Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 15 May 2008, Vol. 111, No. 10, pp. 5215-5222.
Prepublished online as a Blood First Edition Paper on January 3, 2008; DOI 10.1182/blood-2007-09-113092.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figures
Right arrow All Versions of this Article:
blood-2007-09-113092v1
111/10/5215    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kim, J. M.
Right arrow Articles by D'Andrea, A. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, J. M.
Right arrow Articles by D'Andrea, A. D.
Related Collections
Right arrow Red Cells
Right arrowRelated Article in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

RED CELLS

Cell cycle–dependent chromatin loading of the Fanconi anemia core complex by FANCM/FAAP24

Jung Min Kim1, Younghoon Kee1, Allan Gurtan1, and Alan D. D'Andrea1

1 Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Authorship
 References
 
Fanconi anemia (FA) is a genetic disease characterized by congenital abnormalities, bone marrow failure, and cancer susceptibility. A total of 13 FA proteins are involved in regulating genome surveillance and chromosomal stability. The FA core complex, consisting of 8 FA proteins (A/B/C/E/F/G/L/M), is essential for the monoubiquitination of FANCD2 and FANCI. FANCM is a human ortholog of the archaeal DNA repair protein Hef, and it contains a DEAH helicase and a nuclease domain. Here, we examined the effect of FANCM expression on the integrity and localization of the FA core complex. FANCM was exclusively localized to chromatin fractions and underwent cell cycle–dependent phosphorylation and dephosphorylation. FANCM-depleted HeLa cells had an intact FA core complex but were defective in chromatin localization of the complex. Moreover, depletion of the FANCM binding partner, FAAP24, disrupted the chromatin association of FANCM and destabilized FANCM, leading to defective recruitment of the FA core complex to chromatin. Our results suggest that FANCM is an anchor required for recruitment of the FA core complex to chromatin, and that the FANCM/FAAP24 interaction is essential for this chromatin-loading activity. Dysregulated loading of the FA core complex accounts, at least in part, for the characteristic cellular and developmental abnormalities in FA.


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Authorship
 References
 
The 13 identified Fanconi anemia (FA) proteins cooperate in a common cellular pathway regulating the cellular response to DNA cross-linking agents, such as cisplatin (CDDP), diepoxybutane (DEB), and mitomycin C (MMC).1 Of these FA proteins, 8 (A, B, C, E, F, G, L, and M) are assembled into a core complex,2,3 which contains a ubiquitin E3 ligase activity (FANCL subunit)4 and a DNA translocase activity (FANCM).5 In response to DNA damage, or during S-phase progression, the FA core complex coordinately monoubiquitinates 2 downstream substrates, FANCD26,7 and FANCI.810 These monoubiquitinated proteins subsequently translocate to the chromatin where they are believed to interact with additional downstream FA proteins, including FANCJ/BRIP1,1113 FANCD1/BRCA2,14 and FANCN/PALB2.15,16 These downstream proteins then regulate homologous recombination (HR) repair. Disruption of any of the proteins in the FA pathway accounts for the common cellular and clinical phenotype of FA patients.17 How the pathway participates in the process of DNA cross-link repair remains unknown.18 Some FA complementation groups also exhibit additional phenotypic variation, suggesting that some FA genes have functions outside a simple linear FA pathway.1922

The FA core complex may have additional functions beyond the monoubiquitination of FANCD2 and FANCI.8 A FANCD2-Ub linear fusion protein complements the MMC hypersensitivity of Fancd2-deficient chicken cells, but fails to correct the phenotype of FA core complex–deficient cells.23 The FA core complex may therefore have additional activities, such as the recognition of specific DNA substrates, the regulation of the DNA replication machinery, and/or the monoubiquitination of additional (unknown) substrates. These additional functions may be explained, at least in part, by the presence of FA core subcomplexes with variable sizes and variable subcellular distributions.3

When a replication fork encounters an interstrand DNA cross-link during replication, the replication fork arrests near the lesion, resulting in aberrant DNA structures. These abnormal structures activate checkpoint and repair pathways. FA cells, carrying mutations in FA genes, are highly sensitive to DNA cross-linking agents, compared with other DNA-damaging agents, such as ionizing radiation (IR), ultraviolet (UV), and hydroxyurea (HU). This hypersensitivity suggests that some components of the FA core complex may be involved in detecting and binding the DNA lesions caused by treatment of DNA cross-linking agents.

The recently identified FANCM5 and FANCJ1113 proteins suggest a direct involvement of FA proteins at sites of DNA repair. FANCM is homologous to the archaeal protein Hef (helicase-associated endonuclease for fork-structured DNA), and is a member of the XP-F superfamily.24 The N-terminal region of FANCM is able to bind to single-stranded DNA.25 Moreover, FANCM has a DNA-dependent ATPase activity, and it can dissociate DNA triple helices in vitro.5,25 FANCJ/BRIP1, which is thought to play a role downstream in the FA pathway, is a 5' to 3' DNA helicase with substrate specificity toward specific DNA duplexes (Y-shaped DNA). Also, in support of a role for FA proteins in the processing of DNA structures, a recent study demonstrated that recombinant FANCD2 has direct DNA binding activity in vitro.26 Ciccia et al27 reported that recombinant FANCM is directed to branched DNA structures by a novel FA core complex member, FAAP24. Consistent with these studies, some branched DNA structures activate FANCD2 monoubiquitination in vitro.28 Deficiency of either FANCM or FAAP24, but not FANCJ, inhibits FANCD2 monoubiquitination. These results suggest that the DNA-binding affinity of the FANCM/FAAP24 complex may regulate the ubiquitin ligase activity or the localization of the FA core complex.

