Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
 Blood, 15 October 2007, Vol. 110, No. 8, pp. 3049-3055.
Prepublished online as a Blood First Edition Paper on July 16, 2007; DOI 10.1182/blood-2007-02-074393.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figure
Right arrow All Versions of this Article:
blood-2007-02-074393v1
110/8/3049    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pan, D.
Right arrow Articles by Skoda, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pan, D.
Right arrow Articles by Skoda, R. C.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Red Cells
Right arrow Signal Transduction
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

RED CELLS

Normal erythropoiesis but severe polyposis and bleeding anemia in Smad4-deficient mice

Dejing Pan1, Tibor Schomber1, Christian P. Kalberer1, Luigi M. Terracciano2, Katrin Hafen3, Werner Krenger3, Hui Hao-Shen1, Chuxia Deng4, and Radek C. Skoda1

1 Department of Research, Experimental Hematology, University Hospital Basel, Basel, Switzerland; 2 Department of Pathology, University Hospital Basel, Basel, Switzerland, and Department of Health Sciences, University of Molise, Campobasso, Italy; 3 Department of Clinical-Biological Sciences, Laboratory of Pediatric Immunology, University of Basel and Basel University Children's Hospital (UKBB), Basel, Switzerland; 4 Mammalian Genetics Section, Genetics of Development and Disease Branch, National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK), National Institutes of Health (NIH), Bethesda, MD


   Abstract
Top
 Abstract
Introduction
 Materials and methods
 Results
 Discussion
 Authorship
 References
 
The tumor suppressor Smad4 mediates signaling by the transforming growth factor beta (TGF-ß) superfamily of ligands. Previous studies showed that several TGF-ß family members exert important functions in hematopoiesis. Here, we studied the role of Smad4 in adult murine hematopoiesis using the inducible Mx-Cre/loxP system. Mice with homozygous Smad4 deletion (Smad4{Delta}/{Delta}) developed severe anemia 6 to 8 weeks after induction (mean hemoglobin level 70 g/L). The anemia was not transplantable, as wild-type mice reconstituted with Smad4{Delta}/{Delta} bone marrow cells had normal peripheral blood counts. These mice did not develop an inflammatory disease typical for mice deficient in TGF-ß receptors I and II, suggesting that the suppression of inflammation by TGF-ß is Smad4 independent. The same results were obtained when Smad4 alleles were deleted selectively in hematopoietic cells using the VavCre transgenic mice. In contrast, lethally irradiated Smad4{Delta}/{Delta} mice that received wild-type bone marrow cells developed anemia similar to Smad4{Delta}/{Delta} mice that did not receive a transplant. Liver iron stores were decreased and blood was present in stool, indicating that the anemia was due to blood loss. Multiple polyps in stomach and colon represent a likely source of the bleeding. We conclude that Smad4 is not required for adult erythropoiesis and that anemia is solely the consequence of blood loss.


   Introduction
Top
 Abstract
 Introduction
Materials and methods
 Results
 Discussion
 Authorship
 References
 
The members of the transforming growth factor beta (TGF-ß) superfamily of ligands modulate cell proliferation, differentiation, apoptosis, adhesion, and cell migration.1 These ligands, including TGF-ß, activins, and bone morphogenetic proteins (BMPs), bind cell-surface receptors, classified as type I and II receptors, that contain an intracellular serine/threonine protein kinase domain. Upon ligand activation, the type II and type I receptors form an active ligand-receptor complex that phosphorylates members of the Small mutants (Caenorhabditis elegans) and mothers against the decapentaplegic homolog (Smad) family of proteins. The Smad family members that directly interact with the receptors are called receptor Smads (R-Smad). The type I receptors for TGF-ß, activin, nodal, and myostatin phosphorylate R-Smad2 and 3, whereas the BMPs phosphorylate R-Smad1, 5, and 8. The R-Smads associate with Smad4, also called common partner Smad (co-Smad), and as a complex enter the nucleus to regulate transcription. Smad6 and Smad7 TGF-ß inhibit signaling through multiple mechanisms and are called inhibitory Smads (I-Smad).2

Hematopoiesis is a tightly balanced process consisting of cell self-renewal, differentiation, and apoptosis of hematopoietic cells. The effects of TGF-ß signaling on hematopoiesis are cell and context specific. TGF-ß1 has an inhibitory function in early expansion of committed hematopoietic precursors,3 and BMP4 is implicated in mesoderm induction and hematopoietic commitment during embryogenesis.4 Mice deficient for TGF-ß1 die 3 to 4 weeks after birth due to an inflammatory syndrome,5,6 whereas the knockouts of the TGF-ß receptors I and II are embryonically lethal during midgestation.7,8 Cells taken from embryos deficient for TGF-ß receptors I and II display an increase in erythroid colony-forming cells, consistent with an inhibitory effect of TGF-ß in early expansion of committed hematopoietic precursors.8 Smad1–/– and Smad5–/– mice showed defects of hematopoietic and vascular development.9,10 Smad1 expression is sufficient to expand the number of cells that commit to the hemangioblast fate.11 Smad5 is dispensable for hematopoiesis in the adult mouse.12 Overexpression of Smad7 promotes self-renewal capacity of hematopoietic stem cells (HSCs) in vivo.13

