Alhenc-Gelas, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Picard, V.
Right arrow Articles by Alhenc-Gelas, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2007 by American Society of Hematology         Online ISSN: 1528-0020