Here, we show that FANCM recruits the FA core complex to chromatin but is not essential for the assembly of the FA core subunits. Cells depleted of FANCM by siRNA, or cells in which both FANCM alleles are mutated, are defective in the chromatin association of the FA core complex. In addition, we found that the interaction of the FANCM with FAAP24 is required for their stable association in chromatin.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Authorship
 References
 
Cell culture

HeLa cells were maintained in Dulbecco modified Eagle medium (DMEM) with 15% fetal calf serum (FCS). EUFA867 (FANCM-deficient lymphoblasts) and GM02254A.L (wild-type lymphoblasts) were maintained in RPMI-1640 medium with 15% FCS. For generation of FLAG-FANCL HeLa cell lines, pMMP-puro-Flag-FANCL construct was used for the retrovirus production.

Cell synchronization

For synchronization of cells in G1/S phase, HeLa cells were incubated with 2.5 mM thymidine for 18 hours twice with an intervening 10 hours of incubation in fresh medium without thymidine.29 For synchronization of cells in M phase, HeLa cells were incubated with 2.5 mM thymidine for 20 hours, and then incubated for 12 hours with 200 ng/mL nocodazole without thymidine. The cell-cycle synchronization was confirmed by flow cytometry after propidium iodide staining.

Cell extraction and fractionation

For whole-cell extracts, cell pellets were directly lysed with SDS sample buffer. For biochemical cell fractionation, cells were first lysed with 0.1% Triton X-100 CSK buffers (10 mM PIPES [pH 6.8], 100 mM NaCl, 300 mM sucrose, MgCl2, 1 mM EGTA, 1 mM EDTA, 1 mM PMSF, 1 µg/mL leupeptin, 1 µg/mL aprotinin, 50 mM NaF, 0.1 mM NaVO4, and 0.1% Triton X-100) for 5 minutes on ice. After centrifugation (1500g for 5 minutes), the supernatant was labeled "S." The pellet was washed once more with the same buffer and labeled "P."

Antibodies

Rabbit anti-FANCM was kindly provided by Dr Weidong Wang (National Institutes of Health, Baltimore, MD),5 and anti-FAAP24 was kindly provided by Dr Steve West (London Research Institute, London, United Kingdom).27 Rabbit anti-FANCA, anti-FANCG, anti-FANCE antibodies were described previously.30 Affinity-purified anti-FANCG antibody was generated for immunofluorescent (IF) studies. Other reagents used in this study were as follows: anti-FANCJ (Novus, Littleton, CO), anti-FANCD2, monoclonal anti-FLAG M2, M2-agrarose beads and {alpha}-tubulin (Santa Cruz Biotechnology, Santa Cruz, CA), CHK1-p345 (Cell Signaling Technology, Danvers, MA), MUS81 and MCM3 (Bethyl Laboratories, Montgomery, TX), RPA70 (EMD Biosciences, San Diego, CA), Histone H3 (Upstate Biotechnology, Charlottesville, VA), and Orc2 (BD Pharmingen, San Diego, CA).

In addition, a new anti-FANCM antibody was raised against amino acids 1190 to 1273 of FANCM. This polypeptide fused to maltose binding protein was expressed in Escherichia coli and purified as instructed in the manufacturer's protocol (New England Biolabs, Ipswich, MA), prior to antibody generation in New Zealand white rabbits.

Immunoprecipitation

Whole cells were lysed with 0.5% TX-300mCSK containing 300 mM NaCl for 30 minutes on ice. After centrifugation (15 294g for 20 minutes), the supernatant was diluted to 150 mM NaCl before immunoprecipitation. Cell extracts were incubated with 15 µL anti-FLAG M2 agarose overnight at 4°C on a rocker, and washed 3 times with 0.1% TX-150mCSK buffer. The precipitates were analyzed on 3% to 8% Tris-acetate SDS–polyacrylamide gel electrophoresis (PAGE; Invitrogen, Carlsbad, CA).

siRNA transfection

siRNAs were synthesized by Qiagen (Valencia, CA). The target sequences of LacZ, FANCM, FAAP24-1, FAAP24-2, FANCA, and UBE2T are aacgtacgcggaatacttcga, aagctcataaagctctcggaa, attttcgaggatggcttgaca, tgcattctttatgtcaccgaa, cagcgttgagatatcaaagat, and gatctaagttgcctaccttga, respectively. Control siRNA is designed and provided by Qiagen.

MMC survival assay

HeLa cells transfected with siRNAs were seeded in duplicate in 96-well microplates at a density of 400 cells/well in appropriate medium. MMC was added at a final concentration of 0 to 200 nM. Cells were then incubated at 37°C in a 5% CO2 incubator for 5 days, and cell survival was then determined by staining nucleic acids with a proprietary dye (CyQUANT; Molecular Probes, Eugene, OR) and subsequently analyzed by a fluorescence microplate reader (FL x 800; Bio-Tek Instruments, Winooski, VT) according to the manufacturer's protocol. Alternatively, HeLa cells were transfected with the indicated siRNAs for 48 hours, and then exposed to the indicated concentration of MMC for 5 days. Viable cells were counted by trypan blue exclusion.

Immunofluorescence staining

HeLa cells were transfected with siRNAs for 48 hours before seeding into 4-well culture slide at a density of 20 000 cells per well. Cells were pre-extracted with phosphate-buffered saline (PBS) containing 0.3% Triton X-100 for 2 minutes and then fixed with 3.7% paraformaldehyde for 10 minutes on ice. After blocking with 5% goat serum/0.1% NP-40/PBS, the cells were incubated with the affinity purified rabbit polyclonal anti-FANCG antibody (1:400 dilution) overnight at 4°C. The Alexa Fluor 488 goat anti–rabbit IgG (Molecular Probes) was used as a secondary antibody at 1:500 dilution. After incubation with secondary antibody, samples were washed and mounted in Vectashield mounting media with DAPI (Vector Laboratories, Burlingame, CA). Cells were observed with a 63x objective lens (NA 1.4, oil) on a Zeiss Axiovert 200 M microscope (Thornwood, NY) equipped with a CoolSnap HQ camera (Photometrics, Tucson, AZ). Images were acquired and analyzed using SlideBook 4.0 software (Intelligent Imaging Innovations, Denver, CO).