Since Smad4 is necessary for signaling by both the TGF-ß and the BMP families of ligands, Smad4–/– mice could be expected to show severe defects in hematopoiesis. However, Smad4–/– mice die during embryogenesis before the onset of hematopoiesis.14,15 To directly investigate the role of Smad4 in hematopoiesis, we crossed mice with a conditional Smad4 knockout allele (Smad4fl/fl)16 and a strain containing a Cre-recombinase gene controlled by the interferon-inducible Mx1 promoter (Mx-Cre).17 The Mx-Cre–inducible mouse was widely used in studies of hematopoiesis and showed high efficiency of recombination in bone marrow.17,18 Upon induction of Mx-Cre expression, the conditional Smad4fl/fl alleles (fl/fl) recombined to yield dysfunctional Smad4 alleles ({Delta}/{Delta}) and these mice developed severe anemia by 6 to 8 weeks after induction. To inactivate the Smad4fl/fl conditional allele in hematopoietic cells only, we crossed the Smad4 mice to the VavCre strain, which expresses Cre selectively in hematopoietic cells under the control of the Vav promoter.19 We show that erythropoiesis was not directly affected by the loss of Smad4. Rather, anemia is the consequence of blood loss from polyps that rapidly form in the stomach and colon of these mice.


   Materials and methods
Top
 Abstract
 Introduction
 Materials and methods
Results
 Discussion
 Authorship
 References
 
Mice

All mice used in this study were kept under specific pathogen-free conditions and in accordance with Swiss federal regulations. The Smad4fl/fl mice (Figure S1, available on the Blood website; see the Supplemental Materials link at the top of the online article) were crossed with the Mx-Cre mice, which contain Cre recombinase under control of the interferon-inducible Mx1 promoter.16,17 Smad4 mice were genotyped using the primers S1 (ACTTTACAGGATGATGGTTA) and S2 (GGTCAAGCAGATTACAGCAA), which yield a 360-bp fragment for the floxed Smad4 allele (Smad4fl) and 310-bp fragment for the wild-type Smad4 allele (Smad4+), and also in parallel with the primers S3 (GGGCAGCGTAGCATATAAGA) and S4 (GACCCAAACGTCACCTTCAC), which produce a 450-bp fragment for Smad4fl and a 390-bp fragment for Smad4+. The alleles carrying the Cre-induced deletion of Smad4 (Smad4{Delta}) were detected with primer S5 (TCCCACATTCCTCTTAGTTTTGA) and primer S6 (CCAGCTTCTCTGTCCAGGTAGTA), yielding a 500-bp fragment for Smad4{Delta}. The efficiency of the Cre-mediated excision was assessed by Southern blot using a probe generated by the primers CTCGAGTAGGTTAACAAGG and CTTTATATACGCGCTTGGG located in intron 8 and exon 9 of the floxed Smad4 allele (Figure S1). Genotyping of Mx-Cre mice was performed with the primers AGGTGTAGAGAAGGCACTTAGC and CTAATCGCCATCTTCCAGCAGG, which amplify a 300-bp fragment. Mx-Cre expression was induced by the intraperitoneal injection of 300 µg polyinosine-polycytosine (pIpC) 3 times every 2 days. VavCre mice were kindly provided by Dr Dimitris Kioussis.19 These mice were crossed to obtain VavCre;Smad4fl/fl mice. Genotyping of VavCre mice was performed with the primers CTCTGACAGATGCCAGGACA and TGATTTCAGGGATGGACACA, yielding a 500-bp fragment.

Blood analysis

Blood was collected from the tail vein or by cardiac puncture and blood counts were determined by the Advia 120 Hematology Analyzer using the Multispecies Software, version 2.3.01-MS (Bayer, Leverkusen, Germany). The concentration of transferrin in mouse blood plasma was determined by a mouse serum transferrin enzyme-linked immunosorbent assay (ELISA) kit (ADI Alpha Diagnostic, San Antonio, TX). Direct antiglobulin test (DAT) was used for detecting IgG/IgM autoantibodies on the membrane of erythrocytes. Phycoerythrin (PE)– or fluorescein isothiocyanate (FITC)–labeled goat anti–mouse IgG/IgM was from Pharmingen BD (Erembodegen, Belgium). Blood from New Zealand Black (NZB) mice served as positive controls and Smad4fl/fl as negative controls for DAT. Serum erythropoietin levels were measured with the Quantikine Mouse/Rat Epo Immunoassay kit (R&D Systems, Abingdon, United Kingdom).

Red blood cell half-life measurement

Mouse blood cells were labeled by intravenous injection of 3 mg NHS-X-Biotin (Sigma, Deisenhofen, Germany). For analysis, capillary blood obtained by tail puncture was diluted in 3.8% sodium citrate, spun down by 180g, resuspended in 500 µL PBS-FACS buffer (0.5% BSA, 0.02% NaN3), and incubated 30 minutes at 4°C with PE-conjugated streptavidin (Becton Dickinson, Heidelberg, Germany). The cells were centrifuged and the pellet was resuspended in 1 mL PBS-FACS buffer for flow-cytometric analysis on a FACSCalibur (Becton Dickinson) to determine the fraction of labeled red blood cells (RBCs) remaining.

Quantitative reverse transcriptase–polymerase chain reaction (RT-PCR)

Total RNA was isolated from tissue using Trizol (Peqlab, Erlangen, Germany) and reverse transcribed after random hexamer priming using the Omniscript RT kit (Qiagen, Hilden, Germany). Quantitative measurement of gene expression was carried out with SYBR Green PCR master mix on an ABI Prism 7000 (Applied Biosystems, Foster City, CA). The mouse RPL19 mRNA assessed with the primers ATCCGCAAGCCTGTGACTGT and TCGGGCCAGGGTGTTTTT was used for normalization.20 Relative expression values were calculated by the delta-delta cycle threshold ({Delta}{Delta}CT) method using 1 bone marrow sample as a calibrator that was set to the value of 1.21,22 The primer pairs used for quantification of specific mRNAs are listed in Table 1 and were in part described previously.23–25


View this table:
[in this window]
[in a new window]

  		Table 1. Sequences of primers used for quantitative RT-PCR

 
Liver iron analysis

Total iron in the liver tissues was determined by flame atomic absorption spectroscopy under alkaline conditions on a Varian SpectrAA220 spectrometer (Varian, Zug, Switzerland) following solubilization by tetramethylammonium hydroxide.26

Feces analysis

The feces of mice were collected over several weeks with sampling intervals of 3.5 days. The presence of blood in feces was detected by Hemoccult-R (Beckman Coulter, Krefeld, Germany).