Phosphatase treatment

Cell extracts were incubated with 400 U of {lambda} phosphatase at 30°C for 40 minutes and then analyzed by Western blotting.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Authorship
 References
 
FANCM localizes to chromatin and is phosphorylated following DNA damage

To examine the cellular localization of FANCM, cells were lysed in a low-salt (100 mM NaCl) and detergent-containing buffer, yielding a soluble fraction (S) and an insoluble pellet (P; Figure 1A). The S fraction contained cytoplasmic and nucleoplasmic proteins, and the P fraction contained proteins stably bound to nuclear structure (eg, chromatin and nuclear matrix proteins). FANCM was exclusively detected in the P fractions, and cellular localization did not change following DNA damage with MMC or replication block with HU (Figure 1B). MMC and HU activated phosphorylation of the chromatin-bound FANCM, consistent with previous studies.5 Monoubiquitinated FANCD2 was found primarily in the P fraction, as previously described,31 and FANCA was found in both fractions.


Figure 1
View larger version (28K):
[in this window]
[in a new window]

 
Figure 1. FANCM is detected exclusively in the chromatin-containing fraction. (A) Experimental protocol for cell fractionation described in this study. (B) HeLa cells were treated with MMC (50 ng/mL for 17 hours) and HU (2 mM for 17 hours) and then fractionated into the cytosol and nucleoplasmic fraction (S) and the chromatin-containing fraction (P). (C) HeLa cells were fractionated into S and P as in Figure 1A. The pellet was further extracted with 1% Triton X-100 (lanes 5-8) or 250 mM NaCl (lanes 9-12). After centrifugation, the supernatant and pellet were analyzed by Western blotting. (D) Cell extracts were incubated with lambda phosphatase and immunoblotted for the indicated proteins.

 
The P fraction was further extracted with 1% Triton or 250 mM NaCl (Figure 1C). FANCM was insoluble in 1% Triton (Figure 1C lanes 5-8), whereas more than 70% of FANCM was soluble in 250 mM NaCl (Figure 1C lanes 9-12). After MMC treatment, highly phosphorylated FANCM remained in the pellet after 250 mM NaCl extraction. The FANCM mobility shifts were abolished by treatment with lambda phosphatase (Figure 1D, compare lanes 9-12). These results imply that FANCM stably associates with chromatin and that MMC activates the phosphorylation of FANCM, thus increasing its binding affinity for chromatin.

Phosphorylation of FANCM is dynamically regulated during the cell cycle

To detect possible changes in the association of FANCM with chromatin during the cell cycle (Figure 2A), HeLa cells were synchronized at the G1/S boundary by double thymidine block (Figure 2A lanes 1-7) or in M phase by nocodazole treatment (Figure 2A lanes 8-12). Cells were collected at the indicated time points and fractionated prior to immunoblotting. All FANCM was found in P fractions (chromatin fractions) and no significant changes in FANCM levels were detected during the cell cycle. Monoubiquitinated FANCD2 was found in the P fractions during S phase, consistent with previous studies.31 FANCG levels were found in S and P fractions throughout the cell cycle, although the levels in the chromatin fraction were decreased in mitosis (lanes 8-12), consistent with previous studies indicating that the FA core complex is excluded from condensed mitotic chromosmes.32


Figure 2
View larger version (44K):
[in this window]
[in a new window]

 
Figure 2. FANCM undergoes cell cycle–dependent phosphorylation. (A) Asynchronously growing cells (lane 1), cells arrested in G1/S phase with double thymidine blocking and released into S phase (lanes 2-7), or cells arrested in metaphase with nocodazole and released into G1 phase (lanes 8-12) were fractionated into S and P and immunoblotted for the indicated proteins. Asyn indicates asynchronous cells. Synchrony was monitored by flow cytometric analysis. The SDS-PAGE gel used here was 4% Tris-glycine. (B) Experimental protocol used to prepare cell extracts described in panels C and D. (C) Either exponentially growing Flag-FANCL HeLa cells (Asyn; lanes 1-4), cells released from double thymidine block for 3 hours (S phase; lanes 5-8), or cells arrested in mitotic phase with nocodazole (M phase; lanes 9-12) were fractionated into S100 and S300. As a negative control for immunoprecipitation with FLAG antibody, parental HeLa cells (lanes 13-16) were used. Each fraction was immunoprecipitated with FLAG-M2 agarose beads, and the precipitates were immunoblotted for the indicated proteins. (D) Cells were arrested in the G1/S phase by double thymidine block (lanes 1-4) and released into S phase (lanes 5-16). Alternatively, cells were arrested in mitotic phase with nocodazole (laness 17-20) and fractionated into S100 and S300. Proteins from each fraction were immunoprecipitated with FLAG-M2 agarose beads, and the precipitates were immunoblotted with the indicated antibodies. Note that for the Western blots of Flag-FANCL (fourth row), immunoprecipitation samples were exposed for a shorter time than for input samples. This is indicated by the vertical lines in between. This was necessitated by the fact that the intensity of IgG bands that appeared on immunoprecipitation samples was substantially greater than that of the input Flag-FANCL bands. Entire images come from the identical gel.

 
Mobility shifts of FANCM were observed throughout the cell cycle, and these mobility shifts were removed with lambda phosphatase (Figure S1, available on the Blood website; see the Supplemental Materials link at the top of the online article). These results suggest that all or most of the posttranslational modification of FANCM resulted from phosphorylation. We cannot rule out the possibility of other posttranslational modifications (ie, acetylations, methylations) that may not significantly alter the electrophoretic mobility of FANCM. FANCM was moderately phosphorylated during S phase (Figure 2A lanes 2-6), extensively phosphorylated during mitosis (Figure 2A lanes 7-10), and dephosphorylated after mitotic exit (Figure 2A lanes 11,12). FANCM phosphorylation reached maximum levels during mitosis when FANCD2 monoubiquitination was not detectable and when FANCG levels in chromatin were decreased. These results suggest that hyperphosphorylation of FANCM may negatively regulate the E3 ubiquitin ligase activity of the FA core complex in mitotic cells.