Flow cytometry

FITC- and PE-conjugated monoclonal antibodies against TER119, B220, Mac-1, GR-1, CD45.1, CD45.2, and mouse IgG and IgM (Pharmingen, BD, San Diego, CA) were diluted in PBS/1% calf serum and used for staining of single-cell suspensions derived from bone marrow and spleen. In order to get single-cell suspensions, organs were grinded and cells were filtered through 70-µm nylon mesh.

Bone marrow transplantation

Bone marrow cells from femora and tibiae were filtered through 40-µm mesh, and 3 x 106 cells in 200 µL HBSS (1 x Hanks balanced salt solution with 20 mM Hepes buffer) were injected into the tail vein of lethally irradiated (1100 cGy in 2 doses, separated by 3 hours) 7- to 10-week-old recipient mice. Mx-Cre;Smad4fl/fl and control mice received pIpC 10 days before being used as bone marrow donors. C57BL/6SJL-PtprcaPep3b/BoyJ (B6.CD45.1) mice were used as the recipients. In the converse experiment, B6.CD45.1 wild-type donor bone marrow cells were transplanted into irradiated Mx-Cre;Smad4fl/fl or control mice. The recipient mice received pIpC 5 weeks after transplantation. Chimerism of recipient mice was analyzed by flow-cytometric analysis of CD45.1+ and CD45.2+ cells.

Histology

Stomach, small intestine, and colon were isolated, fixed in 4% formalin, and paraffin embedded, and 4-µm sections were stained with hematoxylin and eosin (H&E). The images were viewed and captured with a Leica DMZ75 microscope (Leica, Wetzlar, Germany) and Leica DFC480 R2 camera with 1.0x plan objective, and Zeiss AX10 microscope (Carl Zeiss, Oberkochen, Germany) and Axio CamHR camera objective Plan-Neofluar 2.5x/0.075, Plan-Apochromat 5x/0.16, and Plan-Apochromat 1.0x/0.45. Images were acquired using Leica FireCam software version 1.5 and Axio CamHR version 4.6. Brightness/contrast and color balance were adjusted using Adobe Photoshop Elements 2.0 (Adobe Systems, San Jose, CA).


   Results
Top
 Abstract
 Introduction
 Materials and methods
 Results
Discussion
 Authorship
 References
 
Mice with induced deletion of Smad4 develop severe anemia

Four weeks after Mx-Cre–induced excision of Smad4fl/fl, the resulting Smad4{Delta}/{Delta} mice developed anemia and after 8 weeks the hemoglobin concentration and hematocrit were decreased to 30% of normal values (Figure 1). The mean corpuscular volume (MCV) was unchanged, but the reticulocyte count was strongly increased. The white blood count and platelet levels remained unchanged. The Smad4{Delta}/{Delta} alleles were detectable by PCR in 39 of 40 bone marrow–derived colonies (not shown). The apparent half-life of erythrocytes from Smad4{Delta}/{Delta} mice was reduced to 10 to 12 days, whereas the half-life in Smad4fl/fl control mice was 23 days (data not shown). A direct antiglobulin test showed no evidence for IgM or IgG surface antibodies on erythrocytes from Smad4{Delta}/{Delta} mice, arguing against autoimmune antibody–meditated hemolytic anemia (not shown). The apparent reduction of the erythrocyte half-life in circulation can be explained by compensatory increase in regeneration, marked by massive reticulocytosis (Figure 1) and increased erythropoietin serum levels (> 5000 pg/mL, n = 5; normal range 50-200 pg/mL, n = 4).


Figure 1
View larger version (22K):
[in this window]
[in a new window]

  		Figure 1. Smad4{Delta}/{Delta} mice developed anemia after induced Smad4 deletion. Hemoglobin level, hematocrit, reticulocyte count, leukocyte count, mean corpuscular volume (MCV), and platelet count in Smad4{Delta}/{Delta} (n = 3), Smad4fl/fl (n = 4), and Smad4{Delta}/+ (n = 8) mice were plotted against weeks after induction. The P values were calculated by Student t test. The error bars indicate standard deviation.

 
Smad4 is dispensable for adult murine erythropoiesis

To determine whether the observed anemia was cell autonomous, bone marrow cells from pIpC-induced Mx-Cre;Smad4fl/fl mice and controls were transplanted into lethally irradiated recipient mice. Eight weeks after bone marrow transplantation, the mice were killed and peripheral blood counts were performed (Figure 2). The red blood cell parameters as well as white blood cell counts and platelet levels remained normal (Figure 2). The recipients of Smad4{Delta}/{Delta} bone marrow cells did not show any signs of inflammatory disease typical for knockouts of the TGF-ß receptors (ie, absence of weight loss, leukocytosis, signs of inflammation of the eyes, and upon autopsy absence of organ damage). Chimerism of recipient mice was determined in peripheral blood by assessing the ratio of CD45.2 donor cells to CD45.1 recipient cells by flow cytometry. Both groups of mice displayed a ratio of donor to recipient cells of greater than 100:1 (Table 2). No differences in B cells (B220), T cells (CD3), or myeloid cells (Gr-1) were detected in bone marrow. Deletion of the floxed Smad4 alleles was found by PCR in DNA from peripheral blood cells of the recipient mice (not shown). Thus, anemia was not transplantable with Smad4-deficient bone marrow cells, indicating that Smad4 is dispensable for adult murine erythropoiesis.


Figure 2
View larger version (17K):
[in this window]
[in a new window]

  		Figure 2. Transplantation of Smad4{Delta}/{Delta} bone marrow cells into wild-type recipient mice did not lead to the development of anemia. Hemoglobin level, hematocrit, MCV, reticulocyte count, leukocyte count, and platelet count remained stable in the control and experimental groups. Eight recipients of Smad4{Delta}/{Delta} bone marrow cells and 4 recipients of Smad4fl/fl controls were analyzed 8 weeks after transplantation. Dots represent the values of individual mice; horizontal lines indicate the mean.

 


View this table:
[in this window]
[in a new window]

  		Table 2. Hematopoietic lineage distribution in bone marrow of wild-type recipient mice that received Smad4{Delta}/{Delta} or Smad4fl/fl bone marrow

 
To confirm this observation in a system not depending on transplantation, we generated mice with a hematopoietic-specific deletion of Smad4. The VavCre strain has been shown to excise loxP target sequences in hematopoietic cells only.19 The resulting VavCre;Smad4fl/fl mice had normal blood counts and showed no symptoms of inflammation (Figure 3). We also confirmed complete excision of Smad4 in peripheral blood cells of these mice by PCR (Figure S1E). These results implied that host factors might be causing the anemia phenotype.


Figure 3
View larger version (19K):
[in this window]
[in a new window]

  		Figure 3. Absence of anemia in VavCre;Smad4fl/fl mice. Peripheral blood parameters were determined in 10-week-old mice. VavCre;Smad4fl/fl ({Delta}/{Delta}), VavCre;Smad4fl/+ ({Delta}/+), and Smad4fl/fl (fl/fl). Dots represent the values of individual mice; horizontal lines indicate the mean.

 
Anemia of Smad4{Delta}/{Delta} mice is non–cell-autonomous

To determine if anemia is caused by the host environment, bone marrow from wild-type C57BL/6J mice was transplanted into lethally irradiated Mx-Cre;Smad4fl/fl and Smad4fl/fl control mice. From weeks 2 to 4 after pIpC-induced deletion of Smad4, recipients began developing anemia (Figure 4). Interindividual differences in the severity of anemia were observed in Smad4{Delta}/{Delta} mice. The control Smad4fl/fl recipient mice remained healthy without any changes in blood parameters. These results demonstrate that anemia of Smad4{Delta}/{Delta} mice is caused by alterations outside of the hematopoietic system.


Figure 4
View larger version (23K):
[in this window]
[in a new window]

  		Figure 4. Transplantation of wild-type bone marrow into Smad4{Delta}/{Delta} recipients resulted in anemia. Hemoglobin level, hematocrit, MCV, reticulocyte count, leukocyte count, and platelet count are shown. Three individual Smad4{Delta}/{Delta} recipient mice (#1 [{circ}], #2 [{triangleup}], and #3 [{diamond}]) developed anemia with individual differences in severity and kinetics. *Significant differences at 4 weeks (P ≤ .03; Student t test). The values for the Smad4fl/fl control recipient mice ({blacktriangleup}) are shown as the mean of 6 mice with standard deviation. The error bars indicate standard deviation.

 
Smad4{Delta}/{Delta} mice show severe iron deficiency

The presence of hypochromic erythrocytes at later stages of anemia in Smad4{Delta}/{Delta} mice (Figure 5A) suggested that iron deficiency could be involved in the pathogenesis of anemia. Liver iron in Smad4{Delta}/{Delta} mice 4 weeks after pIpC induction was decreased to 23% (2.6 ± 0.3 µmol/g, n = 6) compared with liver iron of Smad4fl/fl mice (11.5 ± 4.0 µmol/g, n = 6) or wild-type C57BL/6J mice (16.6 ± 4.7 µmol/g, n = 3). No differences in plasma transferrin (Tf), determined by ELISA specific for mouse Tf, were found between Smad4{Delta}/{Delta} mice (1.9 ± 0.2 µg/L, n = 6) and Smad4fl/fl (1.9 ± 0.9 µg/L, n = 10) or wild-type BL6 mice (1.7 ± 0.08 µg/L, n = 3). We determined the expression of genes that are involved in iron metabolism by quantitative PCR (Figure 5B-C). The efficiency of Cre-mediated excision in the livers of Smad4{Delta}/{Delta} mice measured by Southern blot was ranging from 66% to 96% (not shown) and the expression of Smad4 mRNA was severely reduced (Figure 5B). To assure that only the full-length mRNA was measured, the forward primer (Table 1) used for the quantification of the full-length Smad4 mRNA was placed in exon 8, which is deleted by Cre-mediated excision. We also determined the expression of genes involved in the regulation of iron metabolism. Hepcidin (Hepc) mRNA was severely decreased, whereas the expression of divalent metal transporter 1 (Dmt1), cytochrome b reductase 1 (Dcytb), ferroportin 1 (Fpn), and transferrin (Tf) remained unchanged (Figure 5B). In the duodenum, the floxed Smad4 allele was excised by only 4% to 8% (not shown) and Smad4 mRNA was just merely decreased, whereas Dmt1 and Dcytb increased 5- to 50-fold and transferrin receptor 2 (Tfr2) increased 2- to 20-fold (Figure 5C). Other iron-related genes, such as major histocompatibility complex class I–like protein (Hfe), transferrin receptor 1 (Tfr1), hephaestin (Heph), and stimulator of Fe transport (Sft) showed no significant changes in expression (Figure 5C). Taken together, these changes fit well with a state of increased iron uptake and demand.