Chromatin localization of FA core complex is regulated in a cell cycle–dependent manner

To investigate the function of FANCM phosphorylation during cell cycle, we examined the assembly of the FA core complex in HeLa cells in either M phase or S phase (Figure 2B-D). For these studies, we used HeLa cells stably expressing an epitope-tagged Flag-FANCL protein. Cells were fractionated into S100 and S300 fractions (Figure 2B), and FA proteins were analyzed. FA core complex protein levels did not vary during cell cycle. Flag FANCL coimmunoprecipitated with FANCM, FANCG, and FANCA in S-phase cells (Figure 2C lanes 5-8); however, in mitotic cells (lanes 9-12), FANCM remained chromatin-bound while FANCG and FANCA still coimmunoprecipitated from the soluble fraction (Figure 2C). To examine the dynamic changes in the interaction between FANCM and remaining FA core proteins during cell cycle, cells were collected at various times after release from G1/S arrest (Figure 2D). At G1/S (Figure 2D lanes 1-4), late S (Figure 2D lanes 13-16), and G2/M (Figure 2D lanes 17-20) phases, an interaction among the FANCM-FANCA-FANCG-FANCL proteins was detected in the soluble fractions. In contrast, in early S (Figure 2D lanes 5-8) and mid-S (Figure 2D lanes 9-12) phases, the interaction was preferentially detected in the insoluble fraction. Taken together, these results confirm that the intact FA core complex is present throughout the cell cycle but is released from the chromatin-bound FANCM protein in mitosis.

FANCM is required for chromatin association of the FA core complex

We next asked whether the stability and nuclear localization of FA core complex is dependent on FANCM (Figure 3). EUFA867 (FANCM-deficient) lymphoblasts and wild-type lymphoblasts were fractionated, and the cellular localization of the FA core complex was determined by immunoblotting (Figure 3A). In EUFA867, the levels of FANCA and FANCG were reduced, and FANCD2 monoubiquitination was not detected. Importantly, FANCA was undetectable in the chromatin-containing fraction compared with wild-type cells. These results demonstrate that FANCM depletion affects the stability and chromatin association of the FA core complex.


Figure 3
View larger version (55K):
[in this window]
[in a new window]

 
Figure 3. The chromatin association of the FA core complex is impaired in FANCM-depleted cells. (A) EUFA867 lymphoblast and wild-type cells (GM02254A.L) were treated with MMC (150 ng/mL for 17 hours) and fractionated into S and P. {alpha}-tubulin and histone H3 are loading controls for S and P fractions, respectively. (B) HeLa cells transfected with the indicated siRNAs were analyzed by immunoblotting to insure FANCM or FANCA protein knockdown. (C) HeLa cells treated with the indicated siRNAs for 72 hours were treated with MMC (50 ng/mL for 17 hours). The whole-cell extracts were immunoblotted for the indicated proteins. The {alpha}-tubulin is a loading control for S fraction, and MCM3 was used as a loading control for P fraction. The crossreactive band are labeled with asterisks in panels A and C. (D) HeLa cells transfected with indicated siRNA for 72 hours were incubated without or with MMC (50 ng/mL for 17 hours) and then stained with anti-FANCG antibody, either without or with 0.3% Triton X-100 pre-extraction before fixation.

 
We next depleted FANCM in HeLa cells by siRNA transfection (Figure 3B). FANCM siRNA efficiently depleted FANCM, and the depletion was sustained for 7 days (Figure S2). In FANCA-depleted HeLa cells, the FANCG level was strongly reduced, confirming that the direct association between FANCA and FANCG is required for their stability.33,34 In contrast, in FANCM-depleted HeLa cells, levels of FANCA and FANCG were not significantly reduced, but the chromatin localization of FANCA, FANCG, and FANCE was disrupted compared with control siRNA–treated cells (Figure 3B,C). There was no change in FANCJ expression levels or cellular localization following FANCM knockdown (Figure 3C). Also, siRNA knockdown of other FA proteins in the FA pathway, such as the E2 enzyme, UBE-2T,35 did not affect localization of the FA core with chromatin (Figure S3).

We next performed immunofluorescence with an anti-FANCG antibody to detect the FA core complex in chromatin (Figure 3D). For this purpose, we generated an affinity-purified anti-FANCG antibody suitable for detecting endogenous FANCG protein in HeLa cells. To our knowledge, this is the first anti-FANCG antibody capable of detecting endogenous FANCG protein by immunofluorescence, as opposed to overexpressed FANCG protein. In the absence of MMC exposure, very little FANCG nuclear staining was observed. Following MMC exposure, increased FANCG nuclear staining was observed; however, this staining did not depend on the presence of the FANCM protein, since siRNA to FANCM did not decrease this staining. We next performed a triton pre-extraction of nuclei, prior to staining with the anti-FANCG antibody. Triton pre-extraction removed FANCG protein that was soluble in the nucleus or was only loosely bound to chromatin. Interestingly, MMC activated the chromatin association of FANCG protein, and siRNA to FANCM decreased this chromatin association. These results further support the hypothesis that FANCM is required for recruitment of FANCG and perhaps other FA core complex proteins to chromatin.

FANCM is not required for assembly or stability of the nucleoplasmic FA core complex

We further examined the assembly of the FA core complex in FANCM-depleted cells (Figure 4). To immunoprecipitate the FA core complex, we again used the stable HeLa cell line expressing Flag-FANCL. Cells transfected with control siRNA or FANCM siRNA were extracted with a high-salt-containing buffer and analyzed by immunoprecipitation (Figure 4A). The amount of FANCA and FANCG coimmunoprecipitated with Flag-FANCL did not differ significantly between control siRNA– and FANCM siRNA–treated cells (Figure 4B). These results demonstrate that FANCM is not essential for assembly of the FA core complex.


Figure 4
View larger version (38K):
[in this window]
[in a new window]

 
Figure 4. FANCM is not essential for the assembly of the FA core complex. (A) Parental HeLa cells (lane 1) and Flag-FANCL HeLa cells (lanes 2,3) transfected with indicated siRNAs for 72 hours were incubated with MMC (50 ng/mL for 17 hours) and harvested and immunoblotted for the indicted protein. (B) Cells treated as in panel A were extracted with 300 mM NaCl-CSK buffer and immunoprecipitated with FLAG-M2 agarose beads. The precipitates (lanes 1-3) and input (lanes 4-6) were immunoblotted for the indicated proteins.

 
The chromatin localization of FAAP24 depends on FANCM

FAAP24 was recently identified as an integral member of the FA core complex.27 FANCM binds directly to FAAP24, and this interaction appears to be mediated by the carboxy terminal domain of FANCM.27 Moreover, FAAP24 exhibited direct DNA-binding activity, and showed preferential binding for branched chain DNA structures mimicking replication forks. Cellular depletion of either FANCM or FAAP24 reduces FANCD2 monoubiquitination. Taken together, these results suggest that FAAP24 (and FANCM) can anchor the FA core complex at stalled replication forks during S phase.

FAAP24 was detected in S and P fractions (Figure 5A). The abundance of FAAP24 was slightly decreased by FANCM depletion (Figure 5A lanes 7-12), and FANCM depletion disrupted the chromatin association of FAAP24 (Figure 5A lanes 8,10,12). In contrast, FANCA depletion did not affect the level or chromatin association of FAAP24, but the level of FANCG was significantly reduced (Figure 5B). These results demonstrate that chromatin-bound FAAP24 associates with FANCM directly, and its localization depends on FANCM but not on other FA core complex subunits.


Figure 5
View larger version (44K):
[in this window]
[in a new window]

 
Figure 5. The chromatin association of FAAP24 depends on FANCM. (A) HeLa cells transfected with control or FANCM siRNA for 72 hours were treated with MMC (50 ng/mL for 17 hours) or HU (2 mM for 17 hours) and harvested. Fractionated extracts were immunoblotted for the indicated proteins. Mus81 was used a loading control for both fractions. (B) HeLa cells transfected with the indicated siRNAs for 72 hours were treated with MMC (50 ng/mL for 17 hours) and harvested. Fractionated extracts were immunoblotted for the indicated proteins. RPA70 was used a loading control for both fractions.

 
FAAP24 depletion reduces the level of FANCM and impairs chromatin association of FANCM

To examine the effect of FAAP24 depletion on FANCM, we used 2 different sets of FAAP24 siRNAs. HeLa cells transfected with siRNAs were fractionated and analyzed by Western blotting (Figure 6A). FAAP24 depletion moderately reduced the level of FANCM, and decreased the monoubiquitination of FANCD2 (Figure 6B). FAAP24 depletion also inhibited FANCM phosphorylation following DNA damage. FAAP24 siRNA also rendered the cells hypersensitive to MMC (Figure S4). Importantly, FAAP24 depletion reduced the level of FANCM in chromatin and disrupted chromatin association of FANCM, resulting in defective chromatin recruitment of FANCA and FANCG (Figure 6C). These results indicate that FAAP24 is required for stable chromatin association and stability of FANCM. The effects of various FA proteins on the chromatin association of the FA core complex are summarized in Figure 7A.


Figure 6
View larger version (37K):
[in this window]
[in a new window]

 
Figure 6. FANCM requires FAAP24 for its stable association in chromatin. (A) HeLa cells were transfected with indicated siRNAs for 72 hours, and then whole-cell extracts were immunoblotted. (B) HeLa cells transfected with indicated siRNAs for 72 hours were treated with MMC (50 ng/mL for 17 hours) or HU (2 mM for 17 hours), and whole-cell extracts were immunoblotted for the indicated proteins. (C) HeLa cells transfected with indicated siRNAs for 72 hours, and then incubated with MMC (50 ng/mL) for 7 hours, 12 hours, and 20 hours. Cells were then extracted and fractionated, and each fraction was immunoblotted for the indicated proteins.

 


Figure 7
View larger version (26K):
[in this window]
[in a new window]

 
Figure 7. Model for the role of FANCM in regulating the FA pathway. (A) HeLa cells silenced for the indicated proteins by siRNA (columns) were analyzed for MMC sensitivity, FANCD2 monoubiquitination, presence of FA core complex, and chromatin localization of FA core complex (rows). + indicates indistinguishable from control siRNA–treated cells; and –, defective. (B) Schematic model describing the function of FANCM in the chromatin recruitment of the FA core complex. The FANCM-FAAP24 complex associates with chromatin throughout the cell cycle. Early in the cell cycle (G1 phase), the FA core (A/B/C/E/F/G/L complex) is assembled but does not associate with FANCM-FAAP24 complex in chromatin. In S phase, phosphorylated FANCM can recruit the FA core complex to chromatin, possibly to replication forks, and induce E3 ubiquitin ligase activity, resulting in monoubiquitination of FANCD2 and FANCI. In G2/M phase, hyperphosphorylated FANCM may promote the release of the FA core complex, and USP1 may deubiquitinate FANCD2 and FANCI monoubiquitination.

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Authorship
 References
 
Previous studies have suggested that FANCM is an essential component of the FA core complex. Lymphoblasts derived from a patient with FA-M (EUFA867) have decreased levels of other FA core complex proteins, such as FANCA and FANCG.5 In contrast, our results show that the FA core complex (A, B, C, E, F, G, and L) is stable and assembled, even when FANCM protein is depleted to undetectable levels by FANCM siRNA.