Figure 5
View larger version (30K):
[in this window]
[in a new window]

  		Figure 5. Smad4{Delta}/{Delta} mice display severe iron deficiency anemia. (A) Hypochromic erythrocytes in Smad4{Delta}/{Delta} mice. Cell volume was plotted against hemoglobin concentration. (Left) Normal control. (Right) Hypochromic red blood cells (< 220 g/L) and volume increase (> 75 fl) due to reticulocytosis in Smad4{Delta}/{Delta}. (B) In liver, Smad4 and hepcidin (Hepc) expression are almost abrogated, and ferroportin 1 (Fpn) is slightly decreased. Cytochrome b reductase 1 (Dcytb), divalent metal transporter 1 (Dmt1), and transferrin (Tf) were unchanged. (C) In duodenum, Smad4, Fpn, hephaestin (Heph), major histocompatibility complex class I–like protein (Hfe), transferrin receptor 1 (Tfr1), and stimulator of Fe transport (Sft) were unchanged, and Dmt1, Dcytb, and transferrin receptor 2 (Tfr2) were dramatically increased. Smad4fl/fl littermates were chosen as controls. The P values were calculated by Student t test.

 
Polyps in stomach and colon cause blood loss in Smad4{Delta}/{Delta} mice

Histopathology of the gastrointestinal (GI) tract of Smad4{Delta}/{Delta} mice revealed polyps in stomach and colon (Figure 6) but less frequently in the small intestine. Most of them were histologically characterized by a branching architecture reminiscent of hyperplastic lesions, mostly with foci of low- and/or high-grade dysplasia. We classified these lesions as mixed hyperplastic/adenomatous polyps. Moreover, "serrated" aspects of the polyps were also detected focally. Additionally, colon polyps frequently displayed cystic changes. None of the gastric or colon polyps fulfilled the criteria of "juvenile polyps," as they lacked the typical histologic features of such lesions (eg, prominent stroma overgrowth).


Figure 6
View larger version (72K):
[in this window]
[in a new window]

  		Figure 6. Stomach and colon polyp formation in Smad4{Delta}/{Delta} mice. The left panel shows a Smad4fl/fl control mouse, right panel shows a Smad4{Delta}/{Delta} mouse. Gross macroscopy of stomach (A,B), histologic hematoxylin-eosin staining of stomach (C-F), and colon (G-J) with magnified view of the boxed areas. Magnifications for A,B: 2.5x; C,D: 50x; E-H: 100x; I,J: 200x.

 
To show that iron deficiency in Smad4{Delta}/{Delta} mice is due to GI bleeding, we collected stool over several weeks and determined the presence of heme by the hemoccult assay (Figure 7). Bleeding was detectable in all mice but with variable onset and duration. In some mice, bleeding started 17 days after pIpC induction of Smad4 deletion, whereas in others the onset was delayed until 31 days. At the time of the first detectable bleeding, the mice did not yet display severe anemia and the severity of anemia did not correlate with the time of onset of bleeding.


Figure 7
View larger version (16K):
[in this window]
[in a new window]

  		Figure 7. Fecal occult blood test in Smad4{Delta}/{Delta} mice. A total of 13 mice were analyzed (numbered in y-axis). Time in weeks after first pIpC injection is shown on the x-axis. Horizontal bars represent the duration of the stool collection; {square}, negative hemoccult tests; and {blacksquare}, positive hemoccult tests.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
Authorship
 References
 
Our results from transplantation of Smad4{Delta}/{Delta} bone marrow into wild-type recipients and deletion of Smad4 selectively in hematopoietic cells in VavCre;Smad4fl/fl mice demonstrate that Smad4 signaling is dispensable for adult erythropoiesis in vivo (Figures 2,3). The red blood cell parameters in peripheral blood were normal. Our study is consistent with the results of an in vitro study that examined cultured human CD34+ hematopoietic stem/progenitor cells under shRNA-mediated Smad4 knock-down.27 We also found normal megakaryopoiesis in our study, arguing that the decrease in circulating platelet counts and increase in megakaryocyte numbers in mice injected with TGF-ß protein in vivo are mediated by Smad4-independent signaling.28 The white blood cell counts of neutrophil, basophil, and eosinophil granulocytes as well as monocytes and lymphocytes were normal. The severe anemia observed in Smad4{Delta}/{Delta} mice is caused by blood loss.

TGF-ß signaling plays an important role in immune surveillance. By producing the immunosuppressive cytokine TGF-ß, tumors may escape from immune surveillance via inhibiting the expression of cytolytic genes.29 TGF-ß receptor II (TBRII) dominant-negative approaches led to autoimmune inflammatory disease and spontaneous T-cell activation.30 Mice with TBRII deletion in bone marrow not only showed increased CD8+ proliferation in vivo but also developed a lethal inflammatory disease,18,31 and the TBRII-deficient cells of hematopoietic origin, most likely T cells, could induce multifocal inflammatory disease in a dominant way. On the contrary, our Smad4{Delta}/{Delta} bone marrow recipients and VavCre;Smad4fl/fl mice were healthy and did not show any signs of inflammatory disease. This result implies that T-cell–mediated suppression of inflammation via TGF-ß signaling is Smad4 independent. It remains to be determined whether this effect is mediated by the traditional TGF-ß pathway with an alternative downstream mediator like TIF1 or by crosstalk with other signaling through MAPK, JNK, PI3K, or other mediators.