Taken together, our results indicate that FANCM depletion impairs the association of the FA core complex with chromatin but has no effect on the assembly of the FA core complex. We demonstrated that the chromatin recruitment of FA core complex requires chromatin-bound FANCM, but the assembly of FA core complex does not. There are conflicting reports regarding the role of FANCM in the core complex. FANCM-deficient human lymphoblasts (EUFA867) display reduced levels of FANCA and FANCG protein, compared with wild-type lymphoblasts. In contrast, in FANCM siRNA–treated cells, the levels of FA core complex proteins were not significantly different compared with control siRNA–treated cells. Also, the interaction between FANCA and FANCL is defective in EUFA867, whereas in FANCM siRNA–treated cells, the interaction between these 2 proteins does not differ. This discrepancy can be explained by the following possibilities. First, siRNA-mediated silencing of FANCM may display the acute defects of FANCM depletion, whereas a patient-derived FANCM-mutant lymphoblast cell line, EUFA867, may reflect developmental defects of FANCM deficiency. It should be noted that functional complementation of EUFA867 with FANCM cDNA has not been accomplished yet, suggesting that FANCM may not be the only gene-defective EUFA867. Second, the cellular localization of FANCM may be different between lymphoblasts and fibroblasts, possibly accounting for the different phenotypes resulting from FANCM depletion. Consistent with this possibility, when lymphoblasts such as GM02254A.L (wild-type cells) and EUFA121 (FA-F) were fractionated with the same procedure (Figure 1A), a significant amount of FANCM was detected in the soluble fraction. In contrast, a corrected FANCG mutant fibroblast line, EUFA326 + FANCG, exhibited a similar cellular localization of FANCM to HeLa cells (data not shown). Regardless of the mechanism, our results support a model of regulated interaction of the FA core complex with FANCM.

Previous studies have shown that a complex of FAAP24 and a C-terminal domain of FANCM binds to branched DNA molecules. These studies have led to a model in which the FAAP24 protein recruits the FA core complex to DNA.27 Our results demonstrate that FANCM is constitutively bound to chromatin (Figures 1, 2), and it is tethered to chromatin by the FAAP24 anchor protein. SiRNA disruption of FAAP24 leads to a release of FANCM protein from chromatin (Figure 6C). The FA core complex, in contrast, translocates in and out of the chromatin. These translocation events are highly regulated and depend on FANCM and perhaps on the phosphorylation state of FANCM. The FA core complex associates more strongly with chromatin after DNA damage and during the S phase of the cell cycle. The FA core complex is released from chromatin during mitosis. FA core complex binding to chromatin after DNA damage, or in S phase, depends on the presence of the FANCM protein.

How FANCM regulates the binding of the FA core complex to chromatin is unknown, and several models are possible. First, the FANCM protein may provide a direct "landing pad" for the FA core complex. The increased phosphorylation of FANCM during S phase may account for the direct binding of the FA core complex. Hyperphosphorylation of FANCM in mitosis may account for the release of the FA core complex. Second, the FANCM protein may translocate through replicating DNA during S phase, thus "opening" the chromatin and allowing the FA core complex to load. In this case, the ATPase activity of the FANCM protein, required for the translocase activity of the FANCM protein, may also be required for FA core complex loading.

Consistent with this latter model, FANCM appears to have homology and activity similar to members of the Snf2-family of SF2 helicases.36 Snf2-family proteins can translocate on double-stranded DNA but do not display strand displacement activity typical of a helicase. These proteins can translocate across complex DNA structures during S phase and can load protein complexes. Interestingly, one Snf2-family member, CSB, binds to chromatin and plays a critical role in transcription-coupled DNA repair. CSB recruits a complex of proteins, containing CSA and an E3 ligase,3739 perhaps analogous to the E3 ligase of the FA core complex, ultimately leading to the regulated degradation of CSB. It will be interesting to determine whether the FA core complex binding to FANCM regulates the polyubiquitination and degradation of a subfraction of FANCM.

Several questions are raised regarding the function of FANCM in loading the FA core complex in chromatin. First, it remains unclear whether the FA core complex loads specifically at sites of stalled replication forks after DNA damage or more generally across a wider range of double-helical DNA. Second, it remains unknown whether the ATPase activity of FANCM is critical for core complex loading. Third, it remains unknown how FA core complex loading leads to DNA repair and resolution of DNA interstrand crosslinks.

The properties of FANCM protein described here lead us to propose a model of the FA pathway (summarized schematically in Figure 7B). During S phase, moderately phosphorylated FANCM, interacting with FAAP24, recruits the FA core complex to chromatin, promoting the accumulation and activation of FA core complex and resulting in FANCD2 monoubiquitination. In G2/M phase, FANCM is extensively phosphorylated by unknown kinases, thereby releasing the FA core complex from chromatin and "shutting off" the pathway. At the same stage, the deubiquitinating enzyme, USP1, is activated and deubiquitinates FANCD2 and FANCI. In the subsequent G1 phase, the dephosphorylated FANCM-FAAP24 complex remains in chromatin, and the FA core complex remains in the soluble nuclear fraction.


    Authorship
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Authorship
 References
 
J.M.K. designed and performed entire experiments, analyzed the data, and wrote the manuscript with the direction of A.D.D. Y.H.K. contributed the experiment for Figure 4. A.G. provided the stable cell line and affinity-purified antibody.

Conflict-of-interest disclosure: The authors declare no competing financial interests.

Correspondence: Alan D. D'Andrea, Department of Radiation Oncology, Division of Genomic Stability and DNA Repair, Dana-Farber Cancer Institute, Harvard Medical School, 44 Binney St, Boston, MA 02115; e-mail: alan_dandrea{at}dfci.harvard.edu.


    Acknowledgments
 
We would like to thank Weidong Wang for the human FA-M lymphoblast line (EUFA867) and Steve West for the anti-FAAP24 antibody. We also thank Carrie Ruit for technical assistance.

This work was supported by National Institutes of Health grants DK43889-15, HL52725-13, and U19A1067751-02.


    Footnotes
 
Submitted September 17, 2007; accepted January 1, 2008.

Prepublished online as Blood First Edition Paper, January 3, 2008 DOI: 10.1182/blood-2007-09-113092

An Inside Blood analysis of this article appears at the front of this issue.

The online version of this article contains a data supplement.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 USC section 1734.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Authorship
 References
 

  1. Grompe M, van de Vrugt H. The Fanconi family adds a fraternal twin. Dev Cell. 2007;12:661–662.[CrossRef][Medline] [Order article via Infotrieve]

  2. Medhurst AL, Huber PA, Waisfisz Q, de Winter JP, Mathew CG. Direct interactions of the five known Fanconi anaemia proteins suggest a common functional pathway. Hum Mol Genet. 2001;10:423–429.[Abstract/Free Full Text]

  3. Medhurst AL, Laghmani el H, Steltenpool J, et al. Evidence for subcomplexes in the Fanconi anemia pathway. Blood. 2006;108:2072–2080.[Abstract/Free Full Text]

  4. Meetei AR, de Winter JP, Medhurst AL, et al. A novel ubiquitin ligase is deficient in Fanconi anemia. Nat Genet. 2003;35:165–170.[CrossRef][Medline] [Order article via Infotrieve]

  5. Meetei AR, Medhurst AL, Ling C, et al. A human ortholog of archaeal DNA repair protein Hef is defective in Fanconi anemia complementation group M. Nat Genet. 2005;37:958–963.[CrossRef][Medline] [Order article via Infotrieve]

  6. Garcia-Higuera I, Taniguchi T, Ganesan S, et al. Interaction of the Fanconi anemia proteins and BRCA1 in a common pathway. Mol Cell. 2001;7:249–262.[CrossRef][Medline] [Order article via Infotrieve]

  7. Collis SJ, Barber LJ, Ward JD, Martin JS, Boulton SJ.C. elegans FANCD2 responds to replication stress and functions in interstrand cross-link repair. DNA Repair (Amst). 2006;5:1398–1406.[CrossRef][Medline] [Order article via Infotrieve]

  8. Smogorzewska A, Matsuoka S, Vinciguerra P, et al. Identification of the FANCI protein, a monoubiquitinated FANCD2 paralog required for DNA repair. Cell. 2007;129:289–301.[CrossRef][Medline] [Order article via Infotrieve]

  9. Dorsman JC, Levitus M, Rockx D, et al. Identification of the Fanconi anemia complementation group I gene, FANCI. Cell Oncol. 2007;29:211–218.[Medline] [Order article via Infotrieve]

  10. Sims AE, Spiteri E, Sims RJ 3rd, et al. FANCI is a second monoubiquitinated member of the Fanconi anemia pathway. Nat Struct Mol Biol. 2007;14:564–567.[CrossRef][Medline] [Order article via Infotrieve]

  11. Levitus M, Waisfisz Q, Godthelp BC, et al. The DNA helicase BRIP1 is defective in Fanconi anemia complementation group J. Nat Genet. 2005;37:934–935.[CrossRef][Medline] [Order article via Infotrieve]

  12. Levran O, Attwooll C, Henry RT, et al. The BRCA1-interacting helicase BRIP1 is deficient in Fanconi anemia. Nat Genet. 2005;37:931–933.[CrossRef][Medline] [Order article via Infotrieve]

  13. Litman R, Peng M, Jin Z, et al. BACH1 is critical for homologous recombination and appears to be the Fanconi anemia gene product FANCJ. Cancer Cell. 2005;8:255–265.[CrossRef][Medline] [Order article via Infotrieve]

  14. Howlett NG, Taniguchi T, Olson S, et al. Biallelic inactivation of BRCA2 in Fanconi anemia. Science. 2002;297:606–609.[Abstract/Free Full Text]

  15. Xia B, Dorsman JC, Ameziane N, et al. Fanconi anemia is associated with a defect in the BRCA2 partner PALB2. Nat Genet. 2007;39:159–161.[CrossRef][Medline] [Order article via Infotrieve]

  16. Reid S, Schindler D, Hanenberg H, et al. Biallelic mutations in PALB2 cause Fanconi anemia subtype FA-N and predispose to childhood cancer. Nat Genet. 2007;39:162–164.[CrossRef][Medline] [Order article via Infotrieve]

  17. Kennedy RD, D'Andrea AD. The Fanconi Anemia/BRCA pathway: new faces in the crowd. Genes Dev. 2005;19:2925–2940.[Abstract/Free Full Text]

  18. Dronkert ML, Kanaar R. Repair of DNA interstrand cross-links. Mutat Res. 2001;486:217–247.[Medline] [Order article via Infotrieve]

  19. Berwick M, Satagopan JM, Ben-Porat L, et al. Genetic heterogeneity among Fanconi anemia heterozygotes and risk of cancer. Cancer Res. 2007;67:9591–9596.[Abstract/Free Full Text]

  20. Offit K, Levran O, Mullaney B, et al. Shared genetic susceptibility to breast cancer, brain tumors, and Fanconi anemia. J Natl Cancer Inst. 2003;95:1548–1551.[Abstract/Free Full Text]

  21. Hirsch B, Shimamura A, Moreau L, et al. Association of biallelic BRCA2/FANCD1 mutations with spontaneous chromosomal instability and solid tumors of childhood. Blood. 2004;103:2554–2559.[Abstract/Free Full Text]

  22. Rahman N, Seal S, Thompson D, et al. PALB2, which encodes a BRCA2-interacting protein, is a breast cancer susceptibility gene. Nat Genet. 2007;39:165–167.[CrossRef][Medline] [Order article via Infotrieve]