Smad4 is a tumor suppressor gene, and Smad4 mutations are frequently detected in pancreatic cancer, colon cancer, gastric polyps, and adenocarcinomas.32–37 Mice heterozygous for the Smad4 knockout appear normal but develop gastrointestinal polyps after a long latency with loss of heterozygosity in the epithelial cells.38,39 Our Smad4{Delta}/{Delta} mice, which have complete excision in bone marrow as well as partially in stomach (10%-50%), started bleeding around day 20 after pIpC induction (Figure 7) and quickly developed a severe anemia and significant polyps in the GI tract without formation of real tumors before they needed to be killed. Ablation of TGF-ß by T-cell–specific overexpression of dominant-negative TBRII could accelerate azoxymethane-induced colon carcinogenesis through increased T-cell production of IL-6.40 Recently, it was reported that T-cell specific deletion of Smad4 leads to spontaneous epithelial tumors throughout the GI tract. Mice in this study displayed weight loss starting 3 months after birth and eventually developed clinical features of systemic illness. In contrast, mice with epithelial-specific deletion of Smad4 remained free of polyps, suggesting that polyp formation and tumorigenesis are induced by Smad4-deficient T cells.41 Our Mx-Cre;Smad4{Delta}/{Delta} mice developed polyps with a much faster kinetics and since they suffered from severe bleeding anemia, we could not examine tumor progression. At age 10 weeks, our VavCre;Smad4fl/fl mice did not yet show any signs of weight loss or systemic disease. Furthermore, when Smad4{Delta}/{Delta} mice were used as recipients for the transplantation of normal bone marrow cells, we observed rapid evolution of anemia (Figure 4). However, we cannot exclude that some host T cells deficient for Smad4 remained functional in these mice.

Recently, shRNA-mediated knockdown of bone morphogenic protein type II receptor (Bmpr2), another member of the TGF-ß receptor family, resulted in severe mucosal hemorrhage, gastrointestinal hyperplasia, and blood loss.42 This phenotype was related to vascular dysmorphogenesis. Other studies suggested that malformed vessels are present in polyps of patients with juvenile polyposis, found exclusively in patients carrying a mutation up to codon 415 of SMAD4.43 In contrast, no malformations of blood vessels were observed in polyps from our Smad4{Delta}/{Delta} mice.

Our Smad4{Delta}/{Delta} mice showed an almost complete loss of hepcidin mRNA expression in liver. This could be due to 2 mechanisms: (1) liver-specific Smad4 deletion results in markedly decreased hepcidin transcription44; and (2) increased erythropoiesis due to anemia suppresses the production of hepcidin.45 In our mice, both mechanisms are likely to be contributing to the strongly suppressed hepcidin expression.

Our results demonstrate that Smad4 is dispensable for adult erythropoiesis and suggest that polyp formation in mice with homozygous deletion of Smad4 is not entirely T-cell dependent. The same results were recently reported by Karlsson et al.46 The Smad4{Delta}/{Delta} mice can be used to further study polyp formation and the interplay between the inflammatory response and alterations in the epithelial cells and the stroma of the GI tract.


   Authorship
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Authorship
References
 
Contribution: D.P. performed research, analyzed data, and wrote the paper; T.S. performed research and analyzed data; C.P.K. performed flow cytometric analysis; L.M.T. performed pathology analysis; K.H. and W.K. performed bone marrow transplantations; H.H.-S. performed genotyping; C.D. analyzed data; and R.C.S. designed research, analyzed data, and wrote the paper.

Conflict-of-interest disclosure: The authors declare no competing financial interests.

Correspondence: Radek C. Skoda, Department of Research, Experimental Hematology, University Hospital Basel, Hebelstrasse 20, 4031 Basel, Switzerland; e-mail: radek.skoda{at}unibas.ch.


   Acknowledgments
 
We thank Martin Hersberger (University Hospital Zürich, Switzerland) for determining iron in liver samples, Alois Gratwohl (Basel) and Andre Tichelli (Basel) for helpful discussions, and Ralph Tiedt (Basel) and Alexandre Theocharides (Basel) for comments on the manuscript. This work was supported by a grant from the Roche Foundation of Anemia Research (RoFAR) (R.C.S. and D.P.).


   Footnotes
 
Submitted February 20, 2007; accepted July 3, 2007.

Prepublished online as Blood First Edition Paper, July 16, 2007 DOI: 10.1182/blood-2007-02-074393

The online version of this article contains a data supplement.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 USC section 1734.


   References
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Authorship
 References
 

  1. Massague J and Gomis RR. The logic of TGFbeta signaling. FEBS Lett 2006; 580:2811–2820.[CrossRef][Medline] [Order article via Infotrieve]

  2. Dong M and Blobe GC. Role of transforming growth factor-beta in hematologic malignancies. Blood 2006; 107:4589–4596.[Abstract/Free Full Text]

  3. Park C, Afrikanova I, Chung YS, et al. A hierarchical order of factors in the generation of FLK1- and SCL-expressing hematopoietic and endothelial progenitors from embryonic stem cells. Development 2004; 131:2749–2762.[Abstract/Free Full Text]

  4. Snyder A, Fraser ST, Baron MH. Bone morphogenetic proteins in vertebrate hematopoietic development. J Cell Biochem 2004; 93:224–232.[CrossRef][Medline] [Order article via Infotrieve]