  23. Matsushita N, Kitao H, Ishiai M, et al. A FancD2-monoubiquitin fusion reveals hidden functions of Fanconi anemia core complex in DNA repair. Mol Cell. 2005;19:841–847.[CrossRef][Medline] [Order article via Infotrieve]

  24. Niedernhofer LJ. The Fanconi anemia signalosome anchor. Mol Cell. 2007;25:487–490.[CrossRef][Medline] [Order article via Infotrieve]

  25. Mosedale G, Niedzwiedz W, Alpi A, et al. The vertebrate Hef ortholog is a component of the Fanconi anemia tumor-suppressor pathway. Nat Struct Mol Biol. 2005;12:763–767.[CrossRef][Medline] [Order article via Infotrieve]

  26. Park WH, Margossian S, Horwitz AA, Simons AM, D'Andrea AD, Parvin JD. Direct DNA binding activity of the fanconi anemia d2 protein. J Biol Chem. 2005;280:23593–23598.[Abstract/Free Full Text]

  27. Ciccia A, Ling C, Coulthard R, et al. Identification of FAAP24, a Fanconi anemia core complex protein that interacts with FANCM. Mol Cell. 2007;25:331–343.[CrossRef][Medline] [Order article via Infotrieve]

  28. Sobeck A, Stone S, Costanzo V, et al. Fanconi anemia proteins are required to prevent accumulation of replication-associated DNA double-strand breaks. Mol Cell Biol. 2006;26:425–437.[Abstract/Free Full Text]

  29. Taniguchi T, Garcia-Higuera I, Andreassen PR, Gregory RC, Grompe M, D'Andrea AD. S-phase-specific interaction of the Fanconi anemia protein, FANCD2, with BRCA1 and RAD51. Blood. 2002;100:2414–2420.[Abstract/Free Full Text]

  30. Taniguchi T, Garcia-Higuera I, Xu B, et al. Convergence of the fanconi anemia and ataxia telangiectasia signaling pathways. Cell. 2002;109:459–472.[CrossRef][Medline] [Order article via Infotrieve]

  31. Montes de Oca R, Andreassen PR, Margossian SP, et al. Regulated interaction of the Fanconi anemia protein, FANCD2, with chromatin. Blood. 2005;105:1003–1009.[Abstract/Free Full Text]

  32. Qiao F, Moss A, Kupfer GM. Fanconi anemia proteins localize to chromatin and the nuclear matrix in a DNA damage- and cell cycle-regulated manner. J Biol Chem. 2001;276:23391–23396.[Abstract/Free Full Text]

  33. Garcia-Higuera I, Kuang Y, Denham J, D'Andrea AD. The fanconi anemia proteins FANCA and FANCG stabilize each other and promote the nuclear accumulation of the Fanconi anemia complex. Blood. 2000;96:3224–3230.[Abstract/Free Full Text]

  34. Kuang Y, Garcia-Higuera I, Moran A, Mondoux M, Digweed M, D'Andrea AD. Carboxy terminal region of the Fanconi anemia protein, FANCG/XRCC9, is required for functional activity. Blood. 2000;96:1625–1632.[Abstract/Free Full Text]

  35. Machida YJ, Machida Y, Chen Y, et al. UBE2T is the E2 in the Fanconi anemia pathway and undergoes negative autoregulation. Mol Cell. 2006;23:589–596.[CrossRef][Medline] [Order article via Infotrieve]

  36. Heyer WD, Li X, Rolfsmeier M, Zhang XP. Rad54: the Swiss Army knife of homologous recombination? Nucleic Acids Res. 2006;34:4115–4125.[Abstract/Free Full Text]

  37. Groisman R, Kuraoka I, Chevallier O, et al. CSA-dependent degradation of CSB by the ubiquitin-proteasome pathway establishes a link between complementation factors of the Cockayne syndrome. Genes Dev. 2006;20:1429–1434.[Abstract/Free Full Text]

  38. Henning KA, Li L, Iyer N, et al. The Cockayne syndrome group A gene encodes a WD repeat protein that interacts with CSB protein and a subunit of RNA polymerase II TFIIH. Cell. 1995;82:555–564.[CrossRef][Medline] [Order article via Infotrieve]

  39. Fousteri M, Vermeulen W, van Zeeland AA, Mullenders LH. Cockayne syndrome A and B proteins differentially regulate recruitment of chromatin remodeling and repair factors to stalled RNA polymerase II in vivo. Mol Cell. 2006;23:471–482.[CrossRef][Medline] [Order article via Infotrieve]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?

Related Article in Blood Online:

FA core complex moves to chromatin
Paula Rio and Juan A. Bueren
Blood 2008 111: 4837-4838. [Full Text] [PDF]



This article has been cited by other articles:


Home page
BloodHome page
T. R. Singh, S. T. Bakker, S. Agarwal, M. Jansen, E. Grassman, B. C. Godthelp, A. M. Ali, C.-h. Du, M. A. Rooimans, Q. Fan, et al.
Impaired FANCD2 monoubiquitination and hypersensitivity to camptothecin uniquely characterize Fanconi anemia complementation group M
Blood, July 2, 2009; 114(1): 174 - 180.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
I. V. Rosado, W. Niedzwiedz, A. F. Alpi, and K. J. Patel
The Walker B motif in avian FANCM is required to limit sister chromatid exchanges but is dispensable for DNA crosslink repair
Nucleic Acids Res., May 21, 2009; (2009) gkp365v1.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
Y. Kee, J. M. Kim, and A. D'Andrea
Regulated degradation of FANCM in the Fanconi anemia pathway during mitosis
Genes & Dev., March 1, 2009; 23(5): 555 - 560.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figures
Right arrow All Versions of this Article:
blood-2007-09-113092v1
111/10/5215    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kim, J. M.
Right arrow Articles by D'Andrea, A. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, J. M.
Right arrow Articles by D'Andrea, A. D.
Related Collections
Right arrow Red Cells
Right arrowRelated Article in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2008 by American Society of Hematology         Online ISSN: 1528-0020