  5. Shull MM, Ormsby I, Kier AB, et al. Targeted disruption of the mouse transforming growth factor-beta 1 gene results in multifocal inflammatory disease. Nature 1992; 359:693–699.[CrossRef][Medline] [Order article via Infotrieve]

  6. Kulkarni AB, Huh CG, Becker D, et al. Transforming growth factor beta 1 null mutation in mice causes excessive inflammatory response and early death. Proc Natl Acad Sci U S A 1993; 90:770–774.[Abstract/Free Full Text]

  7. Oshima M, Oshima H, Taketo MM. TGF-beta receptor type II deficiency results in defects of yolk sac hematopoiesis and vasculogenesis. Dev Biol 1996; 179:297–302.[CrossRef][Medline] [Order article via Infotrieve]

  8. Larsson J, Goumans MJ, Sjostrand LJ, et al. Abnormal angiogenesis but intact hematopoietic potential in TGF-beta type I receptor-deficient mice. EMBO J 2001; 20:1663–1673.[CrossRef][Medline] [Order article via Infotrieve]

  9. Tremblay KD, Dunn NR, Robertson EJ. Mouse embryos lacking Smad1 signals display defects in extra-embryonic tissues and germ cell formation. Development 2001; 128:3609–3621.[Medline] [Order article via Infotrieve]

  10. Chang H, Huylebroeck D, Verschueren K, Guo Q, Matzuk MM, Zwijsen A. Smad5 knockout mice die at mid-gestation due to multiple embryonic and extraembryonic defects. Development 1999; 126:1631–1642.[Abstract]

  11. Zafonte BT, Liu S, Lynch-Kattman M, et al. Smad1 expands the hemangioblast population within a limited developmental window. Blood 2007; 109:516–523.[Abstract/Free Full Text]

  12. Singbrant S, Moody JL, Blank U, et al. Smad5 is dispensable for adult murine hematopoiesis. Blood 2006; 108:3707–3712.[Abstract/Free Full Text]

  13. Blank U, Karlsson G, Moody JL, et al. Smad7 promotes self-renewal of hematopoietic stem cells. Blood 2006; 108:4246–4254.[Abstract/Free Full Text]

  14. Takaku K, Oshima M, Miyoshi H, Matsui M, Seldin MF, Taketo MM. Intestinal tumorigenesis in compound mutant mice of both Dpc4 (Smad4) and Apc genes. Cell 1998; 92:645–656.[CrossRef][Medline] [Order article via Infotrieve]

  15. Yang X, Li C, Xu X, Deng C. The tumor suppressor SMAD4/DPC4 is essential for epiblast proliferation and mesoderm induction in mice. Proc Natl Acad Sci U S A 1998; 95:3667–3672.[Abstract/Free Full Text]

  16. Yang X, Li C, Herrera PL, Deng CX. Generation of Smad4/Dpc4 conditional knockout mice. Genesis 2002; 32:80–81.[CrossRef][Medline] [Order article via Infotrieve]

  17. Kuhn R, Schwenk F, Aguet M, Rajewsky K. Inducible gene targeting in mice. Science 1995; 269:1427–1429.[Abstract/Free Full Text]

  18. Leveen P, Carlsen M, Makowska A, et al. TGF-beta type II receptor-deficient thymocytes develop normally but demonstrate increased CD8+ proliferation in vivo. Blood 2005; 106:4234–4240.[Abstract/Free Full Text]

  19. de Boer J, Williams A, Skavdis G, et al. Transgenic mice with hematopoietic and lymphoid specific expression of Cre. Eur J Immunol 2003; 33:314–325.[CrossRef][Medline] [Order article via Infotrieve]

  20. Ghilardi N, Li J, Hongo JA, Yi S, Gurney A, de Sauvage FJ. A novel type I cytokine receptor is expressed on monocytes, signals proliferation, and activates STAT-3 and STAT-5. J Biol Chem 2002; 277:16831–16836.[Abstract/Free Full Text]

  21. Livak KJ and Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001; 25:402–408.[CrossRef][Medline] [Order article via Infotrieve]

  22. Kralovics R, Teo SS, Buser AS, et al. Altered gene expression in myeloproliferative disorders correlates with activation of signaling by the V617F mutation of Jak2. Blood 2005; 106:3374–3376.[Abstract/Free Full Text]

  23. Dupic F, Fruchon S, Bensaid M, et al. Duodenal mRNA expression of iron related genes in response to iron loading and iron deficiency in four strains of mice. Gut 2002; 51:648–653.[Abstract/Free Full Text]

  24. Nemeth E, Rivera S, Gabayan V, et al. IL-6 mediates hypoferremia of inflammation by inducing the synthesis of the iron regulatory hormone hepcidin. J Clin Invest 2004; 113:1271–1276.[CrossRef][Medline] [Order article via Infotrieve]

  25. Yamamoto K, Yoshida K, Miyagoe Y, et al. Quantitative evaluation of expression of iron-metabolism genes in ceruloplasmin-deficient mice. Biochim Biophys Acta 2002; 1588:195–202.[Medline] [Order article via Infotrieve]

  26. Murthy L, Menden EE, Eller PM, Petering HG. Atomic absorption determination of zinc, copper, cadmium, and lead in tissues solubilized by aqueous tetramethylammonium hydroxide. Anal Biochem 1973; 53:365–372.[CrossRef][Medline] [Order article via Infotrieve]

  27. He W, Dorn DC, Erdjument-Bromage H, Tempst P, Moore MA, Massague J. Hematopoiesis controlled by distinct TIF1gamma and Smad4 branches of the TGFbeta pathway. Cell 2006; 125:929–941.[CrossRef][Medline] [Order article via Infotrieve]

  28. Carlino JA, Higley HR, Creson JR, Avis PD, Ogawa Y, Ellingsworth LR. Transforming growth factor beta 1 systemically modulates granuloid, erythroid, lymphoid, and thrombocytic cells in mice. Exp Hematol 1992; 20:943–950.[Medline] [Order article via Infotrieve]

  29. Thomas DA and Massague J. TGF-beta directly targets cytotoxic T cell functions during tumor evasion of immune surveillance. Cancer Cell 2005; 8:369–380.[CrossRef][Medline] [Order article via Infotrieve]

  30. Gorelik L and Flavell RA. Abrogation of TGFbeta signaling in T cells leads to spontaneous T cell differentiation and autoimmune disease. Immunity 2000; 12:171–181.[CrossRef][Medline] [Order article via Infotrieve]

  31. Larsson J, Blank U, Helgadottir H, et al. TGF-beta signaling-deficient hematopoietic stem cells have normal self-renewal and regenerative ability in vivo despite increased proliferative capacity in vitro. Blood 2003; 102:3129–3135.[Abstract/Free Full Text]

  32. Hahn SA, Schutte M, Hoque AT, et al. DPC4, a candidate tumor suppressor gene at human chromosome 18q21. 1. Science 1996; 271:350–353.[Abstract]

  33. Nagatake M, Takagi Y, Osada H, et al. Somatic in vivo alterations of the DPC4 gene at 18q21 in human lung cancers. Cancer Res 1996; 56:2718–2720.[Abstract/Free Full Text]

  34. Schutte M, Hruban RH, Hedrick L, et al. DPC4 gene in various tumor types. Cancer Res 1996; 56:2527–2530.[Abstract/Free Full Text]

  35. Maesawa C, Tamura G, Nishizuka S, et al. MAD-related genes on 18q21. 1, Smad2 and Smad4, are altered infrequently in esophageal squamous cell carcinoma. Jpn J Cancer Res 1997; 88:340–343.[CrossRef]

  36. Friedl W, Kruse R, Uhlhaas S, et al. Frequent 4-bp deletion in exon 9 of the SMAD4/MADH4 gene in familial juvenile polyposis patients. Genes Chromosomes Cancer 1999; 25:403–406.[CrossRef][Medline] [Order article via Infotrieve]

  37. Howe JR, Roth S, Ringold JC, et al. Mutations in the SMAD4/DPC4 gene in juvenile polyposis. Science 1998; 280:1086–1088.[Abstract/Free Full Text]

  38. Takaku K, Miyoshi H, Matsunaga A, Oshima M, Sasaki N, Taketo MM. Gastric and duodenal polyps in Smad4 (Dpc4) knockout mice. Cancer Res 1999; 59:6113–6117.[Abstract/Free Full Text]

  39. Xu X, Brodie SG, Yang X, et al. Haploid loss of the tumor suppressor Smad4/Dpc4 initiates gastric polyposis and cancer in mice. Oncogene 2000; 19:1868–1874.[CrossRef][Medline] [Order article via Infotrieve]

  40. Jenkins BJ, Grail D, Nheu T, et al. Hyperactivation of Stat3 in gp130 mutant mice promotes gastric hyperproliferation and desensitizes TGF-beta signaling. Nat Med 2005; 11:845–852.[CrossRef][Medline] [Order article via Infotrieve]

  41. Kim BG, Li C, Qiao W, et al. Smad4 signalling in T cells is required for suppression of gastrointestinal cancer. Nature 2006; 441:1015–1019.[CrossRef][Medline] [Order article via Infotrieve]

  42. Liu D, Wang J, Kinzel B, et al. Dosage-dependent requirement of BMP type II receptor for maintenance of vascular integrity. Blood Prepublished on May 11, 2007, as DOI 10.1182/blood-2006-11-058594.[Abstract/Free Full Text]

  43. Handra-Luca A, Condroyer C, de Moncuit C, et al. Vessels' morphology in SMAD4 and BMPR1A-related juvenile polyposis. Am J Med Genet A 2005; 138:113–117.[Medline] [Order article via Infotrieve]

  44. Wang RH, Li C, Xu X, et al. A role of SMAD4 in iron metabolism through the positive regulation of hepcidin expression. Cell Metab 2005; 2:399–409.[CrossRef][Medline] [Order article via Infotrieve]

  45. Pak M, Lopez MA, Gabayan V, Ganz T, Rivera S. Suppression of hepcidin during anemia requires erythropoietic activity. Blood 2006; 108:3730–3735.[Abstract/Free Full Text]

  46. Karlsson G, Blank U, Moody JL, et al. Smad4 is critical for self-renewal of hematopoietic stem cells. J Exp Med 2007; 204:467–474.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 BloodHome page
R. Tiedt, J. Coers, S. Ziegler, A. Wiestner, H. Hao-Shen, C. Bornmann, J. Schenkel, S. Karakhanova, F. J. de Sauvage, C. W. Jackson, et al.
Pronounced thrombocytosis in transgenic mice expressing reduced levels of Mpl in platelets and terminally differentiated megakaryocytes
Blood, February 19, 2009; 113(8): 1768 - 1777.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figure
Right arrow All Versions of this Article:
blood-2007-02-074393v1
110/8/3049    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pan, D.
Right arrow Articles by Skoda, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pan, D.
Right arrow Articles by Skoda, R. C.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Red Cells
Right arrow Signal Transduction
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2007 by American Society of Hematology         Online ISSN: 1528-